Search Results

Search found 37688 results on 1508 pages for 'site search'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 201/1508 | < Previous Page | 197 198 199 200 201 202 203 204 205 206 207 208  | Next Page >

  • Access control for cross site requests in Internet Explorer

    - by Aleksandar
    I am trying to make an AJAX call from several domains to a single one which will handle the request. Enabling Cross domain in Firefox and Chrome was easy by setting the header on the handling server: header("Access-Control-Allow-Origin: *"); But this doesn't help enabling it in Internet Explorer. When I try: httpreq.send(''); it stops with error Access denied. How can this be enabled in Internet Explorer?

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Database Design for multiple users site

    - by jl
    Hi, I am required to work on a php project that requires the database to cater to multiple users. Generally, the idea is similar to what they have for carbonmade or basecamp, or even wordpress mu. They cater to multiple users, whom are also owners of their accounts. And if they were to cancel/terminate their account, anything on the pages/database would be removed. I am not quite sure how should I design the database? Should it be: separate tables for individual user account separate databases for individual user account or otherwise? Kindly advise me for the best approach to this issue. Thank you very much.

    Read the article

  • Problem creating site using Microsoft Visual Web Developer Express 2008

    - by Peter
    Hi, this is a very newbie question, sorry! I need to create an aspx website based con C# and am calling some webservices based on some DLL's I already have. Beforem purchasing Visual Studio, I decided to try Microsoft Visual Web Developer Express (is this ok?) creating a Web Application ASP.NET based on Visual C#. I created the form to enter the data which is submitted when clicking the process button. At this point I need to call stuff from the DLL, which I have added in the Solution Explorer via Add Reference, selecting the DLL from the COM list. But whenever I run the project, I always get the error "the type or namespace xxx cannot be found - maybe a using directive or assembler directive is missing" when trying to create the object. What is my stupid mistake? Thanks!

    Read the article

  • Architecture of an image hosting site

    - by kamziro
    I'm sure many here are aware of image hosting sites, like imgur, min.us, photobucket etc. Not that I want to develop one, but besides just uploading the file, organising it in some directory somewhere, what architectural considerations are involved in these sites? Especially when there's millions of page views a day (like imgur, I'd imagine) I'm curious about this because it seems that a lot of sites (say, dating websites etc) would be pretty image intensive. Even if it's not for millions of page views, what are some basic architectural requirements of efficient image deliveries online?

    Read the article

  • MSDN Subscription Site Down?

    - by Vaccano
    I am not sure that this is an SO worthy question. (At least it is not like ones I normally ask.) But I can't get my MSDN Subscription to work any more. Is anyone else having this issue? When I log in and select "My Account" I get this: and when I try to download I get this: I have asked other developers that I know and it is broken for them too. But before I go digging into this, it would be nice to know if this is a me/us issue or an everyone issue. Also, if I am breaking the rules by posting this here let me know and I will delete it. Thanks.

    Read the article

  • What are the best practices for avoid xss attacks in a PHP site

    - by rikh
    I have PHP configured so that magic quotes are on and register globals are off. I do my best to always call htmlentities() for anything I am outputing that is derived from user input. I also occasionally seach my database for common things used in xss attached such as... <script What else should I be doing and how can I make sure that the things I am trying to do are always done.

    Read the article

  • How Do I Prevent a XSS Cross-Site Scripting Attack When Using jQueryUI Autocomplete

    - by theschmitzer
    I am checking for XSS vulnerabilities in a web application I am developing. This Rails app uses the h method to sanitize HTML it generates. It does, however, make use of the jQueryUI autocomplete widget (new in latest release), where I don't have control over the generated HTML, and I see tags are not getting escaped there. The data fed to autocomplete is retrieved through a JSON request immediately before display. I Possibilities: 1) Autocomplete has an option to sanitize I don't know about 2) There is an easy way to do this in jQuery I don't know about 3) There is an easy way to do this in a Rails controller I don't know about (where I can't use the h method) 4) Disallow < symbol in the model Sugestions?

    Read the article

  • TFS Template Customization - SharePointPortal site

    - by Adam Jenkin
    I am customizing a Process Template for TFS2008. I am using the "MSF for Agile... v4.2" template as the base template and would like to set the version control settings of the "Project Management" document library todo the following: Major Versions : Enabled Documents must be checked our before they can be edited I'm using the editor GUI provided by the tfs powertools, however it does not appear these settings are available. Is it possible to define these settings in the WssTasks.XML file or do I need to approach this from a different angle.

    Read the article

  • Making my site login "mirror" Facebook login

    - by lawrence
    I've noticed that Huffington Post does this: if you log out of there, it forces you to log out of Facebook as well, and if you log in on Facebook and go back to Huffington Post, it automatically logs you in there as well. Is this a straightforward use of the FB Connect API that I just haven't noticed, or is there some trick?

    Read the article

  • Unable to download .apk via webbrowser from drupal site

    - by ggrell
    I have a drupal-based website where people can log in and see private discussion forums. This is where I want to have my beta testers for my Android application download the beta .apk files. I tested this thoroughly on my Android 1.6 based myTouch 3G, and was able to log in, and download files attached to forum posts without problems. Now comes the interesting part: my testers on Droids and Nexus Ones (Android 2.0.1 and 2.1) were complaining that their downloads are failing. Since I don't have an 2.0 phone, I tried it out in a 2.0 emulator, and lo-and-behold, it didn't work. The download shows the indeterminate progress for a second or two, then shows "Download unsuccessful". Based on what I see in the logs, it is apparent that the server is returning a 404 for the download request from 2.0 browsers. I can download to my desktop and 1.6 phone no problem. The only reason I can think of that the server would return a 404 for a request is that for some reason the credentials or cookies aren't being passed by the download process. Logcat shows: http error 404 for download x Some background: I added the mime type to my .htaccess like this: AddType application/vnd.android.package-archive apk I checked the server logs and see the following for failed downloads: xx.xx.xx.224 - - [28/Jan/2010:20:39:00 -0500] "GET /system/files/grandmajong-beta090.apk HTTP/1.1" 404 - "http://trickybits.com/forums/beta-testing/grandma-jong/latest-version-090-b1" "Mozilla/5.0 (Linux; U; Android 1.6; en-us; sdk Build/Donut) AppleWebKit/528.5+ (KHTML, like Gecko) Version/3.1.2 Mobile Safari/525.20.1"

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • PHP library for keeping your site Indexed by Google Bing etc

    - by Ole Jak
    I need some library which would be able to keep my urls Indexed and described. So I want to say to it something like Index this new url "www.bla-bla.com/new_url" with some key words or something like that. And I want to be soure that If I told my lib about my new URL Google and others will 100% find it As soon as possible and people will be able to find this URL on the web. Do you know any such libs?

    Read the article

  • Asp.net 4.0 site fails because no handler mapped with Classic appPool

    - by AndyV
    When I create a Asp.net app and flip the appPool to "ASP.NET v4.0 Classic" it fails with the following error: HTTP Error 404.17 - Not Found The requested content appears to be script and will not be served by the static file handler. After some searching it seems to be the handler not mapping correctly for the Classic mode but I can't find out where or how to fix that. I have the full .Net 4.0 install with VS2010 and the app works fine if I flip the appPool to Integrated. Also, it's a Windows 7 machine (I'm having the same problem on a Vista box). Thanks in advance. Andy

    Read the article

  • Whats up with cross site Scripting (getJSON) and flickr example

    - by Bernhard
    In past i had read the documentation about getJSON and there is an example with a flickr photo api. (the example with the [pussy]cats :-)). No I ask myself why is it possible, to access flickr directly with this example. Ive tried this by store this code on my local machine - it works but if I use a local copy of jquery i just get an error in firebug like this $ is not defined myurl/test.html Line 11 Does anybody of you have a solution for this paradox thing? This is the documentation url HTTP:api.jquery.com/jQuery.getJSON/ The example isn´t also not working if I store the HTTP:code.jquery.com/jquery-latest.js in my local jquery file. I also dont understand why the request isnt´s visible in Firebug Console Thank you in advance Bernhard

    Read the article

  • Subsonic Simple Repo for high volume site

    - by kjgilla
    Simple Repo has given me a competitive edge in my consulting. I can finish projects much faster than I could in the "cmd.Parameters.Add(param)" days. As things progress on this end im getting into higher volume sites and wondering if Simple Repo is still the way to go. Im wondering what people's experiences have been putting SR into production vs. NHibernate. Any tips or tricks for using SR in production.

    Read the article

  • Ive just created a site! [closed]

    - by Steven Pollock
    Hi i just recently made a website and i need to get decent hits on it! The URL is http://www.aussiebac kpackersclan.net It is a clan website that also has its own gaming tournament ladder system and we want teams to sign up!!! What is the best method of achieving this promotion?

    Read the article

  • Database design for sharing photos site?

    - by javaLearner.java
    I am using php and mysql. If I want to do a sharing photos website, whats the best database design for upload and display photos. This is what I have in mind: domain: |_> photos |_> user Logged in user will upload photo in [http://www.domain.com/user/upload.php] The photos are stored in filesystems, and the path-to-photos stored in database. So, in my photos folder would be like: photos/userA/subfolders+photos, photos/userB/subfolders+photos, photos/userC/subfolders+photos etc Public/others people may view his photo in: [http://www.domain.com/photos/user/?photoid=123] where 123 is the photoid, from there, I will query from database to fetch the path and display the image. My questions: Whats the best database design for photo-sharing website (like flickr)? Will there be any problems if I keep creating new folder in "photos" folder. What if hundreds of thousands users registered? Whats the best practices What size of photos should I keep? Currently I only stored thumbnail (100x100) and (max) 1600x1200 px photos. What others things I should take note when developing photos-sharing website?

    Read the article

  • Integrate forum software into existing Zend site

    - by mrbubblesort
    I've searched around and haven't really found anything on this, so maybe someone here has tried this before. My company already has a website built with Zend, and we'd like to add in a forum as well. All I really need is something that will work with postgresql and has foreign language support (particularly Japanese, but if worst comes to worst, I'll just translate it myself). phpBB fits all my needs though. Is it possible to get the two working together? Or is there another forum software that'll work with Zend? Or is it better to just build the thing from scratch? Thanks!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 197 198 199 200 201 202 203 204 205 206 207 208  | Next Page >