Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 203/246 | < Previous Page | 199 200 201 202 203 204 205 206 207 208 209 210  | Next Page >

  • How to catch non exist requested URL in Java servlet ?

    - by Frank
    My objects are stored online in two different places : <1 On my nmjava.com site, where I can put them in a directory called "Dir_My_App/Dir_ABC/" <2 On Google App Engine datastore When my Java app runs it checks both places for the objects, I designed the app so that it tries to get an object from a Url, it doesn't care whether it's an object in a directory or an object returned by a servlet. My_Object Get_Object(String Site_Url,String Object_Path) { ... get object by the name of Object_Path from the Site_Url ... } Now the request Url for my web site nmjava.com might look like this : http://nmjava.com/Dir_My_App/Dir_ABC/My_Obj_123 [ In a directory ] Or in the case of Google App Engine servlet : http://nm-java.appspot.com/Check_License/Dir_My_App/Dir_ABC/My_Obj_123 [ Non exist ] The "Object_Path" was generated by my app automatically. It can now get the object from my site by the above method like this : My_Object Get_Object("http://nmjava.com","/Dir_My_App/Dir_ABC/My_Obj_123"); In the Google App Engine, my servlet is running and ready to serve the object, if the request comes in correctly, but since I don't want to design my app to know whether the object is in one site's directory or in other site's datastore, I need to design the servlet to catch the non exist Url, such as the one above, and be able to make a call : My_Object Get_Object("http://nm-java.appspot.com/Check_License","/Dir_My_App/Dir_ABC/My_Obj_123"); So my question is : When a request comes into the servlet with a non exist Url, how should it catch it and analyze the url in order to respond properly, in my case it should know that : http://nm-java.appspot.com/Check_License/Dir_My_App/Dir_ABC/My_Obj_123 is asking for the object "My_Obj_123" [ ignore the dirs ] and return the object from the datastore. Now I'm getting this : Error: Not Found The requested URL /Check_License/Dir_My_App/Dir_ABC/My_Obj_123 was not found on this server. Where in my servlet and how do I detect the request for this non exist Url ?

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • Getting ellipses function parameters without an initial argument

    - by Tox1k
    So I've been making a custom parser for a scripting language, and I wanted to be able to pass only ellipses arguments. I don't need or want an initial variable, however Microsoft and C seem to want something else. FYI, see bottom for info. I've looked at the va_* definitions #define _crt_va_start(ap,v) ( ap = (va_list)_ADDRESSOF(v) + _INTSIZEOF(v) ) #define _crt_va_arg(ap,t) ( *(t *)((ap += _INTSIZEOF(t)) - _INTSIZEOF(t)) ) #define _crt_va_end(ap) ( ap = (va_list)0 ) and the part I don't want is the v in va_start. As a little background I'm competent in goasm and I know how the stack works so I know what's happening here. I was wondering if there is a way to get the function stack base without having to use inline assembly. Ideas I've had: #define im_va_start(ap) (__asm { mov [ap], ebp }) and etc... but really I feel like that's messy and I'm doing it wrong. struct function_table { const char* fname; (void)(*fptr)(...); unsigned char maxArgs; }; function_table mytable[] = { { "MessageBox", &tMessageBoxA, 4 } }; ... some function that sorts through a const char* passed to it to find the matching function in mytable and calls tMessageBoxA with the params. Also, the maxArgs argument is just so I can check that a valid number of parameters is being sent. I have personal reasons for not wanting to send it in the function, but in the meantime we can just say it's because I'm curious. This is just an example; custom libraries are what I would be implementing so it wouldn't just be calling WinAPI stuff. void tMessageBoxA(...) { // stuff to load args passed MessageBoxA(arg1, arg2, arg3, arg4); } I'm using the __cdecl calling convention and I've looked up ways to reliably get a pointer to the base of the stack (not the top) but I can't seem to find any. Also, I'm not worried about function security or typechecking.

    Read the article

  • recvfrom returns invalid argument when *from* is passed

    - by Aditya Sehgal
    I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

    Read the article

  • nHibernate storage of an object with self referencing many children and many parents

    - by AdamC
    I have an object called MyItem that references children in the same item. How do I set up an nhibernate mapping file to store this item. public class MyItem { public virtual string Id {get;set;} public virtual string Name {get;set;} public virtual string Version {get;set;} public virtual IList<MyItem> Children {get;set;} } So roughly the hbm.xml would be: <class name="MyItem" table="tb_myitem"> <id name="Id" column="id" type="String" length="32"> <generator class="uuid.hex" /> </id> <property name="Name" column="name" /> <property name="Version" column="version" /> <bag name="Children" cascade="all-delete-orphan" lazy="false"> <key column="children_id" /> <one-to-many class="MyItem" not-found="ignore"/> </bag> </class> This wouldn't work I don't think. Perhaps I need to create another class, say MyItemChildren and use that as the Children member and then do the mapping in that class? This would mean having two tables. One table holds the MyItem and the other table holds references from my item. NOTE: A child item could have many parents.

    Read the article

  • Learn Prolog Now! DCG Practice Example

    - by Timothy
    I have been progressing through Learn Prolog Now! as self-study and am now learning about Definite Clause Grammars. I am having some difficulty with one of the Practical Session's tasks. The task reads: The formal language anb2mc2mdn consists of all strings of the following form: an unbroken block of as followed by an unbroken block of bs followed by an unbroken block of cs followed by an unbroken block of ds, such that the a and d blocks are exactly the same length, and the c and d blocks are also exactly the same length and furthermore consist of an even number of cs and ds respectively. For example, ε, abbccd, and aaabbbbccccddd all belong to anb2mc2mdn. Write a DCG that generates this language. I am able to write rules that generate andn, b2mc2m, and even anb2m and c2mndn... but I can't seem to join all these rules into anb2mc2mdn. The following are my rules that can generate andn and b2mc2m. s1 --> []. s1 --> a,s1,d. a --> [a]. d --> [d]. s2 --> []. s2 --> c,c,s2,d,d. c --> [c]. d --> [d]. Is anb2mc2mdn really a CFG, and is it possible to write a DCG using only what was taught in the lesson (no additional arguments or code, etc)? If so, can anyone offer me some guidance how I can join these so that I can solve the given task?

    Read the article

  • Specifying character

    - by danutenshu
    So below I have a code in C++ that is supposed to invert the arguments in a vector, but not the sequence. I have listed my problems as sidenotes in the code below. The invert function is supposed to invert each argument, and then the main function just outputs the inverted words in same order For instance, program("one two three four")=ruof eerth owt eno #include <iostream> #include <string> using namespace std; int invert(string normal) { string inverted; for (int num=normal.size()-1; num>=0; num--) { inverted.append(normal[num]); //I don't know how to get each character //I need another command for append } return **inverted**; <---- } int main(int argc, char* argv[]) { string text; for (int a=1; a<argc; a++) { text.append(invert(argv[a])); //Can't run the invert function text.append(" "); } cout << text << endl; return 0; }

    Read the article

  • Scala: Correcting type inference of representation type over if statement

    - by drhagen
    This is a follow-up to two questions on representation types, which are type parameters of a trait designed to represent the type underlying a bounded type member (or something like that). I've had success creating instances of classes, e.g ConcreteGarage, that have instances cars of bounded type members CarType. trait Garage { type CarType <: Car[CarType] def cars: Seq[CarType] def copy(cars: Seq[CarType]): Garage def refuel(car: CarType, fuel: CarType#FuelType): Garage = copy( cars.map { case `car` => car.refuel(fuel) case other => other }) } class ConcreteGarage[C <: Car[C]](val cars: Seq[C]) extends Garage { type CarType = C def copy(cars: Seq[C]) = new ConcreteGarage(cars) } trait Car[C <: Car[C]] { type FuelType <: Fuel def fuel: FuelType def copy(fuel: C#FuelType): C def refuel(fuel: C#FuelType): C = copy(fuel) } class Ferrari(val fuel: Benzin) extends Car[Ferrari] { type FuelType = Benzin def copy(fuel: Benzin) = new Ferrari(fuel) } class Mustang(val fuel: Benzin) extends Car[Mustang] { type FuelType = Benzin def copy(fuel: Benzin) = new Mustang(fuel) } trait Fuel case class Benzin() extends Fuel I can easily create instances of Cars like Ferraris and Mustangs and put them into a ConcreteGarage, as long as it's simple: val newFerrari = new Ferrari(Benzin()) val newMustang = new Mustang(Benzin()) val ferrariGarage = new ConcreteGarage(Seq(newFerrari)) val mustangGarage = new ConcreteGarage(Seq(newMustang)) However, if I merely return one or the other, based on a flag, and try to put the result into a garage, it fails: val likesFord = true val new_car = if (likesFord) newFerrari else newMustang val switchedGarage = new ConcreteGarage(Seq(new_car)) // Fails here The switch alone works fine, it is the call to ConcreteGarage constructor that fails with the rather mystical error: error: inferred type arguments [this.Car[_ >: this.Ferrari with this.Mustang <: this.Car[_ >: this.Ferrari with this.Mustang <: ScalaObject]{def fuel: this.Benzin; type FuelType<: this.Benzin}]{def fuel: this.Benzin; type FuelType<: this.Benzin}] do not conform to class ConcreteGarage's type parameter bounds [C <: this.Car[C]] val switchedGarage = new ConcreteGarage(Seq(new_car)) // Fails here ^ I have tried putting those magic [C <: Car[C]] representation type parameters everywhere, but without success in finding the magic spot.

    Read the article

  • Execute a function to affect different template class instances

    - by Samer Afach
    I have a complicated problem, and I need help. I have a base case, class ParamBase { string paramValue; //... } and a bunch of class templates with different template parameters. template <typename T> class Param : public ParamBase { T value; //... } Now, each instance of Param has different template parameter, double, int, string... etc. To make it easier, I have a vector to their base class pointers that contains all the instances that have been created: vector<ParamBase*> allParamsObjects; The question is: How can I run a single function (global or member or anything, your choice), that converts all of those different instances' strings paramValue with different templates arguments and save the conversion result to the appropriate type in Param::value. This has to be run over all objects that are saved in the vector allParamsObjects. So if the template argument of the first Param is double, paramValue has to be converted to double and saved in value; and if the second Param's argument is int, then the paramValue of the second has to be converted to int and saved in value... etc. I feel it's almost impossible... Any help would be highly appreciated :-)

    Read the article

  • Google App Engine: TypeError problem with Models

    - by Rosarch
    I'm running Google App Engine on the dev server. Here is my models file: from google.appengine.ext import db import pickle import re re_dept_code = re.compile(r'[A-Z]{2,}') re_course_number = re.compile(r'[0-9]{4}') class DependencyArcHead(db.Model): sink = db.ReferenceProperty() tails = db.ListProperty() class DependencyArcTail(db.Model): courses = db.ListProperty() It gives this error: Traceback (most recent call last): File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 3192, in _HandleRequest self._Dispatch(dispatcher, self.rfile, outfile, env_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 3135, in _Dispatch base_env_dict=env_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 516, in Dispatch base_env_dict=base_env_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 2394, in Dispatch self._module_dict) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 2304, in ExecuteCGI reset_modules = exec_script(handler_path, cgi_path, hook) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 2200, in ExecuteOrImportScript exec module_code in script_module.__dict__ File "main.py", line 19, in <module> from src.Models import Course, findCourse, validateCourse, dictForJSON, clearAndBuildDependencyGraph File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1279, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1929, in load_module return self.FindAndLoadModule(submodule, fullname, search_path) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1279, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1831, in FindAndLoadModule description) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1279, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver.py", line 1782, in LoadModuleRestricted description) File "src\Models.py", line 14, in <module> class DependencyArcHead(db.Model): File "src\Models.py", line 17, in DependencyArcHead tails = db.ListProperty() TypeError: __init__() takes at least 2 arguments (1 given) What am I doing wrong?

    Read the article

  • Mulltiple configurations in Qt

    - by user360607
    Hi all! I'm new to Qt Creator and I have several questions regarding multiple build configurations. A side note: I have the QtCreator 1.3.1 installed on my Linux machine. I need to have two configurations in my Qt Creator project. The thing is that these aren't simply debug and release but are based on the target architecture - x86 or x64. I came across http://stackoverflow.com/questions/2259192/building-multiple-targets-in-qt-qmake and from that I went trying something like: Conf_x86 { TARGET = MyApp_x86 } Conf_x64 { TARGET = MyApp_x64 } This way however I don't seems to be able to use the Qt Creator IDE to build each of these separately (Build All, Rebuild All, etc. options from the IDE menu). Is there a way to achieve this - may be even show Conf_x86 and Conf_x64 as new build configurations in Qt Creator? One other thing the Qt I have is 64 bit so by default the target built using Qt Creator IDE will also be 64 bit. I noticed that the effective qmake call in the build step includes the following option '-spec linux-g++-64'. I also noticed that should I add '-spec linux-g++-32' in 'Additional arguments' it would override '-spec linux-g++-64' and the resulting target will be 32 bit. How can I achieve this by simply editing the contents of the .pro file? I saw that all these changes are initially saved in the .pro.user file but does doesn't suit me at all. I need to be able to make these configurations from the .pro file if possible. Any help will be appreciated. 10x in advance!

    Read the article

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • Incorrect component when querying immediately after insert using NHibernate

    - by Am
    I have the following mapping for my table in MySql: <class name="Tag, namespace" table="tags" > <id name="id" type="Int32" unsaved-value="0"> <generator class="native"></generator> </id> <property name="name" type="String" not-null="true"></property> <component name="record_dates" class="DateMetaData, namespace" > <property name="created_at" type="DateTime" not-null="true"></property> <property name="updated_at" type="DateTime" not-null="true"></property> </component> </class> As you see the record_dates property is defined as a component field of type DateMetaDate. Both created_at and updated_at fields in 'tags' table are updated via triggers. Thus I can insert a new record like such: var newTag = new Tag() { name = "some string here" } Int32 id = (Int32)Session.Save(tag); Session.Flush(); ITag t = Session.Get<Tag>(id); ViewData["xxx"] = t.name; // -----> not null ViewData["xxx"] = t.record_dates.created_at; // -----> is null However when querying the same record back immediately after it was inserted the record_dates field ends up null even though in the table those fields have got values. Can any one please point out why the Session.Get ignores getting everything back from the table? is it because it caches the newly created record for which the records_dates is null? If so how can it be told to ignore the cached version?

    Read the article

  • ASP.NET Web Application: use 1 or multiple virtual directories

    - by tster
    I am working on a (largish) internal web application which has multiple modules (security, execution, features, reports, etc.). All the pages in the app share navigation, CSS, JS, controls, etc. I want to make a single "Web Application" project, which includes all the pages for the app, then references various projects which will have the database and business logic in them. However, some of the people on the project want to have separate projects for the pages of each module. To make this more clear, this is what I'm advocating to be the projects. /WebInterface* /SecurityLib /ExecutionLib etc... And here is what they are advocating: /SecurityInterface* /SecutiryLib /ExecutionInterface* /ExecutionLib etc... *project will be published to a virtual directory of IIS Basically What I'm looking for is the advantages of both approaches. Here is what I can think of so far: Single Virtual Directory Pros Modules can share a single MasterPage Modules can share UserControls (this will be common) Links to other modules are within the same Virtual directory, and thus don't need to be fully qualified. Less chance of having incompatible module versions together. Multiple Virtual Directories Pros Can publish a new version of a single module without disrupting other modules Module is more compartmentalized. Less likely that changes will break other modules. I don't buy those arguments though. First, using load balanced servers (which we will have) we should be able to publish new versions of the project with zero downtime assuming there are no breaking database changes. Second, If something "breaks" another module, then there is either an improper dependency or the break will show up eventually in the other module, when the developers copy over the latest version of the UserControl, MasterPage or dll. As a point of reference, there are about 10 developers on the project for about 50% of their time. The initial development will be about 9 months.

    Read the article

  • Python 3, urllib ... Reset Connection Possible?

    - by Rhys
    In the larger scale of my program the goal of the below code is to filter out all dynamic html in a web-page source code code snippet: try: deepreq3 = urllib.request.Request(deepurl3) deepreq3.add_header("User-Agent","etc......") deepdata3 = urllib.request.urlopen(deepurl3).read().decode("utf8", 'ignore') The following code is looped 3 times in order to identify whether the target web-page is Dynamic (source code is changed at intervals) or not. If the page IS dynamic, the above code loops another 15 times and attempts to filter out the dynamic content. QUESTION: While this filtering method works 80% of the time, some pages will reload ALL 15 times and STILL contain dynamic code. HOWEVER. If I manually close down the Python Shell and re-execute my program, the dynamic html that my 'refresh-page method' could not shake off is no longer there ... it's been replaced with new dynamic html that my 'refresh-page method' cannot shake off. So I need to know, what is going on here? How is re-running my program causing the dynamic content of a page to change. AND, is there any way, any 'reset connection' command I can use to recreate this ... without manually restarting my app. Thanks for your response.

    Read the article

  • Java data structure suggestion.

    - by techoverflow
    Hi folks, I am a newbie in this field so please excuse my silly mistakes :) So the issue I am facing is: On my webpage, I am displaying a table. For now my issue is concerned with three columns of the table. First is : Area Code Second is : Zone Code Third is: Value The relationship between these three is: 1 Area Code has 6 different Zone code's and all those 6 Zone codes have corresponding "Value" I need a data structer that would give me the flexibility to get a "Value" for a Zone code, which falls under a particular Area code. I have the same zone codes for all the Area codes: Zone codes are: 111, 222, 333, 444, 555, 666 After surfing your stackoverflow, I thought I can go with this structure: Map<Integer, Map<Integer, Double>> retailPrices = new HashMap<Integer, Map<Integer, Double>>(); Map<Integer, Double> codes = new HashMap<Integer, Double>(); where reatailPrices would hold an Area Code and a Map of Zone code as Key and "Value" as Value. but when I am trying to populate this through a SQL resultset, I am getting the following error: The method put(Integer, Map<Integer,Double>) in the type Map is not applicable for the arguments (Integer, Double) on line: `while(oResult.next()) retailPrices.put((new Integer(oResult.getString("AREA"))), (pegPlPrices.put(new Integer(oResult.getString("ZONE_CODE")), new Double(oResult.getString("VALUE"))))); }` please help me figure out this problem. Am I following the right approach?

    Read the article

  • Breaking dependencies when you can't make changes to other files?

    - by codemuncher
    I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

    Read the article

  • Deploy and Run application at beginning of WIX Install

    - by Doctor Fro
    I'm trying to deploy and run an application (C# console app) at the beginning of the MSI install with WIX but having some difficulty. The application needs to run before any of the webserver actions happen but after the files have been copied from the MSI to the target location. I can get the app to run but only if I have actually copied the application in the directory before I run the MSI. If I don't do that, I get an error relating to the app not existing in the MSI logs. So basically I think it has to do with the launch sequence I am using I need to ensure that the app exists before it is run. Wondering if one of you good folks could help me out. The requirement is that the application must run as the first thing the WIX MSI does, (well actually before any of the webservice parts happen). The relevant bits of the Wix are as follows. <CustomAction Id='LaunchUpdaterRunFirst' FileKey='serverUpdaterRunFirstExe' ExeCommand='' Return='ignore' /> ... <InstallExecuteSequence> <Custom Action='CA_BlockOlderVersionInstall' After='FindRelatedProducts'>NEWERVERSIONDETECTED</Custom> <RemoveExistingProducts After="InstallInitialize" /> <Custom Action='LaunchUpdaterRunFirst' After='InstallInitialize' /> <Custom Action='LaunchInstaller' After='InstallFinalize'><![CDATA[ REMOVE <> "ALL" and UILevel <> 2]]></Custom> </InstallExecuteSequence> ... <Component Id="ServerInstaller" DiskId="1" Guid="9662EC72-1774-4d22-9F41-AD98A5DCD729"> <File Id="serverUpdaterRunFirstExe" Name="MyCompany.Server.Updater.RunFirst.exe" Source="$(var.SOURCEPATH)\MyCompany.Server.Updater.RunFirst.exe" /> <File Id="serverUpdaterRunFirstExeConfig" Name="MyCompany.Server.Updater.RunFirst.exe.config" Source="$(var.SOURCEPATH)\MyCompany.Server.Updater.RunFirst.exe.config" /> Any help or references greatly appreciated.

    Read the article

  • How does one gets started with Winforms style applications on Win32?

    - by Billy ONeal
    EDIT: I'm extremely tired and frustrated at the moment -- please ignore that bit in this question -- I'll edit it in the morning to be better. Okay -- a bit of background: I'm a C++ programmer mostly, but the only GUI stuff I've ever done was on top of .NET's WinForms platform. I'm completely new to Windows GUI programming, and despite Petzold's excellent book, I'm extremely confused. Namely, it seems that most every reference on getting started with Win32 is all about drawing lines and curves and things -- a topic about which (at least at present time) I couldn't care less. I need a checked list box, a splitter, and a textbox -- something that would take less than 10 minutes to do in Winforms land. It has been recommended to me to use the WTL library, which provides an implementation of all three of these controls -- but I keep getting hung up on simple things, such as getting the damn controls to use the right font, and getting High DPI working correctly. I've spent two freaking days on this, and I can't help but think there has to be a better reference for these kinds of things than I've been able to find. Petzold's book is good, but it hasn't been updated since Windows 95 days, and there's been a LOT changed w.r.t. how applications should be correctly developed since it was published. I guess what I'm looking for is a modern Petzold book. Where can I find such a resource, if any?

    Read the article

  • I expect to see in the browswer "http://path/some_page.html" but instead it identifies with "http:/

    - by indiehacker
    I am developing with app engine SDK. I have a feeling this is much too basic a question so apologies ahead of time... A simple submit button doesnt work instead of just showing an alert box as expected it continues on afterwards and redirects me to the latest http-request, and I think this is because I dont understand how to tell the browser to recognize the proper URLs. Why does my browser say I am at the most recent http-request http://localhost:8080/putProjectInDB rather than the somepage.html that was actually served to the browser that I am currently looking at? How can I get the browser to recognize and show in its url spot the normal expected http://somepage.html ? Just in case, here are details of the specific problem which you might be able to ignore for answering the question: This hasnt been mattered for me until I just wanted to put into my .html a simple button that changes some stuff of the page without needing the server. The below code after displaying the alert box redirects me to the last server request http://localhost:8080/putProjectInDB instead of just staying in the same html page. in header: function MyFormCommands() { alert('Some Text'); } in body: <form onSubmit="MyFormCommands()" ><input type=submit ></form >

    Read the article

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • Aligning messageformat on printing a JTable.

    - by DanielFH
    I'm using this for the moment to print out my table, and it works. But I'm not really happy with the layout of the messageformatting, I would like to have both pagenumber and date in the footer, and date format aligned to the left side of the table, and page to the right. How can I do that? Been reading some stuff about overriding the PrintTable method, but seems to get pretty complex from what I've read. Hope you can help me with this issue, thank you. :) import javax.print.attribute.HashPrintRequestAttributeSet; import javax.print.attribute.PrintRequestAttributeSet; import javax.print.attribute.standard.OrientationRequested; import javax.swing.JTable; import dk.beesys.rims.ui.WindowInventory; public class Print { private static Print INSTANCE; public static Print getInstance() { if (INSTANCE == null) { INSTANCE = new Print(); } return INSTANCE; } private Print(){ } public void printList(java.awt.event.ActionEvent ignore) { String strDate = MessageFormat.format("{0,date,short} {0,time,short}", new Date()); MessageFormat header = new MessageFormat("- {0} -"); MessageFormat footer = new MessageFormat("Printed: " + strDate); PrintRequestAttributeSet aset = new HashPrintRequestAttributeSet(); aset.add(OrientationRequested.LANDSCAPE); try { WindowInventory.getInstance().getTable().print(JTable.PrintMode.FIT_WIDTH, header, footer, true, aset, true); } catch (java.awt.print.PrinterException e) { System.err.format("Cannot print %s%n", e.getMessage()); } }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Google Analytics version 3 - How to apply it correctly?

    - by ephramd
    I've added google analytics to my app with the intention of obtaining information about the screens you and send custom events. I am obtained duplicate content ... Also I get different results: "com.package.app.MainScreen" - 300 views and "Main Screen" - 200 views I am interested to get only follow up with the custom name of the activity and not the package. And in any case, because both show different results? public class MainScreen extends Activity { private static final String GA_PROPERTY_ID = "UA-12345678-9"; private static final String SCREEN_LABEL = "Main Screen"; Tracker mTracker; EasyTracker easyTracker; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main_screen); mTracker = GoogleAnalytics.getInstance(this).getTracker(GA_PROPERTY_ID); mTracker.set(Fields.SCREEN_NAME, SCREEN_LABEL); // For Custom Name from activity mTracker.send(MapBuilder.createAppView().build()); easyTracker = EasyTracker.getInstance(this); // Analytics Events ... easyTracker.send(MapBuilder.createEvent("MainScreen", "Play", category.get(1), null).build()); //AnalyticsEvents ... } @Override public void onStart() { super.onStart(); EasyTracker.getInstance(this).activityStart(this); } @Override public void onStop() { super.onStop(); EasyTracker.getInstance(this).activityStop(this); } } And analytics.xml: <?xml version="1.0" encoding="utf-8" ?> <resources xmlns:tools="http://schemas.android.com/tools" tools:ignore="TypographyDashes"> <!--Replace placeholder ID with your tracking ID--> <string name="ga_trackingId">UA-12345678-9</string> <!--Enable automatic activity tracking--> <bool name="ga_autoActivityTracking">true</bool> <!--Enable automatic exception tracking--> <bool name="ga_reportUncaughtExceptions">true</bool> </resources> Google Analytics Dev Guide

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

< Previous Page | 199 200 201 202 203 204 205 206 207 208 209 210  | Next Page >