Search Results

Search found 10640 results on 426 pages for 'apache2 module'.

Page 202/426 | < Previous Page | 198 199 200 201 202 203 204 205 206 207 208 209  | Next Page >

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • How to read the file

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file.But I want the file content instead of the file. I know that using the read method we can read the file content. But how to call the read function and how to get the file content. Please help me.

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

  • What is the "proper" method for determining if a swf is running within an AIR application?

    - by Michael Prescott
    I've got a Flex Web project and a Flex AIR project that use a common code-base. The common code defines several run-time loaded Flex Modules. I want the Flex Modules to behave differently depending on whether the running base application is WEB or AIR. What is the proper method for determining from the module code whether the module is running in a WEB or AIR application? (I found that Security.sandboxType.toString() returns "application", but I haven't found anything better in the documentation, yet.)

    Read the article

  • Opencart SEO URL

    - by user2483877
    My question is, I have installed the SEO component successfully, and its working well but; On homepage, the Latest Products module shows the url like http://www.domain.com/product-21.html On category page, the product shows the url like http://www.domain.com/category/product-21.html I want to put the category URL in the latest products module so it will be the same as on category page. Does anybody have any ideas about this?

    Read the article

  • Behaviour difference Dim oDialog1 as Dialog1 = New Dialog1 VS Dim oDialog1 as Dialog1 = Dialog1

    - by user472722
    VB.Net 2005 I have a now closed Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = New Dialog1. VB.Net 2008 I have a still open Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = Dialog1. VB.Net 2005 does not compile using Dim oDialog1 as Dialog1 = Dialog1 and insists on NEW What is going on and why do I need the different initialisation syntax?

    Read the article

  • Python: saving and loading a class definition

    - by Peterstone
    Hi! I am interested in saving and load objects using the pickle module as you can read in a question I asked before: Python: Errors saving and loading objects with pickle module Someone commment: 1, In an other way: the error is raise because pickle wanted to load an instance of the class Fruits and search for the class definition where it was defined, but it didn't find it so it raise the error Now I want to save and load a class definition in order to solve the problem I describe in the question mentioned before. Thank you so much!

    Read the article

  • How can I read a file's contents directly with Perl's Net::FTP?

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file. But I want the file contents instead of the file. I know that using the read method we can read the file contents. But how do I call the read function and how do I get the file contents?

    Read the article

  • Where should I put common utility functions for Perl .t tests?

    - by zedoo
    I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but across different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Joomla, jQuery modules conflicting

    - by Websmith
    I have a custom jQuery accordion menu on my site in a module, when the mod is enabled it breaks my RokSlideshow module. I can't get them both to work at the same time. The site is http://www.fbcsheffield.org/2.0 Any help would be much appreciated!

    Read the article

  • viewing files in python?

    - by Galilsnap
    I am creating a sort of "Command line" in Python. I already added a few functions, such as changing login/password, executing, etc., But is it possible to browse files in the directory that the main file is in with a command/module, or will I have to make the module myself and use the import command? Same thing with changing directories to view, too.

    Read the article

  • drupal open id - how to get details

    - by Arun
    I'm try to use drupal open id module. When i used to login using any provider id(yahoo,google..) the step it goes to registration page of my site. My question is how to populate details of the user to my form without additional burden to the user ?. For ex name,email-id etc. Is there any module associated with it ?

    Read the article

  • How do i create my own Token?

    - by EugenA
    I use Rules-Module. I want to add 1 to a cck integer field on an action. Someone told me to create custom token doing this addition. So, I installed tokenSTARTER module. Now, how do i access the content profile (I load it in the rules chain) where needed cck field is in?

    Read the article

  • Question about python modules

    - by morpheous
    I have recently started learning Python and I have 2 questions relating to modules. Is there a way to obtain a list of Python modules available (i.e. installed) on a mchine? I am using Ubuntum Karmic and Synaptic for package management. I have just installed a python module.Where is the module code actually stored on my machine? (is there a default [recommended] location that modules are stored)?

    Read the article

  • factory class, wrong number of arguments being passed to subclass constructor

    - by Hugh Bothwell
    I was looking at Python: Exception in the separated module works wrong which uses a multi-purpose GnuLibError class to 'stand in' for a variety of different errors. Each sub-error has its own ID number and error format string. I figured it would be better written as a hierarchy of Exception classes, and set out to do so: class GNULibError(Exception): sub_exceptions = 0 # patched with dict of subclasses once subclasses are created err_num = 0 err_format = None def __new__(cls, *args): print("new {}".format(cls)) # DEBUG if len(args) and args[0] in GNULibError.sub_exceptions: print(" factory -> {} {}".format(GNULibError.sub_exceptions[args[0]], args[1:])) # DEBUG return super(GNULibError, cls).__new__(GNULibError.sub_exceptions[args[0]], *(args[1:])) else: print(" plain {} {}".format(cls, args)) # DEBUG return super(GNULibError, cls).__new__(cls, *args) def __init__(self, *args): cls = type(self) print("init {} {}".format(cls, args)) # DEBUG self.args = args if cls.err_format is None: self.message = str(args) else: self.message = "[GNU Error {}] ".format(cls.err_num) + cls.err_format.format(*args) def __str__(self): return self.message def __repr__(self): return '{}{}'.format(type(self).__name__, self.args) class GNULibError_Directory(GNULibError): err_num = 1 err_format = "destination directory does not exist: {}" class GNULibError_Config(GNULibError): err_num = 2 err_format = "configure file does not exist: {}" class GNULibError_Module(GNULibError): err_num = 3 err_format = "selected module does not exist: {}" class GNULibError_Cache(GNULibError): err_num = 4 err_format = "{} is expected to contain gl_M4_BASE({})" class GNULibError_Sourcebase(GNULibError): err_num = 5 err_format = "missing sourcebase argument: {}" class GNULibError_Docbase(GNULibError): err_num = 6 err_format = "missing docbase argument: {}" class GNULibError_Testbase(GNULibError): err_num = 7 err_format = "missing testsbase argument: {}" class GNULibError_Libname(GNULibError): err_num = 8 err_format = "missing libname argument: {}" # patch master class with subclass reference # (TO DO: auto-detect all available subclasses instead of hardcoding them) GNULibError.sub_exceptions = { 1: GNULibError_Directory, 2: GNULibError_Config, 3: GNULibError_Module, 4: GNULibError_Cache, 5: GNULibError_Sourcebase, 6: GNULibError_Docbase, 7: GNULibError_Testbase, 8: GNULibError_Libname } This starts out with GNULibError as a factory class - if you call it with an error number belonging to a recognized subclass, it returns an object belonging to that subclass, otherwise it returns itself as a default error type. Based on this code, the following should be exactly equivalent (but aren't): e = GNULibError(3, 'missing.lib') f = GNULibError_Module('missing.lib') print e # -> '[GNU Error 3] selected module does not exist: 3' print f # -> '[GNU Error 3] selected module does not exist: missing.lib' I added some strategic print statements, and the error seems to be in GNULibError.__new__: >>> e = GNULibError(3, 'missing.lib') new <class '__main__.GNULibError'> factory -> <class '__main__.GNULibError_Module'> ('missing.lib',) # good... init <class '__main__.GNULibError_Module'> (3, 'missing.lib') # NO! ^ why? I call the subclass constructor as subclass.__new__(*args[1:]) - this should drop the 3, the subclass type ID - and yet its __init__ is still getting the 3 anyway! How can I trim the argument list that gets passed to subclass.__init__?

    Read the article

  • Drupal 6: best way to upgrade jQuery ?

    - by Patrick
    Hi! I want to upgrade jQuery inside my drupal installation. At the moment I have jQuery 1.2.6 and I would like to upgrade it to jQuery 1.4 I guess some Drupal modules still depends on the old jQuery version. I've tried jquery_update module to upgrade jQuery, but it didn't work. It asked to replace the original Drupal files in the "misc" folder with the new ones, but it didn't work. Anyway, I was wondering if there is a better method instead of using another module thanks

    Read the article

< Previous Page | 198 199 200 201 202 203 204 205 206 207 208 209  | Next Page >