Search Results

Search found 15408 results on 617 pages for 'import module'.

Page 205/617 | < Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • Probelm with String.split() in java

    - by Matt
    What I am trying to do is read a .java file, and pick out all of the identifiers and store them in a list. My problem is with the .split() method. If you run this code the way it is, you will get ArrayOutOfBounds, but if you change the delimiter from "." to anything else, the code works. But I need to lines parsed by "." so is there another way I could accomplish this? import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; import java.util.*; public class MyHash { private static String[] reserved = new String[100]; private static List list = new LinkedList(); private static List list2 = new LinkedList(); public static void main (String args[]){ Hashtable hashtable = new Hashtable(997); makeReserved(); readFile(); String line; ListIterator itr = list.listIterator(); int listIndex = 0; while (listIndex < list.size()) { if (itr.hasNext()){ line = itr.next().toString(); //PROBLEM IS HERE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! String[] words = line.split("."); //CHANGE THIS AND IT WILL WORK System.out.println(words[0]); //TESTING TO SEE IF IT WORKED } listIndex++; } } public static void readFile() { String text; String[] words; BufferedReader in = null; try { in = new BufferedReader(new FileReader("MyHash.java")); //NAME OF INPUT FILE } catch (FileNotFoundException ex) { Logger.getLogger(MyHash.class.getName()).log(Level.SEVERE, null, ex); } try { while ((text = in.readLine()) != null){ text = text.trim(); words = text.split("\\s+"); for (int i = 0; i < words.length; i++){ list.add(words[i]); } for (int j = 0; j < reserved.length; j++){ if (list.contains(reserved[j])){ list.remove(reserved[j]); } } } } catch (IOException ex) { Logger.getLogger(MyHash.class.getName()).log(Level.SEVERE, null, ex); } try { in.close(); } catch (IOException ex) { Logger.getLogger(MyHash.class.getName()).log(Level.SEVERE, null, ex); } } public static int keyIt (int x) { int key = x % 997; return key; } public static int horner (String word){ int length = word.length(); char[] letters = new char[length]; for (int i = 0; i < length; i++){ letters[i]=word.charAt(i); } char[] alphabet = new char[26]; String abc = "abcdefghijklmnopqrstuvwxyz"; for (int i = 0; i < 26; i++){ alphabet[i]=abc.charAt(i); } int[] numbers = new int[length]; int place = 0; for (int i = 0; i < length; i++){ for (int j = 0; j < 26; j++){ if (alphabet[j]==letters[i]){ numbers[place]=j+1; place++; } } } int hornered = numbers[0] * 32; for (int i = 1; i < numbers.length; i++){ hornered += numbers[i]; if (i == numbers.length -1){ return hornered; } hornered = hornered % 997; hornered *= 32; } return hornered; } public static String[] makeReserved (){ reserved[0] = "abstract"; reserved[1] = "assert"; reserved[2] = "boolean"; reserved[3] = "break"; reserved[4] = "byte"; reserved[5] = "case"; reserved[6] = "catch"; reserved[7] = "char"; reserved[8] = "class"; reserved[9] = "const"; reserved[10] = "continue"; reserved[11] = "default"; reserved[12] = "do"; reserved[13] = "double"; reserved[14] = "else"; reserved[15] = "enum"; reserved[16] = "extends"; reserved[17] = "false"; reserved[18] = "final"; reserved[19] = "finally"; reserved[20] = "float"; reserved[21] = "for"; reserved[22] = "goto"; reserved[23] = "if"; reserved[24] = "implements"; reserved[25] = "import"; reserved[26] = "instanceof"; reserved[27] = "int"; reserved[28] = "interface"; reserved[29] = "long"; reserved[30] = "native"; reserved[31] = "new"; reserved[32] = "null"; reserved[33] = "package"; reserved[34] = "private"; reserved[35] = "protected"; reserved[36] = "public"; reserved[37] = "return"; reserved[38] = "short"; reserved[39] = "static"; reserved[40] = "strictfp"; reserved[41] = "super"; reserved[42] = "switch"; reserved[43] = "synchronize"; reserved[44] = "this"; reserved[45] = "throw"; reserved[46] = "throws"; reserved[47] = "trasient"; reserved[48] = "true"; reserved[49] = "try"; reserved[50] = "void"; reserved[51] = "volatile"; reserved[52] = "while"; reserved[53] = "="; reserved[54] = "=="; reserved[55] = "!="; reserved[56] = "+"; reserved[57] = "-"; reserved[58] = "*"; reserved[59] = "/"; reserved[60] = "{"; reserved[61] = "}"; return reserved; } }

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • XML - python prints extra lines

    - by horse
    `from xml import xpath from xml.dom import minidom xmldata = minidom.parse('model.xml').documentElement for maks in xpath.Evaluate('/cacti/results/maks/text()', xmldata): print maks.nodeValue ` and I get result: 85603399.14 398673062.66 95785523.81 But I needed to be: 85603399.14 NO SPACE 398673062.66 NO SPACE 95785523.81 Can somebody help me, i new at programing :( ?

    Read the article

  • Expandable list with animated effect

    - by Naveen Chauhan
    I am using this animation class to create the animation when i shrink and expand the list on some click event import android.view.View; import android.view.animation.Animation; import android.view.animation.Transformation; import android.widget.LinearLayout.LayoutParams; public class ExpandAnimation extends Animation{ private View mAnimatedView; private LayoutParams mViewLayoutParams; private int mMarginStart, mMarginEnd; private boolean mIsVisibleAfter = false; private boolean mWasEndedAlready = false; public ExpandAnimation(View view, int duration){ setDuration(duration); mAnimatedView = view; System.out.println(view.getVisibility()); mViewLayoutParams = (LayoutParams)view.getLayoutParams(); mIsVisibleAfter = (view.getVisibility() == View.VISIBLE); System.out.println("mIsVisibleAfter:- "+ mIsVisibleAfter); mMarginStart = mViewLayoutParams.bottomMargin; System.out.println("mMarginStart:- "+ mMarginStart); mMarginEnd = (mMarginStart == 0 ?(0 - view.getHeight()):0); System.out.println("mMarginEnd:- "+mMarginEnd); view.setVisibility(View.VISIBLE); } @Override protected void applyTransformation(float interpolatedTime, Transformation t){ super.applyTransformation(interpolatedTime, t); System.out.println("mMarginEnd:- "+interpolatedTime); if(interpolatedTime<1.0f){ System.out.println("Inside if true"); mViewLayoutParams.bottomMargin = mMarginStart + (int) ((mMarginEnd - mMarginStart)*interpolatedTime); System.out.println("mViewLayoutParams.bottomMargin:- "+mViewLayoutParams.bottomMargin); mAnimatedView.requestLayout(); }else if(!mWasEndedAlready){ mViewLayoutParams.bottomMargin = mMarginEnd; mAnimatedView.requestLayout(); System.out.println("mIsVisibleAfter:- "+mIsVisibleAfter); if(mIsVisibleAfter){ mAnimatedView.setVisibility(View.GONE); } mWasEndedAlready = true; } } } i am using following lines on some click event in my activity class to create the object of my animation class View toolbar = (View) findViewById(R.id.toolbar1); ExpandAnimation expandani = new ExpandAnimation(toolbar,500); toolbar.startAnimation(expandani); My probem is that when click event occurs, my list expand and then shrink but it must stop when it grows completely and shrink when i click on up image. please let me know that how my animation class is working. i have also tried myself by using SOP statements which you can see in my animation class.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • How to check for local Wi-Fi (not just cellular connection) using iPhone SDK?

    - by Michael
    I'm currently using the following to check whether Wi-Fi is available for my application: #import <SystemConfiguration/SystemConfiguration.h> static inline BOOL addressReachable(const struct sockaddr_in *hostAddress); BOOL localWiFiAvailable() { struct sockaddr_in localWifiAddress; bzero(&localWifiAddress, sizeof(localWifiAddress)); localWifiAddress.sin_len = sizeof(localWifiAddress); localWifiAddress.sin_family = AF_INET; // IN_LINKLOCALNETNUM is defined in <netinet/in.h> as 169.254.0.0 localWifiAddress.sin_addr.s_addr = htonl(IN_LINKLOCALNETNUM); return addressReachable(&localWifiAddress); } static inline BOOL addressReachable(const struct sockaddr_in *hostAddress) { const SCNetworkReachabilityRef target = SCNetworkReachabilityCreateWithAddress(kCFAllocatorDefault, (const struct sockaddr *)hostAddress); if (target != NULL) { SCNetworkReachabilityFlags flags = 0; const BOOL reachable = SCNetworkReachabilityGetFlags(target, &flags); CFRelease(target); return reachable && (flags & kSCNetworkFlagsReachable); } return NO; } This, however, does not return NO as it should when the iPhone is connected only to a cellular network but not a Wi-Fi network. Does anyone know how to fix this? Edit So this is what I ended up using: #import <arpa/inet.h> // For AF_INET, etc. #import <ifaddrs.h> // For getifaddrs() #import <net/if.h> // For IFF_LOOPBACK BOOL localWiFiAvailable() { struct ifaddrs *addresses; struct ifaddrs *cursor; BOOL wiFiAvailable = NO; if (getifaddrs(&addresses) != 0) return NO; cursor = addresses; while (cursor != NULL) { if (cursor -> ifa_addr -> sa_family == AF_INET && !(cursor -> ifa_flags & IFF_LOOPBACK)) // Ignore the loopback address { // Check for WiFi adapter if (strcmp(cursor -> ifa_name, "en0") == 0) { wiFiAvailable = YES; break; } } cursor = cursor -> ifa_next; } freeifaddrs(addresses); return wiFiAvailable; } Thanks "unforgiven" (and Matt Brown apparently).

    Read the article

  • importing modules in app engine

    - by tanky
    Ive asked this before, but it seems i wasnt clear/detailed enough and after a week of trying im still struggling so i will try again. i am trying to use, oauth2 and ply on app engine. i have tried copying their directories into my app engine project directory (in the form ply-3.4 or brosner-python-oauth2-82a05f9) and i have tried copying the specific sub directory contained within the aforemention one. (ply or oauth2) i have tried saying import oauth2, from brosner-oauth2_python-82a05f9 import oauth and other variations on the theme, but i still cant get it to work nothing has worked. i have tried including them in app.yaml, but that seemed to create an even bigger error as my entire project wouldnt even run when i tried that. and now i have run out of things to try. the error log i am getting is as follows. INFO 2012-10-20 22:33:29,358 dev_appserver.py:2884] "GET / HTTP/1.1" 500 - WARNING 2012-10-20 22:33:58,453 py_zipimport.py:139] Can't open zipfile C:\Python27\lib\site-packages\oauth2-1.0.2-py2.7.egg: IOError: [Errno 13] file not accessible: 'C:\Python27\lib\site-packages\oauth2-1.0.2-py2.7.egg' WARNING 2012-10-20 22:33:58,453 py_zipimport.py:139] Can't open zipfile C:\Python27\lib\site-packages\ply-3.4-py2.7.egg: IOError: [Errno 13] file not accessible: 'C:\Python27\lib\site-packages\ply-3.4-py2.7.egg' WARNING 2012-10-20 22:33:58,453 py_zipimport.py:139] Can't open zipfile C:\Python27\lib\site-packages\tweepy-1.11-py2.7.egg: IOError: [Errno 13] file not accessible: 'C:\Python27\lib\site-packages\tweepy-1.11-py2.7.egg' ERROR 2012-10-20 22:34:00,015 wsgi.py:189] Traceback (most recent call last): File "C:\Program Files\Google\google_appengine\google\appengine\runtime\wsgi.py", line 187, in Handle handler = _config_handle.add_wsgi_middleware(self._LoadHandler()) File "C:\Program Files\Google\google_appengine\google\appengine\runtime\wsgi.py", line 225, in _LoadHandler handler = import(path[0]) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 676, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 1850, in load_module return self.FindAndLoadModule(submodule, fullname, search_path) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 676, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 1722, in FindAndLoadModule description) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 676, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 1665, in LoadModuleRestricted description) File "C:\Documents and Settings\ladds\My Documents\udacity\sigh\main.py", line 3, in import ply ImportError: No module named ply INFO 2012-10-20 22:34:00,030 dev_appserver.py:2884] "GET / HTTP/1.1" 500 - thanks for any help.

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • Warning: newtype `CInt' is used in an FFI declaration,

    - by vivian
    When building gtk2hs-buildtools with ghc 7.4.2, I get the following warning: c2hs/toplevel/C2HSConfig.hs:110:1: Warning: newtype `CInt' is used in an FFI declaration, but its constructor is not in scope. This will become an error in GHC 7.6.1. When checking declaration: foreign import ccall safe "static bitfield_direction" bitfield_direction :: CInt I get similar warnings with FFI calls, even though I have import Foreign.C.Types(CInt). What is the correct way of getting rid of this warning?

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Is there any way to add a MouseListener to a Graphic object ?

    - by Fahad
    Hi, Is there any way to add a MouseListener to a Graphic object. I have this simple GUI that draw an oval. What I want is handling the event when the user clicks on the oval import java.awt.*; import java.awt.event.MouseEvent; import java.awt.event.MouseListener; import javax.swing.*; public class Gui2 extends JFrame { JFrame frame = new JFrame(); MyDrawPanel drawpanel = new MyDrawPanel(); public static void main(String[] args) { Gui2 gui = new Gui2(); gui.go(); } public void go() { frame.getContentPane().add(drawpanel); // frame.addMouseListener(this); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setSize(300, 300); frame.setVisible(true); } } class MyDrawPanel extends JComponent implements MouseListener { public void paintComponent(Graphics g) { int red = (int) (Math.random() * 255); int green = (int) (Math.random() * 255); int blue = (int) (Math.random() * 255); Color startrandomColor = new Color(red, green, blue); red = (int) (Math.random() * 255); green = (int) (Math.random() * 255); blue = (int) (Math.random() * 255); Color endrandomColor = new Color(red, green, blue); Graphics2D g2d = (Graphics2D) g; this.addMouseListener(this); GradientPaint gradient = new GradientPaint(70, 70, startrandomColor, 150, 150, endrandomColor); g2d.setPaint(gradient); g2d.fillOval(70, 70, 100, 100); } @Override public void mouseClicked(MouseEvent e) { if ((e.getButton() == 1) && (e.getX() >= 70 && e.getX() <= 170 && e.getY() >= 70 && e .getY() <= 170)) { this.repaint(); // JOptionPane.showMessageDialog(null,e.getX()+ "\n" + e.getY()); } } @Override public void mouseEntered(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mouseExited(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mousePressed(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mouseReleased(MouseEvent e) { // TODO Auto-generated method stub } } This Works Except it fires when the click is within a virtual box around the oval. Could anyone help me to have it fire when the click is EXACTLY on the oval. Thanks in advance.

    Read the article

  • differences between "d.clear()" and "d={}"

    - by Tshepang
    On my machine, the execution speed between "d.clear()" and "d={}" is over 100ns so am curious why one would use one over the other. import timeit def timing(): d = dict() if __name__=='__main__': t = timeit.Timer('timing()', 'from __main__ import timing') print t.repeat()

    Read the article

  • Flash AS3 Mysterious Blinking MovieClip

    - by Ben
    This is the strangest problem I've faced in flash so far. I have no idea what's causing it. I can provide a .swf if someone wants to actually see it, but I'll describe it as best I can. I'm creating bullets for a tank object to shoot. The tank is a child of the document class. The way I am creating the bullet is: var bullet:Bullet = new Bullet(); (parent as MovieClip).addChild(bullet); The bullet itself simply moves itself in a direction using code like this.x += 5; The problem is the bullets will trace for their creation and destruction at the correct times, however the bullet is sometimes not visible until half way across the screen, sometimes not at all, and sometimes for the whole traversal. Oddly removing the timer I have on bullet creation seems to solve this. The timer is implemented as such: if(shot_timer == 0) { shoot(); // This contains the aforementioned bullet creation method shot_timer = 10; My enter frame handler for the tank object controls the timer and decrements it every frame if it is greater than zero. Can anyone suggest why this could be happening? EDIT: As requested, full code: Bullet.as package { import flash.display.MovieClip; import flash.events.Event; public class Bullet extends MovieClip { public var facing:int; private var speed:int; public function Bullet():void { trace("created"); speed = 10; addEventListener(Event.ADDED_TO_STAGE,addedHandler); } private function addedHandler(e:Event):void { addEventListener(Event.ENTER_FRAME,enterFrameHandler); removeEventListener(Event.ADDED_TO_STAGE,addedHandler); } private function enterFrameHandler(e:Event):void { //0 - up, 1 - left, 2 - down, 3 - right if(this.x > 720 || this.x < 0 || this.y < 0 || this.y > 480) { removeEventListener(Event.ENTER_FRAME,enterFrameHandler); trace("destroyed"); (parent as MovieClip).removeChild(this); return; } switch(facing) { case 0: this.y -= speed; break; case 1: this.x -= speed; break; case 2: this.y += speed; break; case 3: this.x += speed; break; } } } } Tank.as: package { import flash.display.MovieClip; import flash.events.KeyboardEvent; import flash.events.Event; import flash.ui.Keyboard; public class Tank extends MovieClip { private var right:Boolean = false; private var left:Boolean = false; private var up:Boolean = false; private var down:Boolean = false; private var facing:int = 0; //0 - up, 1 - left, 2 - down, 3 - right private var horAllowed:Boolean = true; private var vertAllowed:Boolean = true; private const GRID_SIZE:int = 100; private var shooting:Boolean = false; private var shot_timer:int = 0; private var speed:int = 2; public function Tank():void { addEventListener(Event.ADDED_TO_STAGE,stageAddHandler); addEventListener(Event.ENTER_FRAME, enterFrameHandler); } private function stageAddHandler(e:Event):void { stage.addEventListener(KeyboardEvent.KEY_DOWN,checkKeys); stage.addEventListener(KeyboardEvent.KEY_UP,keyUps); removeEventListener(Event.ADDED_TO_STAGE,stageAddHandler); } public function checkKeys(event:KeyboardEvent):void { if(event.keyCode == 32) { //trace("Spacebar is down"); shooting = true; } if(event.keyCode == 39) { //trace("Right key is down"); right = true; } if(event.keyCode == 38) { //trace("Up key is down"); // lol up = true; } if(event.keyCode == 37) { //trace("Left key is down"); left = true; } if(event.keyCode == 40) { //trace("Down key is down"); down = true; } } public function keyUps(event:KeyboardEvent):void { if(event.keyCode == 32) { event.keyCode = 0; shooting = false; //trace("Spacebar is not down"); } if(event.keyCode == 39) { event.keyCode = 0; right = false; //trace("Right key is not down"); } if(event.keyCode == 38) { event.keyCode = 0; up = false; //trace("Up key is not down"); } if(event.keyCode == 37) { event.keyCode = 0; left = false; //trace("Left key is not down"); } if(event.keyCode == 40) { event.keyCode = 0; down = false; //trace("Down key is not down") // O.o } } public function checkDirectionPermissions(): void { if(this.y % GRID_SIZE < 5 || GRID_SIZE - this.y % GRID_SIZE < 5) { horAllowed = true; } else { horAllowed = false; } if(this.x % GRID_SIZE < 5 || GRID_SIZE - this.x % GRID_SIZE < 5) { vertAllowed = true; } else { vertAllowed = false; } if(!horAllowed && !vertAllowed) { realign(); } } public function realign():void { if(!horAllowed) { if(this.x % GRID_SIZE < GRID_SIZE / 2) { this.x -= this.x % GRID_SIZE; } else { this.x += (GRID_SIZE - this.x % GRID_SIZE); } } if(!vertAllowed) { if(this.y % GRID_SIZE < GRID_SIZE / 2) { this.y -= this.y % GRID_SIZE; } else { this.y += (GRID_SIZE - this.y % GRID_SIZE); } } } public function enterFrameHandler(Event):void { //trace(shot_timer); if(shot_timer > 0) { shot_timer--; } movement(); firing(); } public function firing():void { if(shooting) { if(shot_timer == 0) { shoot(); shot_timer = 10; } } } public function shoot():void { var bullet = new Bullet(); bullet.facing = facing; //0 - up, 1 - left, 2 - down, 3 - right switch(facing) { case 0: bullet.x = this.x; bullet.y = this.y - this.height / 2; break; case 1: bullet.x = this.x - this.width / 2; bullet.y = this.y; break; case 2: bullet.x = this.x; bullet.y = this.y + this.height / 2; break; case 3: bullet.x = this.x + this.width / 2; bullet.y = this.y; break; } (parent as MovieClip).addChild(bullet); } public function movement():void { //0 - up, 1 - left, 2 - down, 3 - right checkDirectionPermissions(); if(horAllowed) { if(right) { orient(3); realign(); this.x += speed; } if(left) { orient(1); realign(); this.x -= speed; } } if(vertAllowed) { if(up) { orient(0); realign(); this.y -= speed; } if(down) { orient(2); realign(); this.y += speed; } } } public function orient(dest:int):void { //trace("facing: " + facing); //trace("dest: " + dest); var angle = facing - dest; this.rotation += (90 * angle); facing = dest; } } }

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

< Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >