Search Results

Search found 15408 results on 617 pages for 'import module'.

Page 206/617 | < Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Basic Google search using a shell script

    - by Lri
    Something like this but using just basic shell scripting: #!/usr/bin/env python import urllib import json base = 'http://ajax.googleapis.com/ajax/services/search/web?v=1.0&' query = urllib.urlencode({'q' : "something"}) response = urllib.urlopen(base + query).read() data = json.loads(response) print data['responseData']['results'][0]['url'] Any more convenient alternatives to ajax.googleapis.com? If not, how should you encode the URL and parse JSON?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Warning: newtype `CInt' is used in an FFI declaration,

    - by vivian
    When building gtk2hs-buildtools with ghc 7.4.2, I get the following warning: c2hs/toplevel/C2HSConfig.hs:110:1: Warning: newtype `CInt' is used in an FFI declaration, but its constructor is not in scope. This will become an error in GHC 7.6.1. When checking declaration: foreign import ccall safe "static bitfield_direction" bitfield_direction :: CInt I get similar warnings with FFI calls, even though I have import Foreign.C.Types(CInt). What is the correct way of getting rid of this warning?

    Read the article

  • C++ MIDI file reading library

    - by Raceimaztion
    I'm trying to write some software to read a MIDI file into an internal data format and use it to control 3D simulated instruments. My biggest problem is reading the MIDI data in from a file, and I'd like to avoid writing all the import code. Does anyone know of a free (preferably Open Source), cross-platform MIDI file reading library? What features does it have? Can it import other note-based music formats?

    Read the article

  • Location of global libraries for Python on Mac ?

    - by xTrol
    Hi, Im fighting with installation SIP for Python on Mac OS X. Finally after compilation and installation when I run console form folder of SIP (locally) I can import sipconfig, but when Im in other folder I cant - there is no module called sipconfig. My question is - Where is folder to which I have to copy modules if I want to have them available globally (like "import os"), or how I can check it, because location "/Library/Python/2.6/site-packages/" doesn`t work.

    Read the article

  • What is wrong with this SimPy installation?

    - by dmindreader
    Alright, I have tried a bunch of times the python setup.py install command from my command prompt, and this is what I'm getting: SCREEN And when trying this: from SimPy.Simulation import * on Idle, I get this: Traceback (most recent call last): File "C:/Python30/pruebas/prueba1", line 1, in <module> from SimPy.Simulation import * File "C:\Python30\SimPy\Simulation.py", line 320 print 'SimPy.Simulation %s' %__version__, ^ SyntaxError: invalid syntax >>>

    Read the article

  • Why do all procedures have to be defined before the compiler sees them?

    - by incrediman
    For example, take a look at this code (from tspl4): (define proc1 (lambda (x y) (proc2 y x))) If I run this as my program in scheme... #!r6rs (import (rnrs)) (define proc1 (lambda (x y) (proc2 y x))) I get this error: expand: unbound identifier in module in: proc2 ...This code works fine though: #!r6rs (import (rnrs)) (define proc2 +) (define proc1 (lambda (x y) (proc2 y x))) (display (proc1 2 3)) ;output: 5

    Read the article

  • Creating a Haskell Empty Set

    - by mvid
    I am attempting to pass back a Node type from this function, but I get the error that empty is out of scope: import Data.Set (Set) import qualified Data.Set as Set data Node = Vertex String (Set Node) deriving Show toNode :: String -> Node toNode x = Vertex x empty What am I doing wrong?

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • error in coding in pygame.

    - by mekasperasky
    import pygame from pygame.locals import * screen=pygame.display.set_mode() nin=pygame.image.load('/home/satyajit/Desktop/nincompoop0001.bmp') screen.blit(nin,(50,100)) according to the code i should get a screen with an image of nin on it . But I only get a black screen which doesnt go even though i press the exit button on it. how to get the image on the screen?

    Read the article

  • Java converting to Jython-Getting a class object within itself

    - by Bggreen
    I am attempting to convert Java code to Jython and am using the apache Log and LogFactory imports. I am attempting to emulate Foo.class in Jython The chunk of code is as follows: in Java import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; public class MyClass { private static final Log log = LogFactory.getLog(MyClass.class); public MyClass(Document dom) { //code } How can I emulate this same behavior of MyClass.class in Jython/Python?

    Read the article

  • Get the path to Django itself

    - by andybak
    I've got some code that runs on every (nearly) every admin request but doesn't have access to the 'request' object. I need to find the path to Django installation. I could do: import django django_path = django.__file__ but that seems rather wasteful in the middle of a request. Does putting the import at the start of the module waste memory? I'm fairly sure I'm missing an obvious trick here.

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • Do you have to use display to output stuff using r6rs?

    - by incrediman
    Background: I am new to scheme, and am using DrScheme to write my programs. The following program outputs 12345 when I run the program as r5rs: 12345 However the following program outputs nothing (it's an r6rs program): #!r6rs (import (rnrs)) 12345 That being said, I can get it to output 12345 by doing this: #!r6rs (import (rnrs)) (display 1235) Is that something new with r6rs, where output only occurs when specifically specified using display? Or am I just doing something else wrong

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • python multiprocessing member variable not set

    - by Jake
    In the following script, I get the "stop message received" output but the process never ends. Why is that? Is there another way to end a process besides terminate or os.kill that is along these lines? from multiprocessing import Process from time import sleep class Test(Process): def __init__(self): Process.__init__(self) self.stop = False def run(self): while self.stop == False: print "running" sleep(1.0) def end(self): print "stop message received" self.stop = True if __name__ == "__main__": test = Test() test.start() sleep(1.0) test.end() test.join()

    Read the article

  • What is the "proper" method for determining if a swf is running within an AIR application?

    - by Michael Prescott
    I've got a Flex Web project and a Flex AIR project that use a common code-base. The common code defines several run-time loaded Flex Modules. I want the Flex Modules to behave differently depending on whether the running base application is WEB or AIR. What is the proper method for determining from the module code whether the module is running in a WEB or AIR application? (I found that Security.sandboxType.toString() returns "application", but I haven't found anything better in the documentation, yet.)

    Read the article

  • How to read the file

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file.But I want the file content instead of the file. I know that using the read method we can read the file content. But how to call the read function and how to get the file content. Please help me.

    Read the article

  • PHP Eclipse - importing existing CakePHP projects

    - by MOFlint
    I'm trying to import existing Cake 1.2 projects into PHP Eclipse (latest all-in-one download on Galileo build) - I don't think I understand Eclipse properly: 1) I have created Workspace on my web root C:\Program Files\xampp\htdocs 2) I have created new Project C:\Program Files\xampp\htdocs\EclipseCake ... how do I import my existing cake project into my new project (EclipseCake) ? I tried Configure Include Path - Project - Add ... but no file browser appears. I'm obviously misunderstanding this.

    Read the article

  • Behaviour difference Dim oDialog1 as Dialog1 = New Dialog1 VS Dim oDialog1 as Dialog1 = Dialog1

    - by user472722
    VB.Net 2005 I have a now closed Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = New Dialog1. VB.Net 2008 I have a still open Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = Dialog1. VB.Net 2005 does not compile using Dim oDialog1 as Dialog1 = Dialog1 and insists on NEW What is going on and why do I need the different initialisation syntax?

    Read the article

  • Python: saving and loading a class definition

    - by Peterstone
    Hi! I am interested in saving and load objects using the pickle module as you can read in a question I asked before: Python: Errors saving and loading objects with pickle module Someone commment: 1, In an other way: the error is raise because pickle wanted to load an instance of the class Fruits and search for the class definition where it was defined, but it didn't find it so it raise the error Now I want to save and load a class definition in order to solve the problem I describe in the question mentioned before. Thank you so much!

    Read the article

< Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >