Search Results

Search found 14125 results on 565 pages for 'apache commons io'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 204/565 | < Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >

  • iphone file download not working

    - by Anonymous
    Hi, In my app I 'm first connecting to a web service, which in return sends a url for a file. I use the url to download the file and then display it on the new view. I get the correct URL but not able to download file from that location. I have another test app which will download file from the same location and it works like a charm. following is my code for webservice-file download. This is a snippet of the code where i 'm parsing the web service xml and then pass the result to NSData for file download. Any suggestions where am i going wrong -- I 'm referring to the following tutorials. Web Service PDF Viewer if ([elementName isEqualToString:@"PRHPdfResultsResult"]) { NSLog(soapResults); UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"Report downloaded from:" message:soapResults delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; NSData *pdfData = [[NSData alloc] initWithContentsOfURL:[NSURL URLWithString:soapResults]]; //Store the Data locally as PDF File NSString *resourceDocPath = [[NSString alloc] initWithString:[[[[NSBundle mainBundle] resourcePath] stringByDeletingLastPathComponent] stringByAppendingPathComponent:@"Documents"]]; NSString *filePath = [resourceDocPath stringByAppendingPathComponent:@"myPDF.pdf"]; [pdfData writeToFile:filePath atomically:YES]; [alert show]; [alert release]; [soapResults setString:@""]; elementFound = FALSE; }

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • Explained shell statement

    - by Mats Stijlaart
    The following statement will remove line numbers in a txt file: cat withLineNumbers.txt | sed 's/^.......//' >> withoutLineNumbers.txt The input file is created with the following statement (this one i understand): nl -ba input.txt >> withLineNumbers.txt I know the functionality of cat and i know the output is written to the 'withoutLineNumbers.txt' file. But the part of '| sed 's/^.......//'' is not really clear to me. Thanks for your time.

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • How can I do block-oriented disk I/O with Java? Or similar for a B+ tree

    - by Sanoj
    I would like to implement an B+ tree in Java and try to optimize it for disk based I/O. Is there an API for accessing individual disk blocks from Java? or is there an API that can do similar block-oriented access that fits my purpose? I would like to create something like Tokyo Cabinet in 100% Java. Is there anyone that knows what Java only databases like JavaDB is using in the back-end for this? I know that there are probably other languages than Java that can do this better, but I do this in a learning purpose only.

    Read the article

  • c++ File input/output

    - by Myx
    Hi: I am trying to read from a file using fgets and sscanf. In my file, I have characters on each line of the while which I wish to put into a vector. So far, I have the following: FILE *fp; fp = fopen(filename, "r"); if(!fp) { fprintf(stderr, "Unable to open file %s\n", filename); return 0; } // Read file int line_count = 0; char buffer[1024]; while(fgets(buffer, 1023, fp)) { // Increment line counter line_count++; char *bufferp = buffer; ... while(*bufferp != '\n') { char *tmp; if(sscanf(bufferp, "%c", tmp) != 1) { fprintf(stderr, "Syntax error reading axiom on " "line %d in file %s\n", line_count, filename); return 0; } axiom.push_back(tmp); printf("put %s in axiom vector\n", axiom[axiom.size()-1]); // increment buffer pointer bufferp++; } } my axiom vector is defined as vector<char *> axiom;. When I run my program, I get a seg fault. It happens when I do the sscanf. Any suggestions on what I'm doing wrong?

    Read the article

  • Batch backup a harddrive without modifying access times C#

    - by johnathan-doena
    I'm trying to write a simple program that will backup my flash drive. I want it to work automatically and silently in the background, and I also want it to be as quick as possible. The thing is, resetting all the access times is useless to me, and something I want to avoid. I know I can read the access times and set them back, but I bet it will fail one day in the future. It would be much simpler to read the files without ever changing it. Also, what is the fastest way to do this? What differences would there be between, say, a flash drive and an external hard drive. I am writing this in C#, as it is the simplest way to do it and it will probably last more generations of Windows..

    Read the article

  • Efficient way to delete a line from a text file (C#)

    - by Valentin Vasilyev
    Hello. I need to delete a certain line from a text file. What is the most efficient way of doing this? File can be potentially large(over million records). Thank you. UPDATE: below is the code I'm currently using, but I'm not sure if it is good. internal void DeleteMarkedEntries() { string tempPath=Path.GetTempFileName(); using (var reader = new StreamReader(logPath)) { using (var writer = new StreamWriter(File.OpenWrite(tempPath))) { int counter = 0; while (!reader.EndOfStream) { if (!_deletedLines.Contains(counter)) { writer.WriteLine(reader.ReadLine()); } ++counter; } } } if (File.Exists(tempPath)) { File.Delete(logPath); File.Move(tempPath, logPath); } }

    Read the article

  • Homemade fstat to get file size, always return 0 length.

    - by Fred
    Hello, I am trying to use my own function to get the file size from a file. I'll use this to allocate memory for a data structure to hold the information on the file. The file size function looks like this: long fileSize(FILE *fp){ long start; fflush(fp); rewind(fp); start = ftell(fp); return (fseek(fp, 0L, SEEK_END) - start); } Any ideas what I'm doing wrong here?

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • Foreach File in a Folder in Flash?

    - by msandbot
    Hey, I have an image slideshow program working right now and it takes in a folder of a hard coded in number of images. I would like to change this so that it can take in a folder and will display all of them no matter the number. Is there a way to do this in flash? I'm thinking something like the foreach loop in perl or other scripting language. It is possible to store then number of images in a text file but I also don't know how to read that in flash either. I'm working in actionscript 3. Any help would be greatly appreciated. Thanks -Mike

    Read the article

  • Connect.registerUsers - Need helping creating array for accounts param

    - by mw_javaguy
    I keep getting the following error when I try to invoke the Facebook REST API Call: Connect.registerUsers Error Code: 100 - param accounts must be an array JSON based response (from Facebook): {"error_code":100,"error_msg":"param accounts must be an array.","request_args": [{"key":"accounts","value":"{email_hash:5232156322_55ddgvc3db5ddcf218049dd564da2x06}"}, {"key":"api_key","value":"23b2c4c6a23445fbffssf8aab96a5e5"}, {"key":"format","value":"JSON"},{"key":"method","value":"Connect.registerUsers"},{"key":"sig","value":"3sd54153a31382fa6e72eecf3c57d7c9"},{"key":"v","value":"1.0"}],"message":"Unknown exception","code":0} I set up the Java code to invoke the REST end point using HttpClient like this: String API_KEY = "23b2c4c6a23445fbffssf8aab96a5e5"; String toConnectRegisterUsersSignature = "accounts=" + "{email_hash:" + emailHash + "}" + "api_key=" + API_KEY + "format=JSON" + "method=Connect.registerUsers" + "v=1.0" + "0c786155bd3cxe8228d924542da5gf2"; String connectRegisterUsersSignature = SimpleMd5.MD5(toConnectRegisterUsersSignature); NameValuePair[] connectRegisterUsersParameters = { new NameValuePair("accounts", "{email_hash:" + emailHash + "}"), new NameValuePair("api_key", API_KEY), new NameValuePair("format", "JSON"), new NameValuePair("method", "Connect.registerUsers"), new NameValuePair("sig", connectRegisterUsersSignature), new NameValuePair("v", "1.0") }; Tried the following combinations and I still get the same error! Signature: "accounts=" + "[email_hash=" + emailHash + "]" new NameValuePair("accounts", "[email_hash=" + emailHash + "]") Signature: "accounts=" + "email_hash[" + emailHash + "]" new NameValuePair("accounts", "email_hash[" + emailHash + "]") Signature: "accounts=" + "email_hash(" + emailHash + ")" new NameValuePair("accounts", "email_hash(" + emailHash + ")") Signature: "accounts=" + "[email_hash=" + emailHash + "]" new NameValuePair("accounts", "[email_hash=" + emailHash + "]") Signature: "accounts=" + "email_hash=" + emailHash new NameValuePair("accounts", "email_hash=" + emailHash) Signature: "accounts=" + "[{email_hash:" + emailHash + "}]" new NameValuePair("accounts", "[{email_hash:" + emailHash + "}]"), Does anyone know how to construct this array that the response is requesting? Happy programming and thank you for taking the time to read this.

    Read the article

  • Cant print contents of a custom file

    - by ZaZu
    Hello, Im trying to scan contents from a random file into an array in a structure. Then I want to print those contents on screen. (NOTE: The following code is from a bigger program, this is just a sample, but all structures and arrays used are needed as declared ) The contents of the file being tested are simply: 5 4 3 2 5 3 4 2 #include<stdio.h> #define first 500 #define sec 500 struct trial{ int f; int r; float what[first][sec]; }; int trialtest(trial *test); int trialdisplay(trial *test); main(){ trial test; trialtest(&test); trialdisplay(&test); } int trialtest(trial *test){ int z,x,i; FILE *inputf; inputf=fopen("randomfile.txt","r"); for(i=0;i<5;i++){ fscanf(inputf,"%f",&(*test).what[z][x]); } fclose(inputf); return 0; } int trialdisplay(trial *test){ int i,z,x; printf("printing\n\n\n"); for (i=0;i<10;i++){ printf("%f",(*test).what[z][x]); } return 0; } The problem is, I get this error whenever I run the code .. I cant really understand whats going on : Any suggestions ? Thanks alot !

    Read the article

  • Check whether a folder is a local or a network resource in .NET

    - by rwmnau
    Is there a quick way to check whether a path I have is on a local disk or somewhere on the network? I can't just check to see if it's a drive letter vs. UNC, because that would incorrectly identify mapped drives as local. I assumed it would be a boolean in the DirectoryInfo object, but it appears that it's not. I've found classic VB code to do this check (through an API), but nothing for .NET so far.

    Read the article

  • best way to output a full precision double into a text file

    - by flevine100
    Hi, I need to use an existing text file to store some very precise values. When read back in, the numbers essentially need to be exactly equivalent to the ones that were originally written. Now, a normal person would use a binary file... for a number of reasons, that's not possible in this case. So... do any of you have a good way of encoding a double as a string of characters (aside from increasing the precision). My first thought was to cast the double to a char[] and write out the chars. I don't think that's going to work because some of the characters are not visible, produce sounds, and even terminate strings ('\0'... I'm talkin to you!) Thoughts?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • removing a line from a text file?

    - by Blackbinary
    Hi all. I am working with a text file, which contains a list of processes under my programs control, along with relevant data. At some point, one of the processes will finish, and thus will need to be removed from the file (as its no longer under control). Here is a sample of the file contents (which has enteries added "randomly"): PID=25729 IDLE=0.200000 BUSY=0.300000 USER=-10.000000 PID=26416 IDLE=0.100000 BUSY=0.800000 USER=-20.000000 PID=26522 IDLE=0.400000 BUSY=0.700000 USER=-30.000000 So for example, if I wanted to remove the line that says PID=26416.... how could I do that, without writing the file over again? I can use external unix commands, however I am not very familiar with them so please if that is your suggestion, give an example. Thanks!

    Read the article

  • How can I redirect all traffic from one domain to another with an .htaccess file?

    - by George Edison
    Say I have a subdomain xxx.yyy.com running Apache. The files are stored in /home/someone/public_html/xxx. What I want to do is redirect all requests to a domain name zzz.com which is using the same location for its files. (In other words, xxx.yyy.com and zzz.com are aliases for each other) I just want people accessing zzz.com, so if someone goes to xxx.yyy.com they should be redirected to zzz.com. Can this easily be done with a rewrite rule in an .htaccess file?

    Read the article

  • Which workflow engine should I chose for implementing a dynamic reconfiguration of workflows?

    - by Raya
    I want to be able to interrupt a running workflow instance, say when a new activity is about to be invoked, and extract information both about the structure of the workflow and the data in the particular instance. Then I will consult with an external system and according to its response I will possibly alter the behaviour of the workflow. The options I would like to have are addition/removal of activities and altering parameters for the activities to be invoked. I am currently struggling with the engine it's best to go with. I have looked at WWF, Apache ODE, Oracle Workflow and Active BPEL and as far as I understand they can all provide me with the options I need. I would really appreciate any recommendations on which one will be the easiest to work with for my purpose and any restrictions either of the above might have that would prevent me from reaching my goal. Thanks

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • Known problems with filemtime() on Windows - files getting touched arbitrarily?

    - by Pekka
    Is there a known issue leading to file modification times of cache files on Windows XP SP 3 getting arbitrarily updated, but without any actual change? Is there some service on a standard Windows XP - Backup, Sync, Versioning, Virus scanner - known to touch files? They all have a .txt extension. If there isn't, forget it. Then I'm getting something wrong in my cache routines, and I'll debug my way through. Background: I'm building a simple caching wrapper around a slow web site on a Windows server. I am comparing the filemtime() time stamp to some columns in the data base to determine whether a cached file is stale. I'm having problems using this method because the modification time of the cache files seems to get updated in between operations without me doing anything. THis results in stale files being displayed. I'm the only user on the machine. The operating system is Windows XP, the webserver a XAMPP Apache 2 with PHP 5.2

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >