Search Results

Search found 15408 results on 617 pages for 'import module'.

Page 206/617 | < Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >

• importing modules in app engine

  - by tanky

  Ive asked this before, but it seems i wasnt clear/detailed enough and after a week of trying im still struggling so i will try again. i am trying to use, oauth2 and ply on app engine. i have tried copying their directories into my app engine project directory (in the form ply-3.4 or brosner-python-oauth2-82a05f9) and i have tried copying the specific sub directory contained within the aforemention one. (ply or oauth2) i have tried saying import oauth2, from brosner-oauth2_python-82a05f9 import oauth and other variations on the theme, but i still cant get it to work nothing has worked. i have tried including them in app.yaml, but that seemed to create an even bigger error as my entire project wouldnt even run when i tried that. and now i have run out of things to try. the error log i am getting is as follows. INFO 2012-10-20 22:33:29,358 dev_appserver.py:2884] "GET / HTTP/1.1" 500 - WARNING 2012-10-20 22:33:58,453 py_zipimport.py:139] Can't open zipfile C:\Python27\lib\site-packages\oauth2-1.0.2-py2.7.egg: IOError: [Errno 13] file not accessible: 'C:\Python27\lib\site-packages\oauth2-1.0.2-py2.7.egg' WARNING 2012-10-20 22:33:58,453 py_zipimport.py:139] Can't open zipfile C:\Python27\lib\site-packages\ply-3.4-py2.7.egg: IOError: [Errno 13] file not accessible: 'C:\Python27\lib\site-packages\ply-3.4-py2.7.egg' WARNING 2012-10-20 22:33:58,453 py_zipimport.py:139] Can't open zipfile C:\Python27\lib\site-packages\tweepy-1.11-py2.7.egg: IOError: [Errno 13] file not accessible: 'C:\Python27\lib\site-packages\tweepy-1.11-py2.7.egg' ERROR 2012-10-20 22:34:00,015 wsgi.py:189] Traceback (most recent call last): File "C:\Program Files\Google\google_appengine\google\appengine\runtime\wsgi.py", line 187, in Handle handler = _config_handle.add_wsgi_middleware(self._LoadHandler()) File "C:\Program Files\Google\google_appengine\google\appengine\runtime\wsgi.py", line 225, in _LoadHandler handler = import(path[0]) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 676, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 1850, in load_module return self.FindAndLoadModule(submodule, fullname, search_path) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 676, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 1722, in FindAndLoadModule description) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 676, in Decorate return func(self, *args, **kwargs) File "C:\Program Files\Google\google_appengine\google\appengine\tools\dev_appserver_import_hook.py", line 1665, in LoadModuleRestricted description) File "C:\Documents and Settings\ladds\My Documents\udacity\sigh\main.py", line 3, in import ply ImportError: No module named ply INFO 2012-10-20 22:34:00,030 dev_appserver.py:2884] "GET / HTTP/1.1" 500 - thanks for any help.

  Read the article

• Creating a Haskell Empty Set

  - by mvid

  I am attempting to pass back a Node type from this function, but I get the error that empty is out of scope: import Data.Set (Set) import qualified Data.Set as Set data Node = Vertex String (Set Node) deriving Show toNode :: String -> Node toNode x = Vertex x empty What am I doing wrong?

  Read the article

• Location of global libraries for Python on Mac ?

  - by xTrol

  Hi, Im fighting with installation SIP for Python on Mac OS X. Finally after compilation and installation when I run console form folder of SIP (locally) I can import sipconfig, but when Im in other folder I cant - there is no module called sipconfig. My question is - Where is folder to which I have to copy modules if I want to have them available globally (like "import os"), or how I can check it, because location "/Library/Python/2.6/site-packages/" doesn`t work.

  Read the article

• How to use HTTP method DELETE on Google App Engine?

  - by Jader Dias

  I can use this verb in the Python Windows SDK. But not in production. Why? What am I doing wrong? The error message includes (only seen via firebug or fiddler) Malformed request or something like that My code looks like: from google.appengine.ext import db from google.appengine.ext import webapp class Handler(webapp.RequestHandler): def delete(self): key = self.request.get('key') item = db.get(key) item.delete() self.response.out.write(key)

  Read the article

• C++ DLL Export: Decorated/Mangled names

  - by Bob

  Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

  Read the article

• Is there any way to add a MouseListener to a Graphic object ?

  - by Fahad

  Hi, Is there any way to add a MouseListener to a Graphic object. I have this simple GUI that draw an oval. What I want is handling the event when the user clicks on the oval import java.awt.*; import java.awt.event.MouseEvent; import java.awt.event.MouseListener; import javax.swing.*; public class Gui2 extends JFrame { JFrame frame = new JFrame(); MyDrawPanel drawpanel = new MyDrawPanel(); public static void main(String[] args) { Gui2 gui = new Gui2(); gui.go(); } public void go() { frame.getContentPane().add(drawpanel); // frame.addMouseListener(this); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setSize(300, 300); frame.setVisible(true); } } class MyDrawPanel extends JComponent implements MouseListener { public void paintComponent(Graphics g) { int red = (int) (Math.random() * 255); int green = (int) (Math.random() * 255); int blue = (int) (Math.random() * 255); Color startrandomColor = new Color(red, green, blue); red = (int) (Math.random() * 255); green = (int) (Math.random() * 255); blue = (int) (Math.random() * 255); Color endrandomColor = new Color(red, green, blue); Graphics2D g2d = (Graphics2D) g; this.addMouseListener(this); GradientPaint gradient = new GradientPaint(70, 70, startrandomColor, 150, 150, endrandomColor); g2d.setPaint(gradient); g2d.fillOval(70, 70, 100, 100); } @Override public void mouseClicked(MouseEvent e) { if ((e.getButton() == 1) && (e.getX() >= 70 && e.getX() <= 170 && e.getY() >= 70 && e .getY() <= 170)) { this.repaint(); // JOptionPane.showMessageDialog(null,e.getX()+ "\n" + e.getY()); } } @Override public void mouseEntered(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mouseExited(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mousePressed(MouseEvent e) { // TODO Auto-generated method stub } @Override public void mouseReleased(MouseEvent e) { // TODO Auto-generated method stub } } This Works Except it fires when the click is within a virtual box around the oval. Could anyone help me to have it fire when the click is EXACTLY on the oval. Thanks in advance.

  Read the article

• Why do all procedures have to be defined before the compiler sees them?

  - by incrediman

  For example, take a look at this code (from tspl4): (define proc1 (lambda (x y) (proc2 y x))) If I run this as my program in scheme... #!r6rs (import (rnrs)) (define proc1 (lambda (x y) (proc2 y x))) I get this error: expand: unbound identifier in module in: proc2 ...This code works fine though: #!r6rs (import (rnrs)) (define proc2 +) (define proc1 (lambda (x y) (proc2 y x))) (display (proc1 2 3)) ;output: 5

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• C++ MIDI file reading library

  - by Raceimaztion

  I'm trying to write some software to read a MIDI file into an internal data format and use it to control 3D simulated instruments. My biggest problem is reading the MIDI data in from a file, and I'd like to avoid writing all the import code. Does anyone know of a free (preferably Open Source), cross-platform MIDI file reading library? What features does it have? Can it import other note-based music formats?

  Read the article

• Warning: newtype `CInt' is used in an FFI declaration,

  - by vivian

  When building gtk2hs-buildtools with ghc 7.4.2, I get the following warning: c2hs/toplevel/C2HSConfig.hs:110:1: Warning: newtype `CInt' is used in an FFI declaration, but its constructor is not in scope. This will become an error in GHC 7.6.1. When checking declaration: foreign import ccall safe "static bitfield_direction" bitfield_direction :: CInt I get similar warnings with FFI calls, even though I have import Foreign.C.Types(CInt). What is the correct way of getting rid of this warning?

  Read the article

• error in coding in pygame.

  - by mekasperasky

  import pygame from pygame.locals import * screen=pygame.display.set_mode() nin=pygame.image.load('/home/satyajit/Desktop/nincompoop0001.bmp') screen.blit(nin,(50,100)) according to the code i should get a screen with an image of nin on it . But I only get a black screen which doesnt go even though i press the exit button on it. how to get the image on the screen?

  Read the article

• Basic Google search using a shell script

  - by Lri

  Something like this but using just basic shell scripting: #!/usr/bin/env python import urllib import json base = 'http://ajax.googleapis.com/ajax/services/search/web?v=1.0&' query = urllib.urlencode({'q' : "something"}) response = urllib.urlopen(base + query).read() data = json.loads(response) print data['responseData']['results'][0]['url'] Any more convenient alternatives to ajax.googleapis.com? If not, how should you encode the URL and parse JSON?

  Read the article

• im writing a spellchecking program, how do i replace ch in a string..eg..

  - by Ajay Hopkins

  what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

  Read the article

• Some problem with postgres_psycopg2

  - by aatifh

  Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

  Read the article

• Java converting to Jython-Getting a class object within itself

  - by Bggreen

  I am attempting to convert Java code to Jython and am using the apache Log and LogFactory imports. I am attempting to emulate Foo.class in Jython The chunk of code is as follows: in Java import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; public class MyClass { private static final Log log = LogFactory.getLog(MyClass.class); public MyClass(Document dom) { //code } How can I emulate this same behavior of MyClass.class in Jython/Python?

  Read the article

• mysql_connect randomly hangs up

  - by sergdev

  I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

  Read the article

• Do you have to use display to output stuff using r6rs?

  - by incrediman

  Background: I am new to scheme, and am using DrScheme to write my programs. The following program outputs 12345 when I run the program as r5rs: 12345 However the following program outputs nothing (it's an r6rs program): #!r6rs (import (rnrs)) 12345 That being said, I can get it to output 12345 by doing this: #!r6rs (import (rnrs)) (display 1235) Is that something new with r6rs, where output only occurs when specifically specified using display? Or am I just doing something else wrong

  Read the article

• python multiprocessing member variable not set

  - by Jake

  In the following script, I get the "stop message received" output but the process never ends. Why is that? Is there another way to end a process besides terminate or os.kill that is along these lines? from multiprocessing import Process from time import sleep class Test(Process): def __init__(self): Process.__init__(self) self.stop = False def run(self): while self.stop == False: print "running" sleep(1.0) def end(self): print "stop message received" self.stop = True if __name__ == "__main__": test = Test() test.start() sleep(1.0) test.end() test.join()

  Read the article

• Drupal 7: Create a taxonomy term for each node and use the node title as the term name

  - by Spre3

  Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

  Read the article

• net::rawip and net::packet cpan modules

  - by kased

  which cpan module is more sutiable for packet crafting and injection (net::rawip and net::packet) could someone provide what the cons and pros for everyone one of those modules and when it suitable to use every module ?

  Read the article

• Get the path to Django itself

  - by andybak

  I've got some code that runs on every (nearly) every admin request but doesn't have access to the 'request' object. I need to find the path to Django installation. I could do: import django django_path = django.__file__ but that seems rather wasteful in the middle of a request. Does putting the import at the start of the module waste memory? I'm fairly sure I'm missing an obvious trick here.

  Read the article

• How to read the file

  - by muruga

  I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file.But I want the file content instead of the file. I know that using the read method we can read the file content. But how to call the read function and how to get the file content. Please help me.

  Read the article

• Behaviour difference Dim oDialog1 as Dialog1 = New Dialog1 VS Dim oDialog1 as Dialog1 = Dialog1

  - by user472722

  VB.Net 2005 I have a now closed Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = New Dialog1. VB.Net 2008 I have a still open Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = Dialog1. VB.Net 2005 does not compile using Dim oDialog1 as Dialog1 = Dialog1 and insists on NEW What is going on and why do I need the different initialisation syntax?

  Read the article

• Opencart SEO URL

  - by user2483877

  My question is, I have installed the SEO component successfully, and its working well but; On homepage, the Latest Products module shows the url like http://www.domain.com/product-21.html On category page, the product shows the url like http://www.domain.com/category/product-21.html I want to put the category URL in the latest products module so it will be the same as on category page. Does anybody have any ideas about this?

  Read the article

• What is the "proper" method for determining if a swf is running within an AIR application?

  - by Michael Prescott

  I've got a Flex Web project and a Flex AIR project that use a common code-base. The common code defines several run-time loaded Flex Modules. I want the Flex Modules to behave differently depending on whether the running base application is WEB or AIR. What is the proper method for determining from the module code whether the module is running in a WEB or AIR application? (I found that Security.sandboxType.toString() returns "application", but I haven't found anything better in the documentation, yet.)

  Read the article

< Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >