Search Results

Search found 5425 results on 217 pages for 'drupal modules'.

Page 205/217 | < Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >

  • ASP.net Repeater Control Problem (nothing outputted from datasource(sqldatareader))

    - by Phil
    I have the following code to get the repeaters' data in my usercontrol (content.ascx.vb): If did = 0 Then s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", Data.SqlDbType.Int) x.Parameters("@contentid").Value = contentid c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r End If c.Close() r.Close() Else s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", SqlDbType.Int) x.Parameters("@contentid").Value = contentid x.Parameters.Add("@did", SqlDbType.Int) x.Parameters("@did").Value = did c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r c.Close() r.Close() End If End If Then I have the following repeater control markup in my usercontrol (content.ascx): <asp:Repeater ID="Contactinforepeater" runat="server"> <HeaderTemplate> <h1>Contact Information</h1> </HeaderTemplate> <ItemTemplate> <table width="50%"> <tr> <td colspan="2"><%#Container.DataItem("position")%></td> </tr> <tr> <td>Name:</td> <td><%#Container.DataItem("surname")%></td> </tr> <tr> <td>Telephone:</td> <td><%#Container.DataItem("telephone")%></td> </tr> <tr> <td>Fax:</td> <td><%#Container.DataItem("fax")%></td> </tr> <tr> <td>Email:</td> <td><%#Container.DataItem("email")%></td> </tr> </table> </ItemTemplate> <SeparatorTemplate><br /><hr /><br /></SeparatorTemplate> </asp:Repeater> When I insert this usercontrol into default.aspx with this code: <%@ Register src="Modules/Content.ascx" tagname="Content" tagprefix="uc1" %> and <form id="form1" runat="server"> <div> <uc1:Content ID="Content" runat="server" /> </div> </form> I do not get any error messages but the expected content from the database is not displayed. Can someone please show me the syntax to get this working or point out where I am going wrong? Thanks in advance!

    Read the article

  • Question about DBD::CSB Statement-Functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Function syntax When using SQL::Statement/SQL::Parser directly to parse SQL, functions (either built-in or user-defined) may occur anywhere in a SQL statement that values, column names, table names, or predicates may occur. When using the modules through a DBD or in any other context in which the SQL is both parsed and executed, functions can occur in the same places except that they can not occur in the column selection clause of a SELECT statement that contains a FROM clause. # valid for both parsing and executing SELECT MyFunc(args); SELECT * FROM MyFunc(args); SELECT * FROM x WHERE MyFuncs(args); SELECT * FROM x WHERE y < MyFuncs(args); # valid only for parsing (won't work from a DBD) SELECT MyFunc(args) FROM x WHERE y; Reading this I would expect that the first SELECT-statement of my example shouldn't work and the second should but it is quite the contrary. #!/usr/bin/env perl use warnings; use strict; use 5.010; use DBI; open my $fh, '>', 'test.csv' or die $!; say $fh "id,name"; say $fh "1,Brown"; say $fh "2,Smith"; say $fh "7,Smith"; say $fh "8,Green"; close $fh; my $dbh = DBI->connect ( 'dbi:CSV:', undef, undef, { RaiseError => 1, f_ext => '.csv', }); my $table = 'test'; say "\nSELECT 1"; my $sth = $dbh->prepare ( "SELECT MAX( id ) FROM $table WHERE name LIKE 'Smith'" ); $sth->execute (); $sth->dump_results(); say "\nSELECT 2"; $sth = $dbh->prepare ( "SELECT * FROM $table WHERE id = MAX( id )" ); $sth->execute (); $sth->dump_results(); outputs: SELECT 1 '7' 1 rows SELECT 2 Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2893. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. Could someone explaine me this behavior?

    Read the article

  • How do you clear RootLayoutPanel in GWT?

    - by kerrr
    I have Buttons attached to elements on the modules entrypoint html page using RootPanel.get("foo").add(button). If I subsequently create a LayoutPanel and attach it using RootLayoutPanel.get.add(layoutpanal) then the buttons cannot be clicked. This is all fine. If I then try and remove the layoutpanel or clear the RootLayoutPanel the buttons still cannot be clicked. Any ideas how to clear this? Have I missed a step or should you simply never try and get back to using a page's RootPanel if you have used a RootLayoutPanel? Sample code: public void onModuleLoad(){ final LayoutPanel lp1=new LayoutPanel(); ClickPanel ping=new ClickPanel("Ping"); ping.getElement().getStyle().setBackgroundColor( "#fdd" ); ping.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ Window.alert( "Ping!!!" ); //lp1.removeFromParent(); //RootLayoutPanel.get().remove(lp1); //RootLayoutPanel.get().removeFromParent(); RootLayoutPanel.get().clear(); } } ); ClickPanel bong=new ClickPanel("Bong"); bong.getElement().getStyle().setBackgroundColor( "#ddf" ); bong.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ Window.alert( "Bong!!!" ); } } ); lp1.add( ping ); lp1.setWidgetLeftWidth( ping, 100, Style.Unit.PX, 500, Style.Unit.PX ); lp1.setWidgetTopHeight( ping, 100, Style.Unit.PX, 500, Style.Unit.PX ); lp1.add( bong ); lp1.setWidgetLeftWidth( bong, 50, Style.Unit.PCT, 600, Style.Unit.PX ); lp1.setWidgetTopHeight( bong, 50, Style.Unit.PCT, 200, Style.Unit.PX ); Button b=new Button("Click Me"); b.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ RootLayoutPanel.get().add( lp1 ); } } ); RootPanel.get("button1").add( b ); } ClickPanel is simply overrides HTMLPanel implementing HasClickHandelers. Clicking "Click Me" opens the layout panel. Clicking the panel ping gets rid of the layout panel, but the button "Click Me" cannot be clicked. I've tried various options.

    Read the article

  • How do I delete a [sub]hash based off of the keys/values of another hash?

    - by Zack
    Lets assume I have two hashes. One of them contains a set of data that only needs to keep things that show up in the other hash. e.g. my %hash1 = ( test1 => { inner1 => { more => "alpha", evenmore => "beta" } }, test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, test3 => { inner9999 => { ohlookmore => "golf", somethingelse => "foxtrot" } } ); my %hash2 = ( major=> { test2 => "inner2", test3 => "inner3" } ); What I would like to do, is to delete the whole subhash in hash1 if it does not exist as a key/value in hash2{major}, preferably without modules. The information contained in "innerX" does not matter, it merely must be left alone (unless the subhash is to be deleted then it can go away). In the example above after this operation is preformed hash1 would look like: my %hash1 = ( test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, ); It deletes hash1{test1} and hash1{test3} because they don't match anything in hash2. Here's what I've currently tried, but it doesn't work. Nor is it probably the safest thing to do since I'm looping over the hash while trying to delete from it. However I'm deleting at the each which should be okay? This was my attempt at doing this, however perl complains about: Can't use string ("inner1") as a HASH ref while "strict refs" in use at while(my ($test, $inner) = each %hash1) { if(exists $hash2{major}{$test}{$inner}) { print "$test($inner) is in exists.\n"; } else { print "Looks like $test($inner) does not exist, REMOVING.\n"; #not to sure if $inner is needed to remove the whole entry delete ($hash1{$test}{$inner}); } }

    Read the article

  • Using PHP session_id() to Make Sure iframe is Generated by Our Server Dynamically

    - by Michael Robinson
    We use iframes to show ads on our site. Iframes are used to allow us to keep the ad generation code and other site modules separate. As we track ad views on our site, and need to be able to keep an accurate count of which pagetype gets what views, I must ensure that users can't simply copy-paste the iframe in which the ad is loaded onto another site. This would cause ad count to become inflated for this page, and the count would not match the view count of the page the iframe "should" be displayed in. Before anyone says so: no I can't simply compare the page view count with the ad view count, or use the page view count * number of ads per page, as # of ads per page will not necessarily be static. I need to come up with a solution that will allow ads to be shown only for iframes that are generated dynamically and are shown on our pages. I am not familiar with PHP sessions, but from what little reading I have had time to do, the following seems to be to be an acceptable solution: Add "s = session_id()" to the src of the ad's iframe. In the code that receives and processes ad requests, only return (and count) and ad if s == session_id(). Please correct me if I'm wrong, but this would ensure: Ads would only be returned to iframes whose src was generated alongside the rest of the page's content, as is the case during normal use. We can return our logo to ad calls with an invalid session_id. So a simple example would be: One of our pages: <?php session_start(); ?> <div id="someElement"> <!-- EVERYONE LOVES ADS --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=<?php echo session_id(); ?>></iframe> </div> ad/can_has_ad.php: <?php session_start(); ?> if($_GET['s'] == session_id()){ echo 'can has ad'; } else{ echo '<img src="http://awesomesite.com/images/canhaslogo.jpg"/>'; } And finally, copied code with static 's' parameter: <!-- HAHA LULZ I WILL SCREW WITH YOUR AD VIEW COUNTS LULZ HAHA --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=77f2b5fcdab52f52607888746969b0ad></iframe> Which would give them an iframe showing our awesome site's logo, and not screw with our view counts. I made some basic test cases: two files, one that generates the iframe and echos it, and one that the iframe's src is pointed to, that checks the 's' parameter and shows an appropriate message depending on the result. I copied the iframe into a file and hosted it on a different server, and the correct message was displayed (cannot has ad). So, my question is: Would this work or am I being a PHP session noob, with the above test being a total fluke? Thanks for your time! Edit: I'm trying to solve this without touching the SQL server

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Myself throwing NullReferenceException... needs help

    - by Amit Ranjan
    I know it might be a weird question and its Title too, but i need your help. I am a .net dev , working on platform for the last 1.5 years. I am bit confused on the term usually we say " A Good Programmer ". I dont know ,what are the qualities of a good programmer ? Is the guy who writes a bug free code? or Can develop applications solely? or blah blah blah...lots of points. I dont know... But as far i am concerned , I know I am not a good programmer, still in learning phase an needs a lot to learn in coming days. So you guys are requested to please help me with this two problems of mine My first problem is regarding the proper Error Handling, which is a most debatable aspect of programming. We all know we use ` try { } catch { } finally { } ` in our code to manage exception. But even if I use try { } catch(exception ex) { throw ex } finally { } , different guys have different views. I still dont know the good way to handle errors. I can write code, use try-catch but still i feel I lacks something. When I saw the codes generated by .net fx tools even they uses throw ex or `throw new Exception("this is my exception")`.. I am just wondering what will be the best way to achieve the above. All means the same thing but why we avoid something. If it has some demerits then it must be made obselete.Anyways I still dont have one [how to handle errors efficiently?]. I generally follow the try-catch(execoption ex){throw ex}, and usually got stucked in debates with leads why you follow this why not that... 2.Converting your entire code blocks in modules using Design patterns of some OOPs concepts. How do you guys decide what architeture or pattern will be the best for my upcoming application based on its working, flow etc. I need to know what you guys can see that I can't. Since I know , I dont have that much experience but I can say, with my experience that experience doesnot comes either from degree/certificates or success you made instead it cames from failures you faced or got stucking situations. Pleas help me out.

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to interpret kernel panics?

    - by Owen
    Hi all, I'm new to linux kernel and could barely understand how to debug kernel panics. I have this error below and I don't know where in the C code should I start checking. I was thinking maybe I could echo what functions are being called so I could check where in the code is this null pointer dereferenced. What print function should I use ? How do you interpret the error message below? Unable to handle kernel NULL pointer dereference at virtual address 0000000d pgd = c7bdc000 [0000000d] *pgd=4785f031, *pte=00000000, *ppte=00000000 Internal error: Oops: 17 [#1] PREEMPT Modules linked in: bcm5892_secdom_fw(P) bcm5892_lcd snd_bcm5892 msr bcm5892_sci bcm589x_ohci_p12 bcm5892_skeypad hx_decoder(P) pinnacle hx_memalloc(P) bcm_udc_dwc scsi_mod g_serial sd_mod usb_storage CPU: 0 Tainted: P (2.6.27.39-WR3.0.2ax_standard #1) PC is at __kmalloc+0x70/0xdc LR is at __kmalloc+0x48/0xdc pc : [c0098cc8] lr : [c0098ca0] psr: 20000093 sp : c7a9fd50 ip : c03a4378 fp : c7a9fd7c r10: bf0708b4 r9 : c7a9e000 r8 : 00000040 r7 : bf06d03c r6 : 00000020 r5 : a0000093 r4 : 0000000d r3 : 00000000 r2 : 00000094 r1 : 00000020 r0 : c03a4378 Flags: nzCv IRQs off FIQs on Mode SVC_32 ISA ARM Segment user Control: 00c5387d Table: 47bdc008 DAC: 00000015 Process sh (pid: 1088, stack limit = 0xc7a9e260) Stack: (0xc7a9fd50 to 0xc7aa0000) fd40: c7a6a1d0 00000020 c7a9fd7c c7ba8fc0 fd60: 00000040 c7a6a1d0 00000020 c71598c0 c7a9fd9c c7a9fd80 bf06d03c c0098c64 fd80: c71598c0 00000003 c7a6a1d0 bf06c83c c7a9fdbc c7a9fda0 bf06d098 bf06d008 fda0: c7159880 00000000 c7a6a2d8 c7159898 c7a9fde4 c7a9fdc0 bf06d130 bf06d078 fdc0: c79ca000 c7159880 00000000 00000000 c7afbc00 c7a9e000 c7a9fe0c c7a9fde8 fde0: bf06d4b4 bf06d0f0 00000000 c79fd280 00000000 0f700000 c7a9e000 00000241 fe00: c7a9fe3c c7a9fe10 c01c37b4 bf06d300 00000000 c7afbc00 00000000 00000000 fe20: c79cba84 c7463c78 c79fd280 c7473b00 c7a9fe6c c7a9fe40 c00a184c c01c35e4 fe40: 00000000 c7bb0005 c7a9fe64 c79fd280 c7463c78 00000000 c00a1640 c785e380 fe60: c7a9fe94 c7a9fe70 c009c438 c00a164c c79fd280 c7a9fed8 c7a9fed8 00000003 fe80: 00000242 00000000 c7a9feb4 c7a9fe98 c009c614 c009c2a4 00000000 c7a9fed8 fea0: c7a9fed8 00000000 c7a9ff64 c7a9feb8 c00aa6bc c009c5e8 00000242 000001b6 fec0: 000001b6 00000241 00000022 00000000 00000000 c7a9fee0 c785e380 c7473b00 fee0: d8666b0d 00000006 c7bb0005 00000300 00000000 00000000 00000001 40002000 ff00: c7a9ff70 c79b10a0 c79b10a0 00005402 00000003 c78d69c0 ffffff9c 00000242 ff20: 000001b6 c79fd280 c7a9ff64 c7a9ff38 c785e380 c7473b00 00000000 00000241 ff40: 000001b6 ffffff9c 00000003 c7bb0000 c7a9e000 00000000 c7a9ff94 c7a9ff68 ff60: c009c128 c00aa380 4d18b5f0 08000000 00000000 00071214 0007128c 00071214 ff80: 00000005 c0027ee4 c7a9ffa4 c7a9ff98 c009c274 c009c0d8 00000000 c7a9ffa8 ffa0: c0027d40 c009c25c 00071214 0007128c 0007128c 00000241 000001b6 00000000 ffc0: 00071214 0007128c 00071214 00000005 00073580 00000003 000713e0 400010d0 ffe0: 00000001 bef0c7b8 000269cc 4d214fec 60000010 0007128c 00000000 00000000 Backtrace: [] (__kmalloc+0x0/0xdc) from [] (gs_alloc_req+0x40/0x70 [g_serial]) r8:c71598c0 r7:00000020 r6:c7a6a1d0 r5:00000040 r4:c7ba8fc0 [] (gs_alloc_req+0x0/0x70 [g_serial]) from [] (gs_alloc_requests+0x2c/0x78 [g_serial]) r7:bf06c83c r6:c7a6a1d0 r5:00000003 r4:c71598c0 [] (gs_alloc_requests+0x0/0x78 [g_serial]) from [] (gs_start_io+0x4c/0xac [g_serial]) r7:c7159898 r6:c7a6a2d8 r5:00000000 r4:c7159880 [] (gs_start_io+0x0/0xac [g_serial]) from [] (gs_open+0x1c0/0x224 [g_serial]) r9:c7a9e000 r8:c7afbc00 r7:00000000 r6:00000000 r5:c7159880 r4:c79ca000 [] (gs_open+0x0/0x224 [g_serial]) from [] (tty_open+0x1dc/0x314) [] (tty_open+0x0/0x314) from [] (chrdev_open+0x20c/0x22c) [] (chrdev_open+0x0/0x22c) from [] (__dentry_open+0x1a0/0x2b8) r8:c785e380 r7:c00a1640 r6:00000000 r5:c7463c78 r4:c79fd280 [] (__dentry_open+0x0/0x2b8) from [] (nameidata_to_filp+0x38/0x50) [] (nameidata_to_filp+0x0/0x50) from [] (do_filp_open+0x348/0x6f4) r4:00000000 [] (do_filp_open+0x0/0x6f4) from [] (do_sys_open+0x5c/0x170) [] (do_sys_open+0x0/0x170) from [] (sys_open+0x24/0x28) r8:c0027ee4 r7:00000005 r6:00071214 r5:0007128c r4:00071214 [] (sys_open+0x0/0x28) from [] (ret_fast_syscall+0x0/0x2c) Code: e59c4080 e59c8090 e3540000 159c308c (17943103) ---[ end trace be196e7cee3cb1c9 ]--- note: sh[1088] exited with preempt_count 2 process '-/bin/sh' (pid 1088) exited. Scheduling for restart. Welcome to Wind River Linux

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • mod_rewrite not working for a specific directory

    - by punkish
    This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

    Read the article

  • Do you use an exception class in your Perl programs? Why or why not?

    - by daotoad
    I've got a bunch of questions about how people use exceptions in Perl. I've included some background notes on exceptions, skip this if you want, but please take a moment to read the questions and respond to them. Thanks. Background on Perl Exceptions Perl has a very basic built-in exception system that provides a spring-board for more sophisticated usage. For example die "I ate a bug.\n"; throws an exception with a string assigned to $@. You can also throw an object, instead of a string: die BadBug->new('I ate a bug.'); You can even install a signal handler to catch the SIGDIE psuedo-signal. Here's a handler that rethrows exceptions as objects if they aren't already. $SIG{__DIE__} = sub { my $e = shift; $e = ExceptionObject->new( $e ) unless blessed $e; die $e; } This pattern is used in a number of CPAN modules. but perlvar says: Due to an implementation glitch, the $SIG{DIE} hook is called even inside an eval(). Do not use this to rewrite a pending exception in $@ , or as a bizarre substitute for overriding CORE::GLOBAL::die() . This strange action at a distance may be fixed in a future release so that $SIG{DIE} is only called if your program is about to exit, as was the original intent. Any other use is deprecated. So now I wonder if objectifying exceptions in sigdie is evil. The Questions Do you use exception objects? If so, which one and why? If not, why not? If you don't use exception objects, what would entice you to use them? If you do use exception objects, what do you hate about them, and what could be better? Is objectifying exceptions in the DIE handler a bad idea? Where should I objectify my exceptions? In my eval{} wrapper? In a sigdie handler? Are there any papers, articles or other resources on exceptions in general and in Perl that you find useful or enlightening.

    Read the article

  • Send invitation to any user of google chats (is it possible?)

    - by Gizzo
    Hi I try to realize simple code on perl which should just get/send messages from/to gtalk accounts. I use Net::XMPP::* modules. All works just fine for users, who are my friends (in my "buddy" list). But i can't send message to unknown user. I know, that for this case i must send an invitation first, but Net::XMPP::* don't provide this possibility. There is only one way to invite person - construct my own xml according to "XEP-0155 Stanza Session Negotiation" protocol. But this doesn't work correct. When i send xml to server, it returns error "service-unavailable". I send: <message to='[email protected]'> <sxde xmlns='http://jabber.org/protocol/sxde' xmlns:sxde='http://jabber.org/protocol/sxde#metadata' session='0AEF4278DC4B6577' id='b'> <negotiation> <invitation> <feature var='http://jabber.org/protocol/whiteboard' /> </invitation> </negotiation> </sxde> </message> before my message. ANSWER: <message from='' to='[email protected]/TALKCDDCCE63' type='error'> <sxde id='b' session='0AEF4278DC4B6577' xmlns='http://jabber.org/protocol/sxde' xmlns:sxde='http://jabber.org/protocol/sxde#metadata'> <negotiation> <invitation> <feature var='http://jabber.org/protocol/whiteboard'/> </invitation> </negotiation> </sxde> <nos:x value='disabled' xmlns:nos='google:nosave'/> <arc:record otr='false' xmlns:arc='http://jabber.org/protocol/archive'/> <error code='503' type='cancel'> <service-unavailable xmlns='urn:ietf:params:xml:ns:xmpp-stanzas'/> </error> </message> Maybe i lost smth or should send another info before (or after..) ? Or maybe there are another way to send message without any invitation? Thanks in advance

    Read the article

  • Passing custom info to mongrel_rails start

    - by whaka
    One thing I really don't understand is how I can pass custom start-up options to a mongrel instance. I see that a common approach is the use environment variables, but in my environment this is not going to work because my rails application serves many different clients. Much code is shared between clients, but there are also many differences which I implement by subclassing controllers and views to overload or extend existing features or introduce new ones. To make this all work, I simply add the paths to client specific modules the module load path ($:). In order to start the application for a particular client, I could now use an environment variable like say, TARGET=AMAZONE. Unfortunately, on some systems I'm running multiple mongrel clusters, each cluster serving a different client. Some of these systems run under Windows and to start mongrel I installed mongrel_services. Clearly, this makes my environment variable unsuitable. Passing this extra bit of data to the application is proving to be a real challenge. For a start, mongrel_rails service_install will reject any [custom] command line parameters that aren't documented. I'm not too concerned as installing the services using the install program is trivial. However, even if I manage to install mongrel_services such that when run it passes the custom command line option --target to mongrel_rails start, I get an error because mongrel_rails doesn't recognize the switch. So here were the things I looked at: Pass an extra parameter: mongrel_rails start --target XYZ ... use a config file and add target:XYZ, then do: mongrel_rails start -C x:\myapp\myconfig.yml modify the file: Ruby\lib\ruby\gems\1.8\gems\mongrel-1.1.5-x86-mswin32-60\lib\mongrel\command.rb Perhaps I can use the --script option, but all docs that I found on it were for Unix 1 and 2 simply don't work. I played with 4 but never managed it to do anything. So I had no choice but to go with 3. While it is relatively simple, I hate changing ruby library code. Particularly disappointing is that 2 doesn't work. I mean what is so unreasonable about adding other [custom] options in the config file? Actually I think this is a fundamental piece that is missing in rails. Somehow, the application should be able to register and access command line arguments it expects. If anybody has a good idea how to do this more elegantly using the current infrastructure, I have a chocolate fish to give away!!!

    Read the article

  • Archive tar files to a different location inperl

    - by user314261
    Hi, I am a newbee in Perl. I am reading a directory having some archive files and uncompressing the archive files one by one. Everything seems well however the files are getting uncompressed in the folder which has the main perl code module which is running the sub modules. I want the archive to be generated in the folder I specify. This is my code: sub ExtractFile { #Read the folder which was copied in the output path recursively and extract if any file is compressed my $dirpath = $_[0]; opendir(D, "$dirpath") || die "Can't open dir $dirpath: $!\n"; my @list = readdir(D); closedir(D); foreach my $f (@list) { print " \$f = $f"; if(-f $dirpath."/$f") { #print " File in directory $dirpath \n ";#is \$f = $f\n"; my($file_name, $file_dirname,$filetype)= fileparse($f,qr{\..*}); #print " \nThe file extension is $filetype"; #print " \nThe file name is is $file_name"; # If compressed file then extract the file if($filetype eq ".tar" or $filetype eq ".tzr.gz") { my $arch_file = $dirpath."/$f"; print "\n file to be extracted is $arch_file"; my $tar = Archive::Tar->new($arch_file); #$tar->extract() or die ("Cannot extract file $arch_file"); #mkdir($dirpath."/$file_name"); $tar->extract_file($arch_file,$dirpath."/$file_name" ) or die ("Cannot extract file $arch_file"); } } if(-d $dirpath."/$f") { if($f eq "." or $f eq "..") { next; } print " Directory\n";# is $f"; ExtractFile($dirpath."/$f"); } } } The method ExtractFile is called recursively to loop all the archives. When using $tar-extract() it uncompresses in the folder which calls this metohd. when I use $tar-extract_file($arch_file,$dirpath."/$file_name" ) I get an error : No such file in archive: '/home/fsang/dante/workspace/output/s.tar' at /home/fsang/dante/lib/Extraction.pm line 80 Please help I have checked that path and input output there is no issue with it. Seems some usage problem I am not aware of for $tar-extract_file(). Many thanks for anyone resolving this issue. Regards, Sakshi

    Read the article

  • Lighttpd + fastcgi + python (for django) slow on first request

    - by EagleOne
    I'm having a problem with a django website I host with lighttpd + fastcgi. It works great but it seems that the first request always takes up to 3seconds. Subsequent requests are much faster (<1s). I activated access logs in lighttpd in order to track the issue. But I'm kind of stuck. Here are logs where I 'lose' 4s (from 10:04:17 to 10:04:21): 2012-12-01 10:04:17: (mod_fastcgi.c.3636) handling it in mod_fastcgi 2012-12-01 10:04:17: (response.c.470) -- before doc_root 2012-12-01 10:04:17: (response.c.471) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.472) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.473) Path : 2012-12-01 10:04:17: (response.c.521) -- after doc_root 2012-12-01 10:04:17: (response.c.522) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.523) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.524) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:17: (response.c.541) -- logical -> physical 2012-12-01 10:04:17: (response.c.542) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.543) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.544) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:21: (response.c.128) Response-Header: HTTP/1.1 200 OK Last-Modified: Sat, 01 Dec 2012 09:04:21 GMT Expires: Sat, 01 Dec 2012 09:14:21 GMT Content-Type: text/html; charset=utf-8 Cache-Control: max-age=600 Transfer-Encoding: chunked Date: Sat, 01 Dec 2012 09:04:21 GMT Server: lighttpd/1.4.28 I guess that if there is a problem, it's whith my configuration. So here is the way I launch my django app: python manage.py runfcgi method=threaded host=127.0.0.1 port=3033 And here is my lighttpd conf: server.modules = ( "mod_access", "mod_alias", "mod_compress", "mod_redirect", "mod_rewrite", "mod_fastcgi", "mod_accesslog", ) server.document-root = "/var/www" server.upload-dirs = ( "/var/cache/lighttpd/uploads" ) server.errorlog = "/var/log/lighttpd/error.log" server.pid-file = "/var/run/lighttpd.pid" server.username = "www-data" server.groupname = "www-data" accesslog.filename = "/var/log/lighttpd/access.log" debug.log-request-header = "enable" debug.log-response-header = "enable" debug.log-file-not-found = "enable" debug.log-request-handling = "enable" debug.log-timeouts = "enable" debug.log-ssl-noise = "enable" debug.log-condition-cache-handling = "enable" debug.log-condition-handling = "enable" fastcgi.server = ( "/finderauto.fcgi" => ( "main" => ( # Use host / port instead of socket for TCP fastcgi "host" => "127.0.0.1", "port" => 3033, #"socket" => "/home/finderadmin/finderauto.sock", "check-local" => "disable", "fix-root-scriptname" => "enable", ) ), ) alias.url = ( "/media" => "/home/user/django/contrib/admin/media/", ) url.rewrite-once = ( "^(/media.*)$" => "$1", "^/favicon\.ico$" => "/media/favicon.ico", "^(/.*)$" => "/finderauto.fcgi$1", ) index-file.names = ( "index.php", "index.html", "index.htm", "default.htm", " index.lighttpd.html" ) url.access-deny = ( "~", ".inc" ) static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ## Use ipv6 if available #include_shell "/usr/share/lighttpd/use-ipv6.pl" dir-listing.encoding = "utf-8" server.dir-listing = "enable" compress.cache-dir = "/var/cache/lighttpd/compress/" compress.filetype = ( "application/x-javascript", "text/css", "text/html", "text/plain" ) include_shell "/usr/share/lighttpd/create-mime.assign.pl" include_shell "/usr/share/lighttpd/include-conf-enabled.pl" If any of you could help me finding out where I lose these 3 or 4 s. I would much appreciate. Thanks in advance!

    Read the article

  • sys.path() and PYTHONPATH issues

    - by Justin
    I've been learning Python, I'm working in 2.7.3, and I'm trying to understand import statements. The documentation says that when you attempt to import a module, the interpreter will first search for one of the built-in modules. What is meant by a built-in module? Then, the documentation says that the interpreter searches in the directories listed by sys.path, and that sys.path is initialized from these sources: the directory containing the input script (or the current directory). PYTHONPATH (a list of directory names, with the same syntax as the shell variable PATH). the installation-dependent default. Here is a sample output of a sys.path command from my computer using python in command-line mode: (I deleted a few so that it wouldn't be huge) ['', '/usr/lib/python2.7', '/usr/lib/python2.7/lib-old', '/usr/lib/python2.7/lib-dynload', '/usr/local/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages/PIL', '/usr/lib/python2.7/dist-packages/gst-0.10', '/usr/lib/python2.7/dist-packages/gtk-2.0', '/usr/lib/pymodules/python2.7', '/usr/lib/python2.7/dist-packages/ubuntuone-couch', '/usr/lib/python2.7/dist-packages/ubuntuone-storage-protocol'] Now, I'm assuming that the '' path refers to the directory containing the 'script', and so I figured the rest of them would be coming from my PYTHONPATH environmental variable. However, when I go to the terminal and type env, PYTHONPATH doesn't exist as an environmental variable. I also tried import os then os.environ, but I get the same output. Do I really not have a PYTHONPATH environmental variable? I don't believe I ever specifically defined a PYTHONPATH environmental variable, but I assumed that when I installed new packages they automatically altered that environment variable. If I don't have a PYTHONPATH, how is my sys.path getting populated? If I download new packages, how does Python know where to look for them if I don't have this PYTHONPATH variable? How do environment variables work? From what I understand, environment variables are specific to the process for which they are set, however, if I open multiple terminal windows and run env, they all display a number of identical variables, for example, PATH. I know there file locations for persistent environment variables, for example /etc/environment, which contains my PATH variable. Is it possible to tell where a persistent environment variable is stored? What is the recommended location for storing new persistent environment variables? How do environment variables actually work with say, the Python interpreter? The Python interpreter looks for PYTHONPATH, but how does it work at the nitty-gritty level?

    Read the article

  • unmet dependencies in Ubuntu 12.04

    - by lee.O
    I tried today to install a dvb-card on my Ubuntu 12.04 (Linux blauhai-linux 3.2.0-25-generic #40-Ubuntu SMP Wed May 23 20:30:51 UTC 2012 x86_64 x86_64 x86_64 GNU/Linux ). The installation failed with an error. After that, i tried to install python (it was already installed but i got this error): linux:~$ sudo apt-get install git Reading package lists... Done Building dependency tree Reading state information... Done git is already the newest version. You might want to run 'apt-get -f install' to correct these: The following packages have unmet dependencies: python-glade2:i386 : Depends: python:i386 (< 2.5) but it is not going to be installed Depends: python-support:i386 (= 0.3.4) but it is not installable Depends: python:i386 (= 2.4) but it is not going to be installed Depends: libglade2-0:i386 (= 1:2.5.1) but it is not going to be installed Depends: python-gtk2:i386 (= 2.8.6-8) but it is not going to be installed python-numeric:i386 : Depends: python:i386 (< 2.5) but it is not going to be installed Depends: python:i386 (= 2.3) but it is not going to be installed Depends: python-central:i386 (= 0.5.7) but it is not installable E: Unmet dependencies. Try 'apt-get -f install' with no packages (or specify a solution). well, i can read and tried the proposed command, but then i get this: linux:~$ sudo apt-get -f install Reading package lists... Done Building dependency tree Reading state information... Done Correcting dependencies... Done The following packages were automatically installed and are no longer required: libopenal1:i386 libsdl-ttf2.0-0:i386 libkrb5-3:i386 libgconf-2-4:i386 libsm-dev libatk1.0-0:i386 libk5crypto3:i386 libstdc++5:i386 libqt4-declarative:i386 libxcomposite1:i386 libice-dev libgail18:i386 libldap-2.4-2:i386 libao-common libv4l-0:i386 liblcms1:i386 libqt4-qt3support:i386 libroken18-heimdal:i386 libunistring0:i386 libcupsimage2:i386 libgphoto2-port0:i386 libidn11:i386 libnss3:i386 libcaca0:i386 gtk2-engines:i386 libgudev-1.0-0:i386 libjpeg-turbo8:i386 libpthread-stubs0 libcairo-gobject2:i386 libavc1394-0:i386 libjpeg8:i386 libotr2 libaio1:i386 libsane:i386 odbcinst1debian2 odbcinst1debian2:i386 libqt4-test:i386 libqt4-script:i386 libqt4-designer:i386 libsdl-mixer1.2:i386 libqt4-network:i386 libqt4-dbus:i386 libcap2:i386 libproxy1:i386 ibus-gtk:i386 libdbus-glib-1-2:i386 libtdb1:i386 libasn1-8-heimdal:i386 libspeex1:i386 libxslt1.1:i386 libgomp1:i386 libcapi20-3:i386 libibus-1.0-0:i386 libcairo2:i386 libgnutls26:i386 libopenal-data odbcinst libgssapi3-heimdal:i386 libcanberra0:i386 libtasn1-3:i386 libfreetype6:i386 x11proto-kb-dev gtk2-engines-murrine:i386 libwavpack1:i386 libqt4-opengl:i386 libsoup-gnome2.4-1:i386 libv4lconvert0:i386 gstreamer0.10-plugins-good:i386 libc6-i386 lib32gcc1 libqt4-xmlpatterns:i386 librsvg2-common:i386 libdatrie1:i386 xtrans-dev libavahi-common-data:i386 libiec61883-0:i386 lib32asound2 libgdk-pixbuf2.0-0:i386 libsdl-image1.2:i386 libp11-kit0:i386 x11proto-input-dev libwind0-heimdal:i386 libpixman-1-0:i386 libsdl1.2debian:i386 libxaw7:i386 libgdbm3:i386 libcups2:i386 libcurl3:i386 libqtcore4:i386 libxinerama1:i386 libesd0:i386 libmikmod2:i386 libkrb5support0:i386 libxft2:i386 libxt-dev libcroco3:i386 libpulse-mainloop-glib0:i386 libice6:i386 libaa1:i386 libieee1284-3:i386 libgcrypt11:i386 libthai0:i386 libao4:i386 libkeyutils1:i386 libxmu6:i386 libcanberra-gtk0:i386 libvorbisfile3:i386 libqt4-sql:i386 esound-common libxpm4:i386 libqt4-svg:i386 libusb-0.1-4:i386 libgail-common:i386 libxrender1:i386 libhcrypto4-heimdal:i386 libraw1394-11:i386 libnspr4:i386 libshout3:i386 libdv4:i386 libhx509-5-heimdal:i386 libxau-dev libqt4-xml:i386 gstreamer0.10-x:i386 libgettextpo0:i386 libxss1:i386 libgd2-xpm:i386 libheimbase1-heimdal:i386 libtiff4:i386 libsdl-net1.2:i386 libjasper1:i386 libgnome-keyring0:i386 libxtst6:i386 gtk2-engines-pixbuf:i386 libqtgui4:i386 libtag1c2a:i386 librsvg2-2:i386 libavahi-client3:i386 libssl0.9.8:i386 libmpg123-0:i386 libmad0:i386 libsasl2-2:i386 xorg-sgml-doctools libgsoap1 gtk2-engines-oxygen:i386 libfontconfig1:i386 xaw3dg:i386 libpango1.0-0:i386 libsm6:i386 libx11-dev libheimntlm0-heimdal:i386 libpulsedsp:i386 lib32stdc++6 libx11-doc libqt4-sql-mysql:i386 libxcb-render0:i386 libodbc1:i386 libexif12:i386 libqt4-scripttools:i386 librtmp0:i386 libgssapi-krb5-2:i386 libxi6:i386 libqtwebkit4:i386 libxcb1-dev libxp6:i386 libaudio2:i386 libxcursor1:i386 libxcb-shm0:i386 libxt6:i386 libxv1:i386 libsasl2-modules:i386 libavahi-common3:i386 libxrandr2:i386 x11proto-core-dev libsqlite3-0:i386 libmng1:i386 libgtk2.0-0:i386 libxdmcp-dev libpthread-stubs0-dev libltdl7:i386 libkrb5-26-heimdal:i386 libssl1.0.0:i386 glib-networking:i386 libgpg-error0:i386 libsoup2.4-1:i386 libgphoto2-2:i386 libtag1-vanilla:i386 libaudiofile1:i386 libglade2-0:i386 Use 'apt-get autoremove' to remove them. The following extra packages will be installed: default-jre default-jre-headless icedtea-6-jre-cacao icedtea-6-jre-jamvm icedtea-netx icedtea-netx-common libglade2-0:i386 libpython3.2 openjdk-6-jre openjdk-6-jre-headless openjdk-6-jre-lib python3 python3-minimal python3-uno python3.2 python3.2-minimal Suggested packages: icedtea-plugin sun-java6-fonts fonts-ipafont-gothic fonts-ipafont-mincho ttf-telugu-fonts ttf-oriya-fonts ttf-kannada-fonts ttf-bengali-fonts python3-doc python3-tk python3.2-doc binfmt-support The following packages will be REMOVED: activity-log-manager-control-center aisleriot alacarte apparmor apport apport-gtk apt-xapian-index aptdaemon apturl apturl-common bluez bluez-alsa bluez-alsa:i386 bluez-gstreamer checkbox checkbox-qt command-not-found compiz compiz-gnome compiz-plugins-main-default compizconfig-backend-gconf deja-dup duplicity eog evolution-data-server firefox firefox-globalmenu firefox-gnome-support foomatic-db-compressed-ppds gconf-editor gconf2 gdb gedit gir1.2-mutter-3.0 gir1.2-peas-1.0 gir1.2-rb-3.0 gir1.2-totem-1.0 gir1.2-ubuntuoneui-3.0 gksu gnome-applets gnome-applets-data gnome-bluetooth gnome-contacts gnome-control-center gnome-media gnome-menus gnome-orca gnome-panel gnome-panel-data gnome-session-fallback gnome-shell gnome-sudoku gnome-terminal gnome-terminal-data gnome-themes-standard gnome-tweak-tool gnome-user-share gstreamer0.10-gconf gwibber gwibber-service gwibber-service-facebook gwibber-service-identica gwibber-service-twitter hplip hplip-data ia32-libs ia32-libs-multiarch:i386 ibus ibus-pinyin ibus-table indicator-datetime indicator-power jockey-common jockey-gtk landscape-client-ui-install language-selector-common language-selector-gnome launchpad-integration libcanberra-gtk-module libcanberra-gtk-module:i386 libcanberra-gtk3-module libcompizconfig0 libfolks-eds25 libgksu2-0 libgnome-media-profiles-3.0-0 libgnome2-0 libgnome2-common libgnomevfs2-0 libgnomevfs2-common libgweather-3-0 libgweather-common libgwibber-gtk2 libgwibber2 libmetacity-private0 libmutter0 libpeas-1.0-0 libpurple-bin libpython2.7 libreoffice-gnome librhythmbox-core5 libsyncdaemon-1.0-1 libtotem0 libubuntuoneui-3.0-1 light-themes lsb-release metacity metacity-common mutter-common nautilus-dropbox nautilus-share network-manager-gnome nvidia-common nvidia-settings nvidia-settings-updates onboard oneconf openjdk-7-jdk openjdk-7-jre openprinting-ppds pidgin pidgin-libnotify pidgin-otr printer-driver-foo2zjs printer-driver-ptouch printer-driver-pxljr printer-driver-sag-gdi printer-driver-splix python python-appindicator python-apport python-apt python-apt-common python-aptdaemon python-aptdaemon.gtk3widgets python-aptdaemon.pkcompat python-brlapi python-cairo python-central python-chardet python-configglue python-crypto python-cups python-cupshelpers python-dateutil python-dbus python-debian python-debtagshw python-defer python-dirspec python-egenix-mxdatetime python-egenix-mxtools python-gconf python-gdbm python-gi python-gi-cairo python-glade2:i386 python-gmenu python-gnomekeyring python-gnupginterface python-gobject python-gobject-2 python-gpgme python-gst0.10 python-gtk2 python-httplib2 python-ibus python-imaging python-keyring python-launchpadlib python-lazr.restfulclient python-lazr.uri python-libproxy python-libxml2 python-louis python-mako python-markupsafe python-minimal python-notify python-numeric:i386 python-oauth python-openssl python-packagekit python-pam python-pexpect python-piston-mini-client python-pkg-resources python-problem-report python-protobuf python-pyatspi2 python-pycurl python-pyinotify python-renderpm python-reportlab python-reportlab-accel python-serial python-simplejson python-smbc python-software-properties python-speechd python-twisted-bin python-twisted-core python-twisted-names python-twisted-web python-ubuntu-sso-client python-ubuntuone-client python-ubuntuone-control-panel python-ubuntuone-storageprotocol python-uno python-virtkey python-wadllib python-xapian python-xdg python-xkit python-zeitgeist python-zope.interface python2.7 python2.7-minimal rhythmbox rhythmbox-mozilla rhythmbox-plugin-cdrecorder rhythmbox-plugin-magnatune rhythmbox-plugin-zeitgeist rhythmbox-plugins rhythmbox-ubuntuone screen-resolution-extra sessioninstaller skype software-center software-center-aptdaemon-plugins software-properties-common software-properties-gtk system-config-printer-common system-config-printer-gnome system-config-printer-udev texlive-extra-utils totem totem-mozilla totem-plugins ubuntu-artwork ubuntu-desktop ubuntu-minimal ubuntu-sso-client ubuntu-sso-client-gtk ubuntu-standard ubuntu-system-service ubuntuone-client ubuntuone-client-gnome ubuntuone-control-panel ubuntuone-couch ubuntuone-installer ufw unattended-upgrades unity unity-2d unity-common unity-lens-applications unity-lens-video unity-scope-musicstores unity-scope-video-remote update-manager update-manager-core update-notifier update-notifier-common usb-creator-common usb-creator-gtk virtualbox virtualbox-dkms virtualbox-qt xdiagnose xul-ext-ubufox zeitgeist zeitgeist-core zeitgeist-datahub The following NEW packages will be installed: default-jre default-jre-headless icedtea-6-jre-cacao icedtea-6-jre-jamvm icedtea-netx icedtea-netx-common libglade2-0:i386 libpython3.2 openjdk-6-jre openjdk-6-jre-headless openjdk-6-jre-lib python3 python3-minimal python3-uno python3.2 python3.2-minimal WARNING: The following essential packages will be removed. This should NOT be done unless you know exactly what you are doing! python-minimal python2.7-minimal (due to python-minimal) 0 upgraded, 16 newly installed, 273 to remove and 0 not upgraded. 2 not fully installed or removed. Need to get 39.1 MB of archives. After this operation, 324 MB disk space will be freed. You are about to do something potentially harmful. To continue type in the phrase 'Yes, do as I say!' ?] Thats not good, is it?! Should i run this command or should i run another command to fix this problem? Would be great if somebody can help me. :) Thanks in advance. best regards

    Read the article

  • Multi-tenant ASP.NET MVC – Introduction

    - by zowens
    I’ve read a few different blogs that talk about multi-tenancy and how to resolve some of the issues surrounding multi-tenancy. What I’ve come to realize is that these implementations overcomplicate the issues and give only a muddy implementation! I’ve seen some really illogical code out there. I have recently been building a multi-tenancy framework for internal use at eagleenvision.net. Through this process, I’ve realized a few different techniques to make building multi-tenant applications actually quite easy. I will be posting a few different entries over the issue and my personal implementation. In this first post, I will discuss what multi-tenancy means and how my implementation will be structured.   So what’s the problem? Here’s the deal. Multi-tenancy is basically a technique of code-reuse of web application code. A multi-tenant application is an application that runs a single instance for multiple clients. Here the “client” is different URL bindings on IIS using ASP.NET MVC. The problem with different instances of the, essentially, same application is that you have to spin up different instances of ASP.NET. As the number of running instances of ASP.NET grows, so does the memory footprint of IIS. Stack Exchange shifted its architecture to multi-tenancy March. As the blog post explains, multi-tenancy saves cost in terms of memory utilization and physical disc storage. If you use the same code base for many applications, multi-tenancy just makes sense. You’ll reduce the amount of work it takes to synchronize the site implementations and you’ll thank your lucky stars later for choosing to use one application for multiple sites. Multi-tenancy allows the freedom of extensibility while relying on some pre-built code.   You’d think this would be simple. I have actually seen a real lack of reference material on the subject in terms of ASP.NET MVC. This is somewhat surprising given the number of users of ASP.NET MVC. However, I will certainly fill the void ;). Implementing a multi-tenant application takes a little thinking. It’s not straight-forward because the possibilities of implementation are endless. I have yet to see a great implementation of a multi-tenant MVC application. The only one that comes close to what I have in mind is Rob Ashton’s implementation (all the entries are listed on this page). There’s some really nasty code in there… something I’d really like to avoid. He has also written a library (MvcEx) that attempts to aid multi-tenant development. This code is even worse, in my honest opinion. Once I start seeing Reflection.Emit, I have to assume the worst :) In all seriousness, if his implementation makes sense to you, use it! It’s a fine implementation that should be given a look. At least look at the code. I will reference MvcEx going forward as a comparison to my implementation. I will explain why my approach differs from MvcEx and how it is better or worse (hopefully better).   Core Goals of my Multi-Tenant Implementation The first, and foremost, goal is to use Inversion of Control containers to my advantage. As you will see throughout this series, I pass around containers quite frequently and rely on their use heavily. I will be using StructureMap in my implementation. However, you could probably use your favorite IoC tool instead. <RANT> However, please don’t be stupid and abstract your IoC tool. Each IoC is powerful and by abstracting the capabilities, you’re doing yourself a real disservice. Who in the world swaps out IoC tools…? No one!</RANT> (It had to be said.) I will outline some of the goodness of StructureMap as we go along. This is really an invaluable tool in my tool belt and simple to use in my multi-tenant implementation. The second core goal is to represent a tenant as easily as possible. Just as a dependency container will be a first-class citizen, so will a tenant. This allows us to easily extend and use tenants. This will also allow different ways of “plugging in” tenants into your application. In my implementation, there will be a single dependency container for a single tenant. This will enable isolation of the dependencies of the tenant. The third goal is to use composition as a means to delegate “core” functions out to the tenant. More on this later.   Features In MvcExt, “Modules” are a code element of the infrastructure. I have simplified this concept and have named this “Features”. A feature is a simple element of an application. Controllers can be specified to have a feature and actions can have “sub features”. Each tenant can select features it needs and the other features will be hidden to the tenant’s users. My implementation doesn’t require something to be a feature. A controller can be common to all tenants. For example, (as you will see) I have a “Content” controller that will return the CSS, Javascript and Images for a tenant. This is common logic to all tenants and shouldn’t be hidden or considered a “feature”; Content is a core component.   Up next My next post will be all about the code. I will reveal some of the foundation to the way I do multi-tenancy. I will have posts dedicated to Foundation, Controllers, Views, Caching, Content and how to setup the tenants. Each post will be in-depth about the issues and implementation details, while adhering to my core goals outlined in this post. As always, comment with questions of DM me on twitter or send me an email.

    Read the article

  • Error on 64 Bit Install of IIS &ndash; LoadLibraryEx failed on aspnet_filter.dll

    - by Rick Strahl
    I’ve been having a few problems with my Windows 7 install and trying to get IIS applications to run properly in 64 bit. After installing IIS and creating virtual directories for several of my applications and firing them up I was left with the following error message from IIS: Calling LoadLibraryEx on ISAPI filter “c:\windows\Microsoft.NET\Framework\v4.0.30319\aspnet_filter.dll” failed This is on Windows 7 64 bit and running on an ASP.NET 4.0 Application configured for running 64 bit (32 bit disabled). It’s also on what is essentially a brand new installation of IIS and Windows 7. So it failed right out of the box. The problem here is that IIS is trying to loading this ISAPI filter from the 32 bit folder – it should be loading from Framework64 folder note the Framework folder. The aspnet_filter.dll component is a small Win32 ISAPI filter used to back up the cookieless session state for ASP.NET on IIS 7 applications. It’s not terribly important because of this focus, but it’s a default loaded component. After a lot of fiddling I ended up with two solutions (with the help and support of some Twitter folks): Switch IIS to run in 32 bit mode Fix the filter listing in ApplicationHost.config Switching IIS to allow 32 Bit Code This is a quick fix for the problem above which enables 32 bit code in the Application Pool. The problem above is that IIS is trying to load a 32 bit ISAPI filter and enabling 32 bit code gets you around this problem. To configure your Application Pool, open the Application Pool in IIS Manager bring up Advanced Options and Enable 32 Bit Applications: And voila the error message above goes away. Fix Filters Enabling 32 bit code is a quick fix solution to this problem, but not an ideal one. If you’re running a pure .NET application that doesn’t need to do COM or pInvoke Interop with 32 bit apps there’s usually no need for enabling 32 bit code in an Application Pool as you can run in native 64 bit code. So trying to get 64 bit working natively is a pretty key feature in my opinion :-) So what’s the problem – why is IIS trying to load a 32 bit DLL in a 64 bit install, especially if the application pool is configured to not allow 32 bit code at all? The problem lies in the server configuration and the fact that 32 bit and 64 bit configuration settings exist side by side in IIS. If I open my Default Web Site (or any other root Web Site) and go to the ISAPI filter list here’s what I see: Notice that there are 3 entries for ASP.NET 4.0 in this list. Only two of them however are specifically scoped to the specifically to 32 bit or 64 bit. As you can see the 64 bit filter correctly points at the Framework64 folder to load the dll, while both the 32 bit and the ‘generic’ entry point at the plain Framework 32 bit folder. Aha! Hence lies our problem. You can edit ApplicationHost.config manually, but I ran into the nasty issue of not being able to easily edit that file with the 32 bit editor (who ever thought that was a good idea???? WTF). You have to open ApplicationHost.Config in a 64 bit native text editor – which Visual Studio is not. Or my favorite editor: EditPad Pro. Since I don’t have a native 64 bit editor handy Notepad was my only choice. Or as an alternative you can use the IIS 7.5 Configuration Editor which lets you interactively browse and edit most ApplicationHost settings. You can drill into the configuration hierarchy visually to find your keys and edit attributes and sub values in property editor type interface. I had no idea this tool existed prior to today and it’s pretty cool as it gives you some visual clues to options available – especially in absence of an Intellisense scheme you’d get in Visual Studio (which doesn’t work). To use the Configuration Editor go the Web Site root and use the Configuration Editor option in the Management Group. Drill into System.webServer/isapiFilters and then click on the Collection’s … button on the right. You should now see a display like this: which shows all the same attributes you’d see in ApplicationHost.config (cool!). These entries correspond to these raw ApplicationHost.config entries: <filter name="ASP.Net_4.0" path="C:\Windows\Microsoft.NET\Framework\v4.0.30319\aspnet_filter.dll" enableCache="true" preCondition="runtimeVersionv4.0" /> <filter name="ASP.Net_4.0_64bit" path="C:\Windows\Microsoft.NET\Framework64\v4.0.30319\aspnet_filter.dll" enableCache="true" preCondition="runtimeVersionv4.0,bitness64" /> <filter name="ASP.Net_4.0_32bit" path="C:\Windows\Microsoft.NET\Framework\v4.0.30319\aspnet_filter.dll" enableCache="true" preCondition="runtimeVersionv4.0,bitness32" /> The key attribute we’re concerned with here is the preCondition and the bitness subvalue. Notice that the ‘generic’ version – which comes first in the filter list – has no bitness assigned to it, so it defaults to 32 bit and the 32 bit dll path. And this is where our problem comes from. The simple solution to fix the startup problem is to remove the generic entry from this list here or in the filters list shown earlier and leave only the bitness specific versions active. The preCondition attribute acts as a filter and as you can see here it filters the list by runtime version and bitness value. This is something to keep an eye out in general – if a bitness values are missing it’s easy to run into conflicts like this with any settings that are global and especially those that load modules and handlers and other executable code. On 64 bit systems it’s a good idea to explicitly set the bitness of all entries or remove the non-specific versions and add bit specific entries. So how did this get misconfigured? I installed IIS before everything else was installed on this machine and then went ahead and installed Visual Studio. I suspect the Visual Studio install munged this up as I never saw a similar problem on my live server where everything just worked right out of the box. In searching about this problem a lot of solutions pointed at using aspnet_regiis –r from the Framework64 directory, but that did not fix this extra entry in the filters list – it adds the required 32 bit and 64 bit entries, but it doesn’t remove the errand un-bitness set entry. Hopefully this post will help out anybody who runs into a similar situation without having to trouble shoot all the way down into the configuration settings and noticing the bitness settings. It’s a good lesson learned for me – this is my first desktop install of a 64 bit OS and things like this are what I was reluctant to find. Now that I ran into this I have a good idea what to look for with 32/64 bit misconfigurations in IIS at least.© Rick Strahl, West Wind Technologies, 2005-2011Posted in IIS7   ASP.NET  

    Read the article

  • Announcing release of ASP.NET MVC 3, IIS Express, SQL CE 4, Web Farm Framework, Orchard, WebMatrix

    - by ScottGu
    I’m excited to announce the release today of several products: ASP.NET MVC 3 NuGet IIS Express 7.5 SQL Server Compact Edition 4 Web Deploy and Web Farm Framework 2.0 Orchard 1.0 WebMatrix 1.0 The above products are all free. They build upon the .NET 4 and VS 2010 release, and add a ton of additional value to ASP.NET (both Web Forms and MVC) and the Microsoft Web Server stack. ASP.NET MVC 3 Today we are shipping the final release of ASP.NET MVC 3.  You can download and install ASP.NET MVC 3 here.  The ASP.NET MVC 3 source code (released under an OSI-compliant open source license) can also optionally be downloaded here. ASP.NET MVC 3 is a significant update that brings with it a bunch of great features.  Some of the improvements include: Razor ASP.NET MVC 3 ships with a new view-engine option called “Razor” (in addition to continuing to support/enhance the existing .aspx view engine).  Razor minimizes the number of characters and keystrokes required when writing a view template, and enables a fast, fluid coding workflow. Unlike most template syntaxes, with Razor you do not need to interrupt your coding to explicitly denote the start and end of server blocks within your HTML. The Razor parser is smart enough to infer this from your code. This enables a compact and expressive syntax which is clean, fast and fun to type.  You can learn more about Razor from some of the blog posts I’ve done about it over the last 6 months Introducing Razor New @model keyword in Razor Layouts with Razor Server-Side Comments with Razor Razor’s @: and <text> syntax Implicit and Explicit code nuggets with Razor Layouts and Sections with Razor Today’s release supports full code intellisense support for Razor (both VB and C#) with Visual Studio 2010 and the free Visual Web Developer 2010 Express. JavaScript Improvements ASP.NET MVC 3 enables richer JavaScript scenarios and takes advantage of emerging HTML5 capabilities. The AJAX and Validation helpers in ASP.NET MVC 3 now use an Unobtrusive JavaScript based approach.  Unobtrusive JavaScript avoids injecting inline JavaScript into HTML, and enables cleaner separation of behavior using the new HTML 5 “data-“ attribute convention (which conveniently works on older browsers as well – including IE6). This keeps your HTML tight and clean, and makes it easier to optionally swap out or customize JS libraries.  ASP.NET MVC 3 now includes built-in support for posting JSON-based parameters from client-side JavaScript to action methods on the server.  This makes it easier to exchange data across the client and server, and build rich JavaScript front-ends.  We think this capability will be particularly useful going forward with scenarios involving client templates and data binding (including the jQuery plugins the ASP.NET team recently contributed to the jQuery project).  Previous releases of ASP.NET MVC included the core jQuery library.  ASP.NET MVC 3 also now ships the jQuery Validate plugin (which our validation helpers use for client-side validation scenarios).  We are also now shipping and including jQuery UI by default as well (which provides a rich set of client-side JavaScript UI widgets for you to use within projects). Improved Validation ASP.NET MVC 3 includes a bunch of validation enhancements that make it even easier to work with data. Client-side validation is now enabled by default with ASP.NET MVC 3 (using an onbtrusive javascript implementation).  Today’s release also includes built-in support for Remote Validation - which enables you to annotate a model class with a validation attribute that causes ASP.NET MVC to perform a remote validation call to a server method when validating input on the client. The validation features introduced within .NET 4’s System.ComponentModel.DataAnnotations namespace are now supported by ASP.NET MVC 3.  This includes support for the new IValidatableObject interface – which enables you to perform model-level validation, and allows you to provide validation error messages specific to the state of the overall model, or between two properties within the model.  ASP.NET MVC 3 also supports the improvements made to the ValidationAttribute class in .NET 4.  ValidationAttribute now supports a new IsValid overload that provides more information about the current validation context, such as what object is being validated.  This enables richer scenarios where you can validate the current value based on another property of the model.  We’ve shipped a built-in [Compare] validation attribute  with ASP.NET MVC 3 that uses this support and makes it easy out of the box to compare and validate two property values. You can use any data access API or technology with ASP.NET MVC.  This past year, though, we’ve worked closely with the .NET data team to ensure that the new EF Code First library works really well for ASP.NET MVC applications.  These two posts of mine cover the latest EF Code First preview and demonstrates how to use it with ASP.NET MVC 3 to enable easy editing of data (with end to end client+server validation support).  The final release of EF Code First will ship in the next few weeks. Today we are also publishing the first preview of a new MvcScaffolding project.  It enables you to easily scaffold ASP.NET MVC 3 Controllers and Views, and works great with EF Code-First (and is pluggable to support other data providers).  You can learn more about it – and install it via NuGet today - from Steve Sanderson’s MvcScaffolding blog post. Output Caching Previous releases of ASP.NET MVC supported output caching content at a URL or action-method level. With ASP.NET MVC V3 we are also enabling support for partial page output caching – which allows you to easily output cache regions or fragments of a response as opposed to the entire thing.  This ends up being super useful in a lot of scenarios, and enables you to dramatically reduce the work your application does on the server.  The new partial page output caching support in ASP.NET MVC 3 enables you to easily re-use cached sub-regions/fragments of a page across multiple URLs on a site.  It supports the ability to cache the content either on the web-server, or optionally cache it within a distributed cache server like Windows Server AppFabric or memcached. I’ll post some tutorials on my blog that show how to take advantage of ASP.NET MVC 3’s new output caching support for partial page scenarios in the future. Better Dependency Injection ASP.NET MVC 3 provides better support for applying Dependency Injection (DI) and integrating with Dependency Injection/IOC containers. With ASP.NET MVC 3 you no longer need to author custom ControllerFactory classes in order to enable DI with Controllers.  You can instead just register a Dependency Injection framework with ASP.NET MVC 3 and it will resolve dependencies not only for Controllers, but also for Views, Action Filters, Model Binders, Value Providers, Validation Providers, and Model Metadata Providers that you use within your application. This makes it much easier to cleanly integrate dependency injection within your projects. Other Goodies ASP.NET MVC 3 includes dozens of other nice improvements that help to both reduce the amount of code you write, and make the code you do write cleaner.  Here are just a few examples: Improved New Project dialog that makes it easy to start new ASP.NET MVC 3 projects from templates. Improved Add->View Scaffolding support that enables the generation of even cleaner view templates. New ViewBag property that uses .NET 4’s dynamic support to make it easy to pass late-bound data from Controllers to Views. Global Filters support that allows specifying cross-cutting filter attributes (like [HandleError]) across all Controllers within an app. New [AllowHtml] attribute that allows for more granular request validation when binding form posted data to models. Sessionless controller support that allows fine grained control over whether SessionState is enabled on a Controller. New ActionResult types like HttpNotFoundResult and RedirectPermanent for common HTTP scenarios. New Html.Raw() helper to indicate that output should not be HTML encoded. New Crypto helpers for salting and hashing passwords. And much, much more… Learn More about ASP.NET MVC 3 We will be posting lots of tutorials and samples on the http://asp.net/mvc site in the weeks ahead.  Below are two good ASP.NET MVC 3 tutorials available on the site today: Build your First ASP.NET MVC 3 Application: VB and C# Building the ASP.NET MVC 3 Music Store We’ll post additional ASP.NET MVC 3 tutorials and videos on the http://asp.net/mvc site in the future. Visit it regularly to find new tutorials as they are published. How to Upgrade Existing Projects ASP.NET MVC 3 is compatible with ASP.NET MVC 2 – which means it should be easy to update existing MVC projects to ASP.NET MVC 3.  The new features in ASP.NET MVC 3 build on top of the foundational work we’ve already done with the MVC 1 and MVC 2 releases – which means that the skills, knowledge, libraries, and books you’ve acquired are all directly applicable with the MVC 3 release.  MVC 3 adds new features and capabilities – it doesn’t obsolete existing ones. You can upgrade existing ASP.NET MVC 2 projects by following the manual upgrade steps in the release notes.  Alternatively, you can use this automated ASP.NET MVC 3 upgrade tool to easily update your  existing projects. Localized Builds Today’s ASP.NET MVC 3 release is available in English.  We will be releasing localized versions of ASP.NET MVC 3 (in 9 languages) in a few days.  I’ll blog pointers to the localized downloads once they are available. NuGet Today we are also shipping NuGet – a free, open source, package manager that makes it easy for you to find, install, and use open source libraries in your projects. It works with all .NET project types (including ASP.NET Web Forms, ASP.NET MVC, WPF, WinForms, Silverlight, and Class Libraries).  You can download and install it here. NuGet enables developers who maintain open source projects (for example, .NET projects like Moq, NHibernate, Ninject, StructureMap, NUnit, Windsor, Raven, Elmah, etc) to package up their libraries and register them with an online gallery/catalog that is searchable.  The client-side NuGet tools – which include full Visual Studio integration – make it trivial for any .NET developer who wants to use one of these libraries to easily find and install it within the project they are working on. NuGet handles dependency management between libraries (for example: library1 depends on library2). It also makes it easy to update (and optionally remove) libraries from your projects later. It supports updating web.config files (if a package needs configuration settings). It also allows packages to add PowerShell scripts to a project (for example: scaffold commands). Importantly, NuGet is transparent and clean – and does not install anything at the system level. Instead it is focused on making it easy to manage libraries you use with your projects. Our goal with NuGet is to make it as simple as possible to integrate open source libraries within .NET projects.  NuGet Gallery This week we also launched a beta version of the http://nuget.org web-site – which allows anyone to easily search and browse an online gallery of open source packages available via NuGet.  The site also now allows developers to optionally submit new packages that they wish to share with others.  You can learn more about how to create and share a package here. There are hundreds of open-source .NET projects already within the NuGet Gallery today.  We hope to have thousands there in the future. IIS Express 7.5 Today we are also shipping IIS Express 7.5.  IIS Express is a free version of IIS 7.5 that is optimized for developer scenarios.  It works for both ASP.NET Web Forms and ASP.NET MVC project types. We think IIS Express combines the ease of use of the ASP.NET Web Server (aka Cassini) currently built-into Visual Studio today with the full power of IIS.  Specifically: It’s lightweight and easy to install (less than 5Mb download and a quick install) It does not require an administrator account to run/debug applications from Visual Studio It enables a full web-server feature set – including SSL, URL Rewrite, and other IIS 7.x modules It supports and enables the same extensibility model and web.config file settings that IIS 7.x support It can be installed side-by-side with the full IIS web server as well as the ASP.NET Development Server (they do not conflict at all) It works on Windows XP and higher operating systems – giving you a full IIS 7.x developer feature-set on all Windows OS platforms IIS Express (like the ASP.NET Development Server) can be quickly launched to run a site from a directory on disk.  It does not require any registration/configuration steps. This makes it really easy to launch and run for development scenarios.  You can also optionally redistribute IIS Express with your own applications if you want a lightweight web-server.  The standard IIS Express EULA now includes redistributable rights. Visual Studio 2010 SP1 adds support for IIS Express.  Read my VS 2010 SP1 and IIS Express blog post to learn more about what it enables.  SQL Server Compact Edition 4 Today we are also shipping SQL Server Compact Edition 4 (aka SQL CE 4).  SQL CE is a free, embedded, database engine that enables easy database storage. No Database Installation Required SQL CE does not require you to run a setup or install a database server in order to use it.  You can simply copy the SQL CE binaries into the \bin directory of your ASP.NET application, and then your web application can use it as a database engine.  No setup or extra security permissions are required for it to run. You do not need to have an administrator account on the machine. Just copy your web application onto any server and it will work. This is true even of medium-trust applications running in a web hosting environment. SQL CE runs in-memory within your ASP.NET application and will start-up when you first access a SQL CE database, and will automatically shutdown when your application is unloaded.  SQL CE databases are stored as files that live within the \App_Data folder of your ASP.NET Applications. Works with Existing Data APIs SQL CE 4 works with existing .NET-based data APIs, and supports a SQL Server compatible query syntax.  This means you can use existing data APIs like ADO.NET, as well as use higher-level ORMs like Entity Framework and NHibernate with SQL CE.  This enables you to use the same data programming skills and data APIs you know today. Supports Development, Testing and Production Scenarios SQL CE can be used for development scenarios, testing scenarios, and light production usage scenarios.  With the SQL CE 4 release we’ve done the engineering work to ensure that SQL CE won’t crash or deadlock when used in a multi-threaded server scenario (like ASP.NET).  This is a big change from previous releases of SQL CE – which were designed for client-only scenarios and which explicitly blocked running in web-server environments.  Starting with SQL CE 4 you can use it in a web-server as well. There are no license restrictions with SQL CE.  It is also totally free. Tooling Support with VS 2010 SP1 Visual Studio 2010 SP1 adds support for SQL CE 4 and ASP.NET Projects.  Read my VS 2010 SP1 and SQL CE 4 blog post to learn more about what it enables.  Web Deploy and Web Farm Framework 2.0 Today we are also releasing Microsoft Web Deploy V2 and Microsoft Web Farm Framework V2.  These services provide a flexible and powerful way to deploy ASP.NET applications onto either a single server, or across a web farm of machines. You can learn more about these capabilities from my previous blog posts on them: Introducing the Microsoft Web Farm Framework Automating Deployment with Microsoft Web Deploy Visit the http://iis.net website to learn more and install them. Both are free. Orchard 1.0 Today we are also releasing Orchard v1.0.  Orchard is a free, open source, community based project.  It provides Content Management System (CMS) and Blogging System support out of the box, and makes it possible to easily create and manage web-sites without having to write code (site owners can customize a site through the browser-based editing tools built-into Orchard).  Read these tutorials to learn more about how you can setup and manage your own Orchard site. Orchard itself is built as an ASP.NET MVC 3 application using Razor view templates (and by default uses SQL CE 4 for data storage).  Developers wishing to extend an Orchard site with custom functionality can open and edit it as a Visual Studio project – and add new ASP.NET MVC Controllers/Views to it.  WebMatrix 1.0 WebMatrix is a new, free, web development tool from Microsoft that provides a suite of technologies that make it easier to enable website development.  It enables a developer to start a new site by browsing and downloading an app template from an online gallery of web applications (which includes popular apps like Umbraco, DotNetNuke, Orchard, WordPress, Drupal and Joomla).  Alternatively it also enables developers to create and code web sites from scratch. WebMatrix is task focused and helps guide developers as they work on sites.  WebMatrix includes IIS Express, SQL CE 4, and ASP.NET - providing an integrated web-server, database and programming framework combination.  It also includes built-in web publishing support which makes it easy to find and deploy sites to web hosting providers. You can learn more about WebMatrix from my Introducing WebMatrix blog post this summer.  Visit http://microsoft.com/web to download and install it today. Summary I’m really excited about today’s releases – they provide a bunch of additional value that makes web development with ASP.NET, Visual Studio and the Microsoft Web Server a lot better.  A lot of folks worked hard to share this with you today. On behalf of my whole team – we hope you enjoy them! Scott P.S. In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu

    Read the article

< Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >