Search Results

Search found 13303 results on 533 pages for 'position fixed'.

Page 209/533 | < Previous Page | 205 206 207 208 209 210 211 212 213 214 215 216  | Next Page >

  • Finding distance to the closest point in a point cloud on an uniform grid

    - by erik
    I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

    Read the article

  • SEM/SEO tasks doubts

    - by Josemalive
    Hello, Actually i think that i have an strong knowledge of SEO, but im having some doubts about the following: I will have to increase the position in Google of certain product pages of a company in the next months. I supposed that not only will be sufficient the following tasks: Improve usability of those pages. Change the pages title. Add meta description and keywords. Url's in a REST way. 301's http header to dont lose page rank for the new URLS Optimizing content for Google. Configure links of the website (follow and no follow attributes) Get more inbounds links (Link building tasks). Create RSS. Put main website in Twitter (using twitter feed) using the RSS. Put main website in Facebook. Create a Youtube channel. Invest in Adwords. Invest in other online advertising companies. Use sitemap.xml and Google Webmaster tools. Use Google Trends to analyze the volume of searches of certain keywords. Use Google Analytics to analyze weak points and good points of your site, and find new oportunities in keywords. Use tools to find new keywords related with your content. Do you have some internet links, or knowledge about all the tasks that a SEO Expert should do? Could you share some knowledge about what kind of business could be do with another companies (B2B) to increase the search engine position of those product pages. Do you know more tecniques about how to get more inbound links? (i only know the link interchange) Thanks in advance. Best Regards. Jose.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Inflated ImageView to put in GalleryView isn't the right size

    - by Richard
    I am trying to inflate an ImageView that scales a Drawable that I can display in a GalleryView. My code to inflate the view seems to work fine, except that the attributes of the ImageView are not applied. Specifically, the inflated ImageView does not have the width/height that I set for it via the android:layout params in XML. Can someone show me what I'm doing wrong? I want to set the width/height of the image in dp, so that it is the correct size across multiple screen dpis and support Android 1.5+. As a result I cannot use something like: i.setLayoutParams(new Gallery.LayoutParams(150, 116) My layout definition is: <?xml version="1.0" encoding="utf-8"?> <ImageView xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="150dp" android:layout_height="116dp" android:background="@drawable/gallery_item_background" android:scaleType="fitXY" /> </ImageView> And the snippet I am using to inflate the ImageView is: public View getView(int position, View convertView, ViewGroup parent) { LayoutInflater inflater = getLayoutInflater(); ImageView i = (ImageView) inflater.inflate(R.layout.gallery_item, null); i.setImageResource(mImageIds.get(position)); i.setScaleType(ImageView.ScaleType.FIT_XY); return i; }

    Read the article

  • Silverlight: how to use a scroll viewer to wrap a list view without specifying height?

    - by John Nicholas
    I have a control that has a list that varies in length greatly. This control appears in various places meaning that i cannot calculate its position and desired height easily. Moreover all I want is for the scrollviewer to simply size itself according to its parent. currently it insists on sizing itself according to the content. currently when i have a list that exceeds the height of the screen the whole control extends off the bottom and the scrollviewer shows no bar (because it has stretched to the heigth of the contents and so thinks it is not required). I've not included code as the object graph is fairly deep. What i am looking for is a set of conditions that would cause the scrollviewer to resize itself according to its content rather than its parent. I have it working in a similar situation involving grids and datagrids, the unique part of this control is that there is a list containing controls. Any ideas? I would prefer solutions that don't require use of code behind - but im really not in a position to be choosey.

    Read the article

  • Android Custom Adapter with Bar Progress

    - by xger86x
    Hi, i have a custom adapter for an arraylist. <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content" android:orientation="horizontal"> <ProgressBar android:id="@+id/downloadprogress" style="?android:attr/progressBarStyleHorizontal" android:layout_width="200dip" android:layout_height="wrap_content" android:max="100" android:progress="50" android:secondaryProgress="75" /> <TextView android:id="@+id/tripsname" android:layout_width="wrap_content" android:layout_height="wrap_content"/> </LinearLayout> but when i try to access to the progress bar in the adapter private class MyAdapter extends ArrayAdapter<Trip> { int resource; public MyAdapter(Context context, int resource, ArrayList<Trip> items) { super(context, resource,items); this.resource=resource; } @Override public View getView(int position, View convertView, ViewGroup parent) { LinearLayout tripListItemView; final Trip t = getItem(position); String name = t.getName(); boolean offline = t.isOffline() ; if(convertView==null) { tripListItemView = new LinearLayout(getContext()); String inflater = Context.LAYOUT_INFLATER_SERVICE; LayoutInflater vi; vi = (LayoutInflater)getContext().getSystemService(inflater); vi.inflate(resource, tripListItemView, true); } else { tripListItemView = (LinearLayout) convertView; } setProgressBarVisibility(true); View v = findViewById(R.id.downloadprogress); ProgressBar progressHorizontal = (ProgressBar) findViewById(R.id.downloadprogress); it always return null, like it doesn't find the progress bar. However, the progress bar is shown in the list, but i need to access to it inside the adapter. Anybody knows the solution? Thanks

    Read the article

  • How do I get uri of HTTP packet with winpcap?

    - by Gtker
    Based on this article I can get all incoming packets. /* Callback function invoked by libpcap for every incoming packet */ void packet_handler(u_char *param, const struct pcap_pkthdr *header, const u_char *pkt_data) { struct tm *ltime; char timestr[16]; ip_header *ih; udp_header *uh; u_int ip_len; u_short sport,dport; time_t local_tv_sec; /* convert the timestamp to readable format */ local_tv_sec = header->ts.tv_sec; ltime=localtime(&local_tv_sec); strftime( timestr, sizeof timestr, "%H:%M:%S", ltime); /* print timestamp and length of the packet */ printf("%s.%.6d len:%d ", timestr, header->ts.tv_usec, header->len); /* retireve the position of the ip header */ ih = (ip_header *) (pkt_data + 14); //length of ethernet header /* retireve the position of the udp header */ ip_len = (ih->ver_ihl & 0xf) * 4; uh = (udp_header *) ((u_char*)ih + ip_len); /* convert from network byte order to host byte order */ sport = ntohs( uh->sport ); dport = ntohs( uh->dport ); /* print ip addresses and udp ports */ printf("%d.%d.%d.%d.%d -> %d.%d.%d.%d.%d\n", ih->saddr.byte1, ih->saddr.byte2, ih->saddr.byte3, ih->saddr.byte4, sport, ih->daddr.byte1, ih->daddr.byte2, ih->daddr.byte3, ih->daddr.byte4, dport); } But how do I extract URI information in packet_handler?

    Read the article

  • Flash gets XML but the values are wrong, as3

    - by VideoDnd
    Flash receives the XML, but the values are wrong. How do I fix this? Problem I can see the XML loaded with no errors, but my output is way off. It's as though it's not receiving any values. Numbers in the output window and animation move rapidly. The Flash file runs as if it's variables where set to zero. I changed the order of my code, but that didn't help with this. Please explain how I can correct this. SWF //load xml var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("xml.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //parse XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML); //receive values from XML delay = parseInt(myXML.DELAY.text()); trace(delay); repeat = parseInt(myXML.REPEAT.text()); trace(repeat); } //variables var delay:uint = 0; var repeat:uint = 0; //timer and event var timer:Timer = new Timer(uint(delay),uint(repeat)); timer.addEventListener(TimerEvent.TIMER, countdown); //counter function countdown(event:TimerEvent) { myText.text = String(0 + timer.currentCount); trace(0 + timer.currentCount); } timer.start(); XML <?xml version="1.0" encoding="utf-8"?> <SESSION> <DELAY TITLE="starting position">1000</DELAY> <REPEAT TITLE="starting position">60</REPEAT> </SESSION>

    Read the article

  • DjangoUnicodeDecodeError while storing pickle'd data.

    - by Jack M.
    I've got a simple dict object I'm trying to store in the database after it has been run through pickle. It seems that Django doesn't like trying to encode this error. I've checked with MySQL, and the query isn't even getting there before it is throwing the error, so I don't believe that is the problem. The dict I'm storing looks like this: { 'ordered': [ { 'value': u'First\xd1ame Last\xd1ame', 'label': u'Full Name' }, { 'value': u'123-456-7890', 'label': u'Phone Number' }, { 'value': u'[email protected]', 'label': u'Email Address' } ], 'cleaned_data': { u'Phone Number': u'123-456-7890', u'Full Name': u'First\xd1ame Last\xd1ame', u'Email Address': u'[email protected]' }, 'post_data': <QueryDict: { u'Phone Number': [u'1234567890'], u'Full Name_1': [u'Last\xd1ame'], u'Full Name_0': [u'First\xd1ame'], u'Email Address': [u'[email protected]'] }>, 'user': <User: itis> } The error that gets thrown is: 'utf8' codec can't decode bytes in position 52-53: invalid data. Position 52-53 is the first instance of \xd1 (Ñ) in the pickled data. So far, I've dug around StackOverflow and found a few questions where the database encoding for the objects was wrong. This doesn't help me because there is no MySQL query yet. This is happening before the database. Google also didn't help much when searching for unicode errors on pickled data. It is probably worth mentioning that if I don't use the Ñ, this code works fine.

    Read the article

  • using jquery in asp.net to hide div tag

    - by Eyla
    Greetings, I have asp.net check box control and asp.net dropdownlist control inside div tag. I want to hid the div when I check the box and unhide it when I unchecked the box. I tried few ways with jquery but I could not do it. Here is my code please look at it and tell me what is wrong with it. <%@ Page Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" Title="Untitled Page" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> <script src="js/jquery-1.4.1-vsdoc.js" type="text/javascript"></script> <script type="text/javascript"> function ModifyOccup() { $('myOccup').removeClass('display1'); $('myOccup').removeClass('display1'); $('myOccup').removeClass('display'); $('myOccup').removeClass('display'); if ($('#<%=chkOccup.ClientID %>').is(':checked')) { $('myOccup').addClass('display1'); } else { $('myOccup').addClass('display'); } } </script> <asp:CheckBox ID="chkOccup" runat="server" Style="top: 1055px; left: 355px; position: absolute; height: 22px; width: 126px" Text="Check to modify" onclick=" ModifyOccup()"/> <div id ="myOccup" > <asp:DropDownList ID="cmbWorkField" runat="server" Style="top: 1090px; left: 350px; position: absolute; height: 22px; width: 126px"> </asp:DropDownList> </div> </asp:Content> ...................... Style.css File .......................... .display { display: none; } .display1 { display: inherit; }

    Read the article

  • Determine whether a canvas has been inserted into each page

    - by Hadi Teo
    Hi, Currently i have a code which will print OMR Mark on each pages. Basically i insert a canvas into each page and subsequently an OMR Mark Line Series are inserted into the canvas. Recently i found an issue that somehow one of the canvas is placed out of a page and it appears at the previous page instead of the current page. Below is the code snippet in how i inserted canvas as well as OMR Marks into each page: ' Start Code Snippet Sub GenerateOMR() Dim ShpCanvas As Shape Dim MaxPages As Integer Dim PNo As Integer ClearOMR MaxPages = Selection.Information(wdNumberOfPagesInDocument) For PNo = 1 To MaxPages Selection.GoTo What:=wdGoToPage, Which:=wdGoToFirst, Count:=PNo, Name:="" Select Case PNo Case 1 Set ShpCanvas = ActiveDocument.Shapes.AddCanvas(0, 0.5, 600, 300) Case Else Set ShpCanvas = ActiveDocument.Shapes.AddCanvas(0, 0, 600, 300) End Select ' Add a canvas on each page With ShpCanvas .Name = "OMR_Canvas_" & CStr(PNo) .RelativeHorizontalPosition = wdRelativeHorizontalPositionPage .RelativeVerticalPosition = wdRelativeVerticalPositionPage End With ' Insert a white background rectange and remove the rectangle border line With ShpCanvas.CanvasItems.AddShape(msoShapeRectangle, 536, 0, 64, 300) .Name = "OMR_WhiteBackground_" & CStr(PNo) .Fill.ForeColor.RGB = RGB(255, 255, 255) .Line.ForeColor.RGB = RGB(255, 255, 255) End With PrintOMRPage ShpCanvas, PNo Next PNo End Sub ' End Code Snippet There is a custom method called PrintOMRPage method which is not relevant here. My question now, how do i know whether a canvas has been inserted into a page ? Basically i will loop in all the pages and check whether a canvas has been inserted into that page. Apparently i cannot find the correct way. I have tried to check using ActiveDocument.Shapes(1).Top and validate whether the Top position is a negative value. But apparently the Top position is always measured from the top of each page. Thanks for the help. hadi teo

    Read the article

  • How does real-time collaboration with multiple clients work in a system using operation transformati

    - by Saikat Chakrabarti
    I just finished reading High-Latency, Low-Bandwidth Windowing in the Jupiter Collaboration System and I mostly followed everything until part 6: global consistency. This part describes how the system described in the paper can be extended to accomodate for multiple clients connected to the server. However, the explanation is very short and essentially says the system will work if the central server merely forwards client messages to all the other clients. I don't really understand how this works though. What state vector would be sent in the message that is sent to all the other clients? Does the server maintain separate state vectors for each client? Does it maintain a separate copy of the widgets locally for each client? The simple example I can think of is this setup: imagine client A, server, and client B with client A and client B both connected to the server. To start, all three have the state object "ABCD". Then, client A sends the message "insert character F at position 0" at the same time client B sends the message "insert character G at position 0" to the server. It seems like simply relaying client A's message to client B and vice versa doesn't actually handle this case. So what exactly does the server do?

    Read the article

  • Java & android: Help linking an item in a listView to its correct view, but not the way i know of.

    - by Capsud
    Hi, i'm developing an android app, and what i have is a String array of restaurants in one class... static final String[] AtoZ = new String[] { "Ananda", "Brambles Cafe", "Brannigans", "Buona Sera", "Cafe Mao", "Cafe Mimo", "Dante", "Eddie Rockets", "Frango's World Cuisine", "Nando's", "Overends Restaurant @ Airfield House", "Pizza Hut", "Roly Saul", "Siam Thai","Smokey Joes","Sohag Tandoori", "TGI Friday","The Rockfield Lounge", "Winters Bar", "Al Boschetto","Baan Thai", "Bella Cuba", "Bellamys","Bianconis","Canal Bank Cafe", "Canalettos Restaurant","Chandni Restaurant", "Chill Out Cafe", "Crowes", "Da Vincenzo", "Druids", "Dylan", "Epic Restaurant", "Jewel in the Crown", "Juniors", "Kanum Thai","Kites", "Koishi","Maia Restaurant", "Mangetu Restaurant", "Millers Pizza Kitchens", "O'Connells Restaurant", "Ocras Restaurant", "Orchid Szechuan Restaurant", "Roly's Bistro", "Ryans Beggars Bush", }; i have created a view for each of these restaurants aswell in my layouts folder. so this array is going to be displayed in a listView in my android app. What i want to know is what is the quickest way of linking the item clicked to its correct view, without having to type out each position in the array and have a serious of if statements which would take a year with this! i dont want to be doing something like this if(position == 1){ setContentView(R.layout.bentleys); as it would take a year doing that for each one... Please help. thanks alot.

    Read the article

  • How to get list of files which are currently being diffed in vim

    - by Yogesh Arora
    I am writing a vim plugin in which i need to determine all those files which are currently being diffed. That is the ones for which diff is set. I have been going through the manual but could not find much. Is it possible to do this. This question is actually related to question how-to-detect-the-position-of-window-in-vim. In that question i was trying to get the position of window, so as to detect which one of the diffs is the right one and which is left one. The solution i got was to use winnr() That solution can work only if there are only 2 windows(the ones being diffed). I want to make it generic so that even if multiple windows are open in vim, i can determine which one is on left and which one is right. This is what i was thinking to solve the problem Get a list of all listed buffers For each of this buffers determine if diff is 1 for that If diff is 1 use bufwinnr() to gets it window number. From the window numbers determine which one is left and which one is right. left one will have smaller window number And then determine if current buffer(in which alt-left`alt-right` is pressed) is left or right using winnr of current buffer. Now the pieces that are missing are 1 and 2. For 1 ls can be used but i need to parse its output. Is there a straightfwd way to get list of all listed buffers. And then is there a way to check if for that buffer diff is 1 or not. Any suggestions for a simpler solution are also appreciated.

    Read the article

  • Changing Positions of the Chart When Creating Multiple Charts Automatically via Vbasic in Excel 2007

    - by McVey
    I am creating a new chart for each row of data in an Excel spreadsheet. I have the Vbasic working properly, but I want to change the position of the chart on the sheet that is added for each row. Below is my code, what do I need to do to change the position of the chart on the page automatically? Ideally, I would like it to be in the upper left hand corner of each sheet. Sub DrawCharts() Dim Ws As Worksheet Dim NewWs As Worksheet Dim cht As Chart Dim LastRow As Long Dim CurrRow As Long Set Ws = ThisWorkbook.Worksheets("Sheet1") LastRow = Ws.Range("A65536").End(xlUp).Row For CurrRow = 2 To LastRow Set NewWs = ThisWorkbook.Worksheets.Add NewWs.Name = Ws.Range("A" & CurrRow).Value Set cht = ThisWorkbook.Charts.Add With cht .ChartType = xl3DColumnClustered .SeriesCollection.NewSeries .SeriesCollection(1).Values = "=" & Ws.Name & "!R" & CurrRow & "C3:R" & CurrRow & "C8" .SeriesCollection(1).Name = "=" & Ws.Name & "!R" & CurrRow & "C2" .SeriesCollection(1).XValues = "Sheet1!R1C3:R1C8" .Axes(xlValue).MinimumScale = 0 .Axes(xlValue).MaximumScale = 1 .Axes(xlValue).MajorUnit = 0.2 .SetElement (msoElementDataLabelShow) .SetElement (msoElementLegendNone) .Location Where:=xlLocationAsObject, Name:=NewWs.Name End With Next CurrRow End Sub Any help is appreciated.

    Read the article

  • XSLT Global count of grouped items

    - by Chris
    Hi there, I have a set of items which i am grouping using the muenchian method using keys. This is working great however when i try to do things with the first x number of items it is doing it on the x number of items in each group rather than across the whole set of results. How would i get the individual position of each item accross the whole collection? <xsl:key name="pictures-by-productid" match="/dsQueryResponse/Rows/Row" use="@ProductId" /> <xsl:template match="/"> <div style="border:1px solid red; float:left;"> <xsl:apply-templates select="/" mode="sub"> </xsl:apply-templates> </div> </xsl:template> and the second template <xsl:template match="/" mode="sub"> <xsl:for-each select="/dsQueryResponse/Rows/Row[count(. | key('pictures-by-productid', @ProductId)[1]) = 1]"> <xsl:for-each select="key('pictures-by-productid', @ProductId)"> <xsl:sort select="@PictureType" /> <div style="float:left; margin:2px;"> <img src="{@ThumbNailUrl}" width="58" /> <br /> Download <xsl:number value="position()" format="1. " /> <xsl:value-of select="." /> </div> </xsl:for-each> </xsl:for-each> </xsl:template> Thanks Chris

    Read the article

  • Database design grouping contacts by lists and companies

    - by Serge
    Hi, I'm wondering what would be the best way to group contacts by their company. Right now a user can group their contacts by custom created lists but I'd like to be able to group contacts by their company as well as store the contact's position (i.e. Project Manager of XYZ company). Database wise this is what I have for grouping contacts into lists contact [id_contact] [int] PK NOT NULL, [lastName] [varchar] (128) NULL, [firstName] [varchar] (128) NULL, ...... contact_list [id_contact] [int] FK, [id_list] [int] FK, list [id_list] [int] PK [id_user] [int] FK [list_name] [varchar] (128) NOT NULL, [description] [TEXT] NULL Should I implement something similar for grouping contacts by company? If so how would I store the contact's position in that company and how can I prevent data corruption if a user modifies a contact's company name. For instance John Doe changed companies but the other co-workers are still in the old company. I doubt that will happen often (might not even happen at all) but better be safe than sorry. I'm also keeping an audit trail so in a way the contact would still need to be linked to the old company as well as the new one but without confusing what company he's actually working at the moment. I hope that made sense... Has anyone encountered such a problem? UPDATE Would something like this make sense contact_company [id_contact_company] [int] PK [id_contact] [int] FK [id_company] [int] FK [contact_title] [varchar] (128) company [id_company] [int] PK NOT NULL, [company_name] [varchar] (128) NULL, [company_description] [varchar] (300) NULL, [created_date] [datetime] NOT NULL This way a contact can work for more than one company and contacts can be grouped by companies

    Read the article

  • External XML and AS3

    - by VideoDnd
    I want to pass external XML a variable. How do I do this? WHAT I'M AFTER - update my variable with COUNT XML WHAT I'M NOT GETTING - The integer to String values - How to pass XML to a variable link http://videodnd.weebly.com/ time.xml <?xml version="1.0" encoding="utf-8"?> <SESSION> <COUNT TITLE="starting position">-77777</COUNT> </SESSION> xml.fla //VARIABLES /*CHANGE TO COUNT MyString or count, I don't know if it was necessary to go from int to String */ var myString:String = ""; var count:int = int(myString); trace(count); //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.COUNT.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.COUNT.*; addChild(text); } output window 'traces to the output window correctly' //zero should read -77777 if tracing correctly 0 -77777 <SESSION> <COUNT TITLE="starting position">-77777</COUNT> </SESSION> errors coercion errors and null references with anything I attempt.

    Read the article

  • c# Deserializing an element based on it's parent node's name

    - by daveharnett
    The XML I'm working with has the following structure: <fixture_statistics> <home_player_1 id="2306143" teamid="2"> <element_1>Some Data</element_1> <element_2>Some Data</element_2> </home_player_1> <home_player_2 id="2306144" teamid="2"> <element_1>Some Data</element_1> <element_2>Some Data</element_2> </home_player_2> </fixture_statistics> Now the code to deserialize it would normally look like this: [XmlRootAttribute("fixture_statistics", Namespace = "", IsNullable = false)] public class FixtureRoot { [XmlElement("home_player_1")] [XmlElement("home_player_2")] public List<FixtureStats> fixtures { get; set; } } public class FixtureStats { public string element_1; [XMLElement("element_2")] public string elementTwo; } Here's the question: I'd like the FixtureStats class to have a 'position' property which corrosponds to it's parent's element name (so the FixtureStat object corrosponding to home_player_1 would have position=1). Can this be done with the built-in serialization atrributes? If it's not possible, what's the cleanest workaround? Bear in mind that each document will have about 50 player elements, each with about 50 'child' data elements.

    Read the article

  • Cannot find symbol - variable

    - by Ben Garside
    I'm new to Java, and I'm trying to get user input, store each line of input as a variable and then return each value so that it can be passed on somewhere else. When I try and compile it is telling me that it can't find the variable magnitude. I'm assuming it won't find the others either. I'm guessing that this is because I've declare the variables inside of the "try" but don't know how to get it so that the return statement accepts them. Code is as follows: public Earthquake userAddEarthquake() { Scanner scanner = new Scanner(System.in); try{ // convert the string read from the scanner into Integer type System.out.println("Please Enter An Earthquake Magnitude: "); Double magnitude = Double.parseDouble(scanner.nextLine()); System.out.println("Please Enter The Earthquakes Latitude Position: "); scanner = new Scanner(System.in); Double positionLatitude = Double.parseDouble(scanner.nextLine()); System.out.print("Please Enter The Earthquakes Longitude Position: "); scanner = new Scanner(System.in); Double positionLongitude = Double.parseDouble(scanner.nextLine()); System.out.print("Please Enter The Year That The Earthquake Occured: "); scanner = new Scanner(System.in); int year = Integer.parseInt(scanner.nextLine()); System.out.println("Magnitude = " + magnitude); } catch(NumberFormatException ne){ System.out.println("Invalid Input"); } finally{ scanner.close(); } return new Earthquake(magnitude, positionLatitude, positionLongitude, year); }

    Read the article

  • Are lambda expressions/delegates in C# "pure", or can they be?

    - by Bob
    I recently asked about functional programs having no side effects, and learned what this means for making parallelized tasks trivial. Specifically, that "pure" functions make this trivial as they have no side effects. I've also recently been looking into LINQ and lambda expressions as I've run across examples many times here on StackOverflow involving enumeration. That got me to wondering if parallelizing an enumeration or loop can be "easier" in C# now. Are lambda expressions "pure" enough to pull off trivial parallelizing? Maybe it depends on what you're doing with the expression, but can they be pure enough? Would something like this be theoretically possible/trivial in C#?: Break the loop into chunks Run a thread to loop through each chunk Run a function that does something with the value from the current loop position of each thread For instance, say I had a bunch of objects in a game loop (as I am developing a game and was thinking about the possibility of multiple threads) and had to do something with each of them every frame, would the above be trivial to pull off? Looking at IEnumerable it seems it only keeps track of the current position, so I'm not sure I could use the normal generic collections to break the enumeration into "chunks". Sorry about this question. I used bullets above instead of pseudo-code because I don't even know enough to write pseudo-code off the top of my head. My .NET knowledge has been purely simple business stuff and I'm new to delegates and threads, etc. I mainly want to know if the above approach is good for pursuing, and if delegates/lambdas don't have to be worried about when it comes to their parallelization.

    Read the article

  • CSS Menu disappear

    - by WtFudgE
    Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

    Read the article

  • CAScrollLayer doesn't scroll!

    - by Cliff
    Maybe it's because it's late. Whatever the reason I can't figure out why I'm having trouble with a simple CSScrollLayer example I'm trying. I add a 50 pixel Eclipse icon to a view based project and in my initialize method (called from initWithNibName:bundle:) I have this: -(void) initialize { CAScrollLayer *scrollLayer = [CAScrollLayer layer]; scrollLayer.backgroundColor = [[UIColor blackColor] CGColor]; CGRect bounds = self.view.bounds; scrollLayer.bounds = CGRectMake(0, 0, bounds.size.width, bounds.size.height); scrollLayer.contentsRect = CGRectMake(0, 0, bounds.size.width + 800, bounds.size.height + 800); scrollLayer.borderWidth = 2.5; scrollLayer.borderColor = [[UIColor redColor] CGColor]; scrollLayer.position = CGPointMake(self.view.center.x, self.view.center.y - 20); scrollLayer.scrollMode = kCAScrollBoth; [self.view.layer addSublayer:scrollLayer]; UIImage *image = [UIImage imageNamed:@"eclipse32.gif"]; for(int i=0; i<6; i++) { layer = [CALayer layer]; layer.backgroundColor = [[UIColor blackColor] CGColor]; layer.bounds = CGRectMake(0, 0, 100, 100); layer.contents = (id)[image CGImage]; layer.position = CGPointMake(layer.bounds.size.width * i, self.view.center.y); [scrollLayer addSublayer:layer]; } // [button removeFromSuperview]; // [self.view addSubview:button]; // self.view.userInteractionEnabled = YES; [image release]; } The scroll layer shows, the icon is repeated on the layer I have a border around the edge of the screen. Everything is lovely except I can't scroll the icons. I've tried with/without setting scroll mode. I've tried with a single stretched icon that falls off screen. I've tried everything. What am I doing wrong?

    Read the article

  • Efficient cron job utilizing Zend_Mail_Storage_Imap.

    - by fireeyedboy
    I'm new to the IMAP protocol and Zend_Mail_Storage and I'm writing a small php script for a cron job that should regularly poll an IMAP account and check for new messages, and send an e-mail if new messages have arrived. As you can imagine, I want to only poll the IMAP account for relevant messages, and I only want to send a new e-mail if new messages have arrived since the last polled new message. So I thought of keeping track of the last message I polled with some unique identifier for a message. But I'm a bit uncertain about whether the methods I want to utilize for this do what I expect them to do though. So my questions are: Does the iterator position of Zend_Mail_Storage_Imap actually resemble some IMAP unique identifier for messages, or is it simply only and internal position of Zend_Mail_Storage_Abstract? For instance, if I tell it to seek() to message 5 (which I stored from an earlier session) will it indeed seek to the appropriate message on the IMAP server, even if for instance messages have been deleted since last session? Would keeping track of this latest polled message id in a file suffice for a cron job that, say, polls the account every 5 or 10 minutes? Or is this too naive, and should I be using a database for instance. Or is there maybe a much easier way to keep track of such state with Zend_Mail_Storage_Abstract? Also, do I need to poll every IMAP folder? Or is everything accumulated when I poll INBOX? If you could shed some light on any of these matters, I'ld appreciate it. Thanks in advance.

    Read the article

  • iPhone multitouch - Some touches dispatch touchesBegan: but not touchesMoved:

    - by zkarcher
    I'm developing a multitouch application. One touch is expected to move, and I need to track its position. For all other touches, I need to track their beginnings and endings, but their movement is less critical. Sometimes, when 3 or more touches are active, my UIView does not receive touchesMoved: events for the moving touch. This problem is intermittent, and can always be reproduced after a few attempts: Touch the screen with 2 fingers. Touch the screen with another finger, and move this finger around. The moving finger always dispatches touchesBegan: and touchesEnded:, but sometimes does not dispatch any touchesMoved: events. Whenever the moving touch does not dispatch touchesMoved: events, I can force it to dispatch touchesMoved: if I move one of the other touches. This seems to "force" every touch to recheck its position, and I successfully receive a touchesMoved: event. However, this is clumsy. This bug is reproducible on both the iPhone 2G and 3GS models. My question is: How do I ensure that my moving touch dispatches touchesMoved: events? Does anyone have any experience with this issue? I've spent few fruitless days searching the web for answers. I found a post describing how to sync touch events with the VBL: http://www.71squared.com/2009/04/maingameloop-changes/ . However, this has not solved the problem. I really don't know how to proceed. Any help is appreciated!

    Read the article

< Previous Page | 205 206 207 208 209 210 211 212 213 214 215 216  | Next Page >