Search Results

Search found 14125 results on 565 pages for 'apache commons io'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 204/565 | < Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >

  • The whole site is blocked while one page is waiting for blocking operation (PHP, ASP.NET). Why?

    - by artvolk
    Good day! I've found interesting behaviour for both LAMP stack and ASP.NET. The scenario: There is page performing task in 2-3 minutes (making HttpWebRequest for ASP.NET and curl for PHP). While this page is processed all other requests to this virtual host from the same browser are not processed (even if I use different browsers from one machine). I use two pages written in PHP and C#. I've tested with Apache+PHP in both mod_php and fast_cgi modes on Windows and Debian. For ASP.NET I use IIS6 (with dedicated app pool for this site and with default app pool) and IIS7 in integrated mode. I know that it is better to use async calls for such things, but I'm just curious why single page blocks the entire site and not only the thread processing the request? Thanks in advance!

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • Add HTML Id's to tags in .aspx file

    - by slandau
    So I'm writing an app that lets the user select a folder, it gets all the .aspx files in that folder, and lets the users check off which ones they want to add HTML ID's to. Then they click start, and this runs private void btnStart_Click(object sender, EventArgs e) { for (int i = 0; i < listFiles.CheckedItems.Count; i++) { } } It loops through all the selected file names. How do I open each of these .aspx files in the background, and go through them and add the id="thisItemId" attribute to each tag that's like a , , , , , etc....

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • Efficient way to delete a line from a text file (C#)

    - by Valentin Vasilyev
    Hello. I need to delete a certain line from a text file. What is the most efficient way of doing this? File can be potentially large(over million records). Thank you. UPDATE: below is the code I'm currently using, but I'm not sure if it is good. internal void DeleteMarkedEntries() { string tempPath=Path.GetTempFileName(); using (var reader = new StreamReader(logPath)) { using (var writer = new StreamWriter(File.OpenWrite(tempPath))) { int counter = 0; while (!reader.EndOfStream) { if (!_deletedLines.Contains(counter)) { writer.WriteLine(reader.ReadLine()); } ++counter; } } } if (File.Exists(tempPath)) { File.Delete(logPath); File.Move(tempPath, logPath); } }

    Read the article

  • What is the easiest way to loop through a folder of files in C#?

    - by badpanda
    I am new to C# and am trying to write a program that navigates the local file system using a config file containing relevant filepaths. My question is this: What are the best practices to use when performing file I/O (this will be from the desktop app to a server and back) and file system navigation in C#? I know how to google, and I have found several solutions, but I would like to know which of the various functions is most robust and flexible. As well, if anyone has any tips regarding exception handling for C# file I/O that would also be very helpful. Thanks!!! badPanda

    Read the article

  • How to delete duplicate/aggregate rows faster in a file using Java (no DB)

    - by S. Singh
    I have a 2GB big text file, it has 5 columns delimited by tab. A row will be called duplicate only if 4 out of 5 columns matches. Right now, I am doing dduping by first loading each coloumn in separate List , then iterating through lists, deleting the duplicate rows as it encountered and aggregating. The problem: it is taking more than 20 hours to process one file. I have 25 such files to process. Can anyone please share their experience, how they would go about doing such dduping? This dduping will be a throw away code. So, I was looking for some quick/dirty solution, to get job done as soon as possible. Here is my pseudo code (roughly) Iterate over the rows i=current_row_no. Iterate over the row no. i+1 to last_row if(col1 matches //find duplicate && col2 matches && col3 matches && col4 matches) { col5List.set(i,get col5); //aggregate } Duplicate example A and B will be duplicate A=(1,1,1,1,1), B=(1,1,1,1,2), C=(2,1,1,1,1) and output would be A=(1,1,1,1,1+2) C=(2,1,1,1,1) [notice that B has been kicked out]

    Read the article

  • Write problem - lossing the original data

    - by John
    Every time I write to the text file I will lose the original data, how can I read the file and enter the data in the empty line or the next line which is empty? public void writeToFile() { try { output = new Formatter(myFile); } catch(SecurityException securityException) { System.err.println("Error creating file"); System.exit(1); } catch(FileNotFoundException fileNotFoundException) { System.err.println("Error creating file"); System.exit(1); } Scanner scanner = new Scanner (System.in); String number = ""; String name = ""; System.out.println("Please enter number:"); number = scanner.next(); System.out.println("Please enter name:"); name = scanner.next(); output.format("%s,%s \r\n", number, name); output.close(); }

    Read the article

  • Strange IP addresses in tomcat

    - by mdev
    Some where I have this in some generic class. public static String getRequestIp (HttpServletRequest request){ String ipaddr = request.getHeader("X-FORWARDED-FOR"); if (ipaddr == null)ipaddr = request.getRemoteAddr(); return ipaddr; } For every request i call that method and in a certain moment i insert a record in a mysql database. In most cases it works normally and i can see a record for every request with a valid ip address in the right field. But sometimes where the IP should be there is something like this. "unknown, 93.186.30.120" or "10.0.1.169, 186.38.84.3" Apache is at the front listening at port 80 and used as proxy to Tomcat that listens at port 8081. My router config would not allow to pass any conection that come by any port other than 80. Any Help? Thanks in advance.

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • How to read from database and write into text file with C#?

    - by user147685
    How to read from database and write into text file? I want to write/copy (not sure what to call) the record inside my database into a text file. One row record in database is equal to one line in the text file. I'm having no problem in database. For creating text file, it mentions FileStream and StreamWriter. Which one should I use?

    Read the article

  • VB.NET 2008, Windows 7 and saving files

    - by James Brauman
    Hello, We have to learn VB.NET for the semester, my experience lies mainly with C# - not that this should make a difference to this particular problem. I've used just about the most simple way to save a file using the .NET framework, but Windows 7 won't let me save the file anywhere (or anywhere that I have found yet). Here is the code I am using to save a text file. Dim dialog As FolderBrowserDialog = New FolderBrowserDialog() Dim saveLocation As String = dialog.SelectedPath ... Build up output string ... Try ' Try to write the file. My.Computer.FileSystem.WriteAllText(saveLocation, output, False) Catch PermissionEx As UnauthorizedAccessException ' We do not have permissions to save in this folder. MessageBox.Show("Do not have permissions to save file to the folder specified. Please try saving somewhere different.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error) Catch Ex As Exception ' Catch any exceptions that occured when trying to write the file. MessageBox.Show("Writing the file was not successful.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try The problem is that this using this code throws an UnauthorizedAccessException no matter where I try to save the file. I've tried running the .exe file as administrator, and the IDE as administrator. Is this just Windows 7 being overprotective? And if so, what can I do to solve this problem? The requirements state that I be able to save a file! Thanks.

    Read the article

  • Make Directory.GetFiles() ignore protected folders

    - by Kryptic
    Hello Everyone, I'm using the Directory.GetFiles() method to get a list of files to operate on. This method throws an UnauthorizedAccessException for example when trying to access a protected folder. I would like it to simply skip over such folders and continue. How can I accomplish this with either Directory.GetFiles (preferably) or another method? Update: Here is the code that throws the exception. I am asking the user to select a directory and then retrieving the list of files. I commented out the code (so this is now whole method) that iterates through the files and the problem still occurs. The exception is thrown on the Directory.GetFiles() line. FolderBrowserDialog fbd = new FolderBrowserDialog(); DialogResult dr = fbd.ShowDialog(); if (dr == System.Windows.Forms.DialogResult.Cancel) return; string directory = fbd.SelectedPath; string[] files = Directory.GetFiles(directory, "*.html", SearchOption.AllDirectories);

    Read the article

  • Java I/O: How to append to an already existing text file.

    - by Joe
    Hi I am having no problem writing to or appending to a file, the only problem is that as soon as I quit the program and then run it again, it creates a new file overwriting my original file. This is a problem, as I am using the text file to keep a running tally. Is there a way to get an already created text file as an object and then append to it? Thanks in advance.

    Read the article

  • Improving File Read Performance (single file, C++, Windows)

    - by david
    I have large (hundreds of MB or more) files that I need to read blocks from using C++ on Windows. Currently the relevant functions are: errorType LargeFile::read( void* data_out, __int64 start_position, __int64 size_bytes ) const { if( !m_open ) { // return error } else { seekPosition( start_position ); DWORD bytes_read; BOOL result = ReadFile( m_file, data_out, DWORD( size_bytes ), &bytes_read, NULL ); if( size_bytes != bytes_read || result != TRUE ) { // return error } } // return no error } void LargeFile::seekPosition( __int64 position ) const { LARGE_INTEGER target; target.QuadPart = LONGLONG( position ); SetFilePointerEx( m_file, target, NULL, FILE_BEGIN ); } The performance of the above does not seem to be very good. Reads are on 4K blocks of the file. Some reads are coherent, most are not. A couple questions: Is there a good way to profile the reads? What things might improve the performance? For example, would sector-aligning the data be useful? I'm relatively new to file i/o optimization, so suggestions or pointers to articles/tutorials would be helpful.

    Read the article

  • Randomly Losing Session Variables Only In Google Chrome & URL Rewriting

    - by Toby
    Using Google Chrome, I'm seemingly losing/corrupting session data when navigating between pages (PHP 5.0.4, Apache 2.0.54). The website works perfectly fine in IE7/8, Firefox, Safari & Opera. The issue is only with Google Chrome. I narrowed down the problem. I'm using search friendly URL's, and hiding my front controller (index.php) via a .htaccess file. So the URL looks like: www.domain.com/blah/blah/ Here's the .htaccess file contents: Options +FollowSymlinks RewriteEngine on #allow cool urls RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^(.*) index.php [L] #allow to have Url without index.php If I remove the .htaccess file, and expose the front controller in the URL: www.domain.com/index.php/blah/blah/, Chrome works perfectly fine. Any thoughts ideas? I'm thinking it's some kind of problem with how Chrome identifies what cookie to use and send to the server? This happens in Chrome 4 & 5. Thanks!

    Read the article

  • Store data in file system rather than SQL or Oracle database.

    - by nunu
    Hi All, As I am working on Employee Management system, I have two table (for example) in database as given below. EmployeeMaster (DB table structure) EmployeeID (PK) | EmployeeName | City MonthMaster (DB table structure) Month | Year | EmployeeID (FK) | PrenentDays | BasicSalary Now my question is, I want to store data in file system rather than storing data in SQL or ORACLE. I want my data in file system storage for Insert, Edit and Delete opration with keeping relation with objects too. I am a C# developer, Could anybody have thoughts or idea on it. (To store data in file system with keeping relations between them) Thanks in advance. Any ideas on it?

    Read the article

  • What is the magic behind perl read() function and buffer which is not a ref ?

    - by alex8657
    I do not get to understand how the Perl read($buf) function is able to modify the content of the $buf variable. $buf is not a reference, so the parameter is given by copy (from my c/c++ knowledge). So how come the $buf variable is modified in the caller ? Is it a tie variable or something ? The C documentation about setbuf is also quite elusive and unclear to me # Example 1 $buf=''; # It is a scalar, not a ref $bytes = $fh->read($buf); print $buf; # $buf was modified, what is the magic ? # Example 2 sub read_it { my $buf = shift; return $fh->read($buf); } my $buf; $bytes = read_it($buf); print $buf; # As expected, this scope $buf was not modified

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >