Search Results

Search found 15408 results on 617 pages for 'import module'.

Page 205/617 | < Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >

  • Using Kal calendar without doing the initialization (and so on) in the AppDelegate

    - by testing
    I'm using the Kal calendar. For the code shown below I'm referring to the Holiday example. In this example the allocation and initialization of Kal is done in the applicationDidFinishLaunching in the AppDelegate. The UITableViewDelegate protocol (e.g. didSelectRowAtIndexPath) is also positioned in the AppDelegate class. The AppDelegate: #import "HolidayAppDelegate.h" #import "HolidaySqliteDataSource.h" #import "HolidaysDetailViewController.h" ## Heading ###import "Kal.h" @implementation HolidayAppDelegate @synthesize window; - (void)applicationDidFinishLaunching:(UIApplication *)application { kal = [[KalViewController alloc] init]; kal.navigationItem.rightBarButtonItem = [[[UIBarButtonItem alloc] initWithTitle:@"Today" style:UIBarButtonItemStyleBordered target:self action:@selector(showAndSelectToday)] autorelease]; kal.delegate = self; dataSource = [[HolidaySqliteDataSource alloc] init]; kal.dataSource = dataSource; // Setup the navigation stack and display it. navController = [[UINavigationController alloc] initWithRootViewController:kal]; [window addSubview:navController.view]; [window makeKeyAndVisible]; } // Action handler for the navigation bar's right bar button item. - (void)showAndSelectToday { [kal showAndSelectDate:[NSDate date]]; } #pragma mark UITableViewDelegate protocol conformance // Display a details screen for the selected holiday/row. - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { Holiday *holiday = [dataSource holidayAtIndexPath:indexPath]; HolidaysDetailViewController *vc = [[[HolidaysDetailViewController alloc] initWithHoliday:holiday] autorelease]; [navController pushViewController:vc animated:YES]; } #pragma mark - - (void)dealloc { [kal release]; [dataSource release]; [window release]; [navController release]; [super dealloc]; } @end I don't want to put this into the AppDelegate, because there could be some overlapping code with other views. It should be a separate "component" which I can call and put on the stack. In my navigation based project I have a main view, the RootViewController. From there I want to push the Kal view on the stack. Currently I'm pushing an additional ViewController on the stack. In the viewWillAppear method from this ViewController I do the things shown in the code above. The following problems appear: Navigation back has to be done two times (one for the Kal calendar, one for my created view) Navigation to my main view is not possible anymore In the moment I don't know where to put this code. So the question is where to put the methods for allocation/initialization as well as the methods for the UITableViewDelegate protocol.

    Read the article

  • How to add django modules to pydiction dictionary?

    - by speck
    I'm trying to use pydiction to autocomplete Python/Django statements in VIM Editor. When I try to add django modules to complete-dic using this: python pydiction.py /usr/lib/pymodules/python2.6/django or: python pydiction.py /usr/lib/pymodules/python2.6/django/__init__.py I receive this error: Couldn't import: (...). Import by filename is not supported. Thanks! Pydiction: http://www.vim.org/scripts/script.php?script_id=850

    Read the article

  • Warning: newtype `CInt' is used in an FFI declaration,

    - by vivian
    When building gtk2hs-buildtools with ghc 7.4.2, I get the following warning: c2hs/toplevel/C2HSConfig.hs:110:1: Warning: newtype `CInt' is used in an FFI declaration, but its constructor is not in scope. This will become an error in GHC 7.6.1. When checking declaration: foreign import ccall safe "static bitfield_direction" bitfield_direction :: CInt I get similar warnings with FFI calls, even though I have import Foreign.C.Types(CInt). What is the correct way of getting rid of this warning?

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • How to check for local Wi-Fi (not just cellular connection) using iPhone SDK?

    - by Michael
    I'm currently using the following to check whether Wi-Fi is available for my application: #import <SystemConfiguration/SystemConfiguration.h> static inline BOOL addressReachable(const struct sockaddr_in *hostAddress); BOOL localWiFiAvailable() { struct sockaddr_in localWifiAddress; bzero(&localWifiAddress, sizeof(localWifiAddress)); localWifiAddress.sin_len = sizeof(localWifiAddress); localWifiAddress.sin_family = AF_INET; // IN_LINKLOCALNETNUM is defined in <netinet/in.h> as 169.254.0.0 localWifiAddress.sin_addr.s_addr = htonl(IN_LINKLOCALNETNUM); return addressReachable(&localWifiAddress); } static inline BOOL addressReachable(const struct sockaddr_in *hostAddress) { const SCNetworkReachabilityRef target = SCNetworkReachabilityCreateWithAddress(kCFAllocatorDefault, (const struct sockaddr *)hostAddress); if (target != NULL) { SCNetworkReachabilityFlags flags = 0; const BOOL reachable = SCNetworkReachabilityGetFlags(target, &flags); CFRelease(target); return reachable && (flags & kSCNetworkFlagsReachable); } return NO; } This, however, does not return NO as it should when the iPhone is connected only to a cellular network but not a Wi-Fi network. Does anyone know how to fix this? Edit So this is what I ended up using: #import <arpa/inet.h> // For AF_INET, etc. #import <ifaddrs.h> // For getifaddrs() #import <net/if.h> // For IFF_LOOPBACK BOOL localWiFiAvailable() { struct ifaddrs *addresses; struct ifaddrs *cursor; BOOL wiFiAvailable = NO; if (getifaddrs(&addresses) != 0) return NO; cursor = addresses; while (cursor != NULL) { if (cursor -> ifa_addr -> sa_family == AF_INET && !(cursor -> ifa_flags & IFF_LOOPBACK)) // Ignore the loopback address { // Check for WiFi adapter if (strcmp(cursor -> ifa_name, "en0") == 0) { wiFiAvailable = YES; break; } } cursor = cursor -> ifa_next; } freeifaddrs(addresses); return wiFiAvailable; } Thanks "unforgiven" (and Matt Brown apparently).

    Read the article

  • XML - python prints extra lines

    - by horse
    `from xml import xpath from xml.dom import minidom xmldata = minidom.parse('model.xml').documentElement for maks in xpath.Evaluate('/cacti/results/maks/text()', xmldata): print maks.nodeValue ` and I get result: 85603399.14 398673062.66 95785523.81 But I needed to be: 85603399.14 NO SPACE 398673062.66 NO SPACE 95785523.81 Can somebody help me, i new at programing :( ?

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • Probelm with String.split() in java

    - by Matt
    What I am trying to do is read a .java file, and pick out all of the identifiers and store them in a list. My problem is with the .split() method. If you run this code the way it is, you will get ArrayOutOfBounds, but if you change the delimiter from "." to anything else, the code works. But I need to lines parsed by "." so is there another way I could accomplish this? import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; import java.util.*; public class MyHash { private static String[] reserved = new String[100]; private static List list = new LinkedList(); private static List list2 = new LinkedList(); public static void main (String args[]){ Hashtable hashtable = new Hashtable(997); makeReserved(); readFile(); String line; ListIterator itr = list.listIterator(); int listIndex = 0; while (listIndex < list.size()) { if (itr.hasNext()){ line = itr.next().toString(); //PROBLEM IS HERE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! String[] words = line.split("."); //CHANGE THIS AND IT WILL WORK System.out.println(words[0]); //TESTING TO SEE IF IT WORKED } listIndex++; } } public static void readFile() { String text; String[] words; BufferedReader in = null; try { in = new BufferedReader(new FileReader("MyHash.java")); //NAME OF INPUT FILE } catch (FileNotFoundException ex) { Logger.getLogger(MyHash.class.getName()).log(Level.SEVERE, null, ex); } try { while ((text = in.readLine()) != null){ text = text.trim(); words = text.split("\\s+"); for (int i = 0; i < words.length; i++){ list.add(words[i]); } for (int j = 0; j < reserved.length; j++){ if (list.contains(reserved[j])){ list.remove(reserved[j]); } } } } catch (IOException ex) { Logger.getLogger(MyHash.class.getName()).log(Level.SEVERE, null, ex); } try { in.close(); } catch (IOException ex) { Logger.getLogger(MyHash.class.getName()).log(Level.SEVERE, null, ex); } } public static int keyIt (int x) { int key = x % 997; return key; } public static int horner (String word){ int length = word.length(); char[] letters = new char[length]; for (int i = 0; i < length; i++){ letters[i]=word.charAt(i); } char[] alphabet = new char[26]; String abc = "abcdefghijklmnopqrstuvwxyz"; for (int i = 0; i < 26; i++){ alphabet[i]=abc.charAt(i); } int[] numbers = new int[length]; int place = 0; for (int i = 0; i < length; i++){ for (int j = 0; j < 26; j++){ if (alphabet[j]==letters[i]){ numbers[place]=j+1; place++; } } } int hornered = numbers[0] * 32; for (int i = 1; i < numbers.length; i++){ hornered += numbers[i]; if (i == numbers.length -1){ return hornered; } hornered = hornered % 997; hornered *= 32; } return hornered; } public static String[] makeReserved (){ reserved[0] = "abstract"; reserved[1] = "assert"; reserved[2] = "boolean"; reserved[3] = "break"; reserved[4] = "byte"; reserved[5] = "case"; reserved[6] = "catch"; reserved[7] = "char"; reserved[8] = "class"; reserved[9] = "const"; reserved[10] = "continue"; reserved[11] = "default"; reserved[12] = "do"; reserved[13] = "double"; reserved[14] = "else"; reserved[15] = "enum"; reserved[16] = "extends"; reserved[17] = "false"; reserved[18] = "final"; reserved[19] = "finally"; reserved[20] = "float"; reserved[21] = "for"; reserved[22] = "goto"; reserved[23] = "if"; reserved[24] = "implements"; reserved[25] = "import"; reserved[26] = "instanceof"; reserved[27] = "int"; reserved[28] = "interface"; reserved[29] = "long"; reserved[30] = "native"; reserved[31] = "new"; reserved[32] = "null"; reserved[33] = "package"; reserved[34] = "private"; reserved[35] = "protected"; reserved[36] = "public"; reserved[37] = "return"; reserved[38] = "short"; reserved[39] = "static"; reserved[40] = "strictfp"; reserved[41] = "super"; reserved[42] = "switch"; reserved[43] = "synchronize"; reserved[44] = "this"; reserved[45] = "throw"; reserved[46] = "throws"; reserved[47] = "trasient"; reserved[48] = "true"; reserved[49] = "try"; reserved[50] = "void"; reserved[51] = "volatile"; reserved[52] = "while"; reserved[53] = "="; reserved[54] = "=="; reserved[55] = "!="; reserved[56] = "+"; reserved[57] = "-"; reserved[58] = "*"; reserved[59] = "/"; reserved[60] = "{"; reserved[61] = "}"; return reserved; } }

    Read the article

  • pg.so problem with Ruby in Windows

    - by Alexander
    I have installed the pg module with help of gem install pg Which returned Successfully installed pg-0.8.0-x86-mswin32-60 When a .rb-file looks like this require 'rubygems' require 'pg' I get an LoadError (exception 126) which tells me that it can't find the module C:/Ruby/lib/ruby/gems/1.8/gems/pg-0.8.0-x86-mswin32-60/lib/pg.so. I heard something about that it is a Linux compilation. I'm really stuck so I really welcome suggestions. I have also installed PostgreSQL, I use Windows XP.

    Read the article

  • Is there any way to add a MouseListener to a Graphic object ?

    - by Fahad
    Hi, Is there any way to add a MouseListener to a Graphic object. I have this simple GUI that draw an oval. What I want is handling the event when the user clicks on the oval import java.awt.*; import java.awt.event.MouseEvent; import java.awt.event.MouseListener; import javax.swing.*; public class Gui2 extends JFrame { JFrame frame = new JFrame(); MyDrawPanel drawpanel = new MyDrawPanel(); public static void main(String[] args) { Gui2 gui = new Gui2(); gui.go(); } public void go() { frame.getContentPane().add(drawpanel); // frame.addMouseListener(this); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setSize(300, 300); frame.setVisible(true); } } class MyDrawPanel extends JComponent implements MouseListener { public void paintComponent(Graphics g) { int red = (int) (Math.random() * 255); int green = (int) (Math.random() * 255); int blue = (int) (Math.random() * 255); Color startrandomColor = new Color(red, green, blue); red = (int) (Math.random() * 255); green = (int) (Math.random() * 255); blue = (int) (Math.random() * 255); Color endrandomColor = new Color(red, green, blue); Graphics2D g2d = (Graphics2D) g; this.addMouseListener(this); GradientPaint gradient = new GradientPaint(70, 70, startrandomColor, 150, 150, endrandomColor); g2d.setPaint(gradient); g2d.fillOval(70, 70, 100, 100); } @Override public void mouseClicked(MouseEvent e) { if ((e.getButton() == 1) && (e.getX() >= 70 && e.getX() <= 170 && e.getY() >= 70 && e .getY() <= 170)) { this.repaint(); // JOptionPane.showMessageDialog(null,e.getX()+ "\n" + e.getY()); } } @Override public void mouseEntered(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mouseExited(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mousePressed(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mouseReleased(MouseEvent e) { // TODO Auto-generated method stub } } This Works Except it fires when the click is within a virtual box around the oval. Could anyone help me to have it fire when the click is EXACTLY on the oval. Thanks in advance.

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Basic Google search using a shell script

    - by Lri
    Something like this but using just basic shell scripting: #!/usr/bin/env python import urllib import json base = 'http://ajax.googleapis.com/ajax/services/search/web?v=1.0&' query = urllib.urlencode({'q' : "something"}) response = urllib.urlopen(base + query).read() data = json.loads(response) print data['responseData']['results'][0]['url'] Any more convenient alternatives to ajax.googleapis.com? If not, how should you encode the URL and parse JSON?

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Why do all procedures have to be defined before the compiler sees them?

    - by incrediman
    For example, take a look at this code (from tspl4): (define proc1 (lambda (x y) (proc2 y x))) If I run this as my program in scheme... #!r6rs (import (rnrs)) (define proc1 (lambda (x y) (proc2 y x))) I get this error: expand: unbound identifier in module in: proc2 ...This code works fine though: #!r6rs (import (rnrs)) (define proc2 +) (define proc1 (lambda (x y) (proc2 y x))) (display (proc1 2 3)) ;output: 5

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JavaFX2: Drag Event start and end coordinates

    - by user
    I have one node(ImageView) that displays an image and another node(rectangle) that resides on top of it. The behavior I need is that when the mouse is dragged(press-drag-release gesture) over the rectangle, both the nodes should move coherently. My thought process goes in the following direction: • Move both the nodes by the same distance in the direction of the drag. For this option(maybe there are more options) I need the distance between the start and end of the mouse drags. I tried capturing the start and end coordinates of the drag but have been unsuccessful. I think I am getting lost in which handlers to implement. The code I have is below: import javafx.event.EventHandler; import javafx.geometry.Rectangle2D; import javafx.scene.image.ImageView; import javafx.scene.input.MouseEvent; public class MyView { double mouseDragStartX; double mouseDragEndX; double mouseDragStartY; double mouseDragEndY; ImageView imageView; public MyView() { imageView = new ImageView("C:\\temp\\test.png"); } private void setRectangleEvents(final MyObject myObject) { myObject.getRectangle().setOnMousePressed(new EventHandler<MouseEvent>() { @Override public void handle(MouseEvent mouseEvent) { mouseDragStartX = mouseEvent.getX(); mouseDragStartY = mouseEvent.getY(); mouseEvent.consume(); } }); myObject.getRectangle().setOnMouseReleased(new EventHandler<MouseEvent>() { public void handle(MouseEvent mouseEvent) { mouseDragEndX = mouseEvent.getX(); mouseDragEndY = mouseEvent.getY(); myObjectDraggedHandler(); } }); } private void myObjectDraggedHandler() { Rectangle2D viewport = this.imageView.getViewport(); double newX = this.imageView.getImage().getWidth() + (mouseDragEndX - mouseDragStartX); double newY = this.imageView.getImage().getHeight() + (mouseDragEndY - mouseDragStartY); this.imageView.setViewport(new Rectangle2D(newX, newY, viewport.getWidth(), viewport .getHeight())); } } P.S: This code is just for indicating what I am trying to implement and will not compile correctly. Or maybe my question should just have been: How to capture the length or span of a mouse drag?

    Read the article

  • How to use HTTP method DELETE on Google App Engine?

    - by Jader Dias
    I can use this verb in the Python Windows SDK. But not in production. Why? What am I doing wrong? The error message includes (only seen via firebug or fiddler) Malformed request or something like that My code looks like: from google.appengine.ext import db from google.appengine.ext import webapp class Handler(webapp.RequestHandler): def delete(self): key = self.request.get('key') item = db.get(key) item.delete() self.response.out.write(key)

    Read the article

  • differences between "d.clear()" and "d={}"

    - by Tshepang
    On my machine, the execution speed between "d.clear()" and "d={}" is over 100ns so am curious why one would use one over the other. import timeit def timing(): d = dict() if __name__=='__main__': t = timeit.Timer('timing()', 'from __main__ import timing') print t.repeat()

    Read the article

< Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >