Search Results

Search found 6399 results on 256 pages for 'record'.

Page 211/256 | < Previous Page | 207 208 209 210 211 212 213 214 215 216 217 218  | Next Page >

• How to import data to SAP

  - by Mehmet AVSAR

  Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

  Read the article

• Passing a LINQ DataRow Reference in a GridView's ItemTemplate

  - by Bob Kaufman

  Given the following GridView: <asp:GridView runat="server" ID="GridView1" AutoGenerateColumns="false" DataKeyNames="UniqueID" OnSelectedIndexChanging="GridView1_SelectedIndexChanging" > <Columns> <asp:BoundField HeaderText="Remarks" DataField="Remarks" /> <asp:TemplateField HeaderText="Listing"> <ItemTemplate> <%# ShowListingTitle( ( ( System.Data.DataRowView ) ( Container.DataItem ) ).Row ) %> </ItemTemplate> </asp:TemplateField> <asp:BoundField HeaderText="Amount" DataField="Amount" DataFormatString="{0:C}" /> </Columns> </asp:GridView> which refers to the following code-behind method: protected String ShowListingTitle( DataRow row ) { Listing listing = ( Listing ) row; return NicelyFormattedString( listing.field1, listing.field2, ... ); } The cast from DataRow to Listing is failing (cannot convert from DataRow to Listing) I'm certain the problem lies in what I'm passing from within the ItemTemplate, which is simply not the right reference to the current record from the LINQ to SQL data set that I've created, which looks like this: private void PopulateGrid() { using ( MyDataContext context = new MyDataContext() ) { IQueryable < Listing > listings = from l in context.Listings where l.AccountID == myAccountID select l; GridView1.DataSource = listings; GridView1.DataBind(); } }

  Read the article

• Selenium onChange not working

  - by tohop

  Hi, I have tried a number of things to try and get Selenium to pick up an 'onchange' event from a drop down menu, none of which has worked. The offending HTML is: <select onchange="doOpperation(this.options[this.selectedIndex]); this.selectedIndex = 0;" name="opps_ondemand" id="opps_ondemand"> <option value="none" id="ondemand">Mark as...</option> <option cmd="blah1" value="add">Something</option> <option cmd="blah2" value="remove">None</option> </select> I have read that Selenium IDE doesn't record some on* events, and so it would be wise to use fireEvent(): $this->click("opps_ondemand"); $this->select("opps_ondemand", "label=Mark as..."); $this->click("//option[@value='add']"); sleep(3); $this->fireEvent("//select[@id='opps_ondemand']", "change"); However, this does not work (with or without the fireEvent). I have also tried using $this->fireEvent("locator", "click"); instead of $this->click("locator"); but this did nothing. Selenium does not complain about these locators not existing so I am assuming it can see the select/option elements fine. The problem seems to be the onChange event. Does anyone know how to resolve this? Thanks.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• symfony get data from array

  - by iggnition

  Hi, I'm trying to use an SQL query to get data from my database into the template of a symfony project. my query: SQL: SELECT l.loc_id AS l__loc_id, l.naam AS l__naam, l.straat AS l__straat, l.huisnummer AS l__huisnummer, l.plaats AS l__plaats, l.postcode AS l__postcode, l.telefoon AS l__telefoon, l.opmerking AS l__opmerking, o.org_id AS o__org_id, o.naam AS o__naam FROM locatie l LEFT JOIN organisatie o ON l.org_id = o.org_id This is generated by this DQL: DQL: $this->q = Doctrine_Query::create() ->select('l.naam, o.naam, l.straat, l.huisnummer, l.plaats, l.postcode, l.telefoon, l.opmerking') ->from('Locatie l') ->leftJoin('l.Organisatie o') ->execute(); But now when i try to acces this data in the template by either doing: <?php foreach ($q as $locatie): ?> <?php echo $locatie['o.naam'] ?> or <?php foreach ($q as $locatie): ?> <?php echo $locatie['o__naam'] ?> i get the error from symfony: 500 | Internal Server Error | Doctrine_Record_UnknownPropertyException Unknown record property / related component "o__naam" on "Locatie" Does anyone know what is going wrong here? i dont know how to call the value from the array if the names in both query's dont work.

  Read the article

• SharePoint 2007 and SiteMinder

  - by pborovik

  Here is a question regarding some details how SiteMinder secures access to the SharePoint 2007. I've read a bunch of materials regarding this and have some picture for SharePoint 2010 FBA claims-based + SiteMinder security (can be wrong here, of course): SiteMinder is registered as a trusted identity provider for the SharePoint; It means (to my mind) that SharePoint has no need to go into all those user directories like AD, RDBMS or whatever to create a record for user being granted access to SharePoint - instead it consumes a claims-based id supplied by SiteMinder SiteMinder checks all requests to SharePoint resources and starts login sequence via SiteMinder if does not find required headers in the request (SMSESSION, etc.) SiteMinder creates a GenericIdentity with the user login name if headers are OK, so SharePoint recognizes the user as authenticated But in the case of SharePoint 2007 with FBA + SiteMinder, I cannot find an answer for questions like: Does SharePoint need to go to all those user directories like AD to know something about users (as SiteMinder is not in charge of providing user info like claims-based ids)? So, SharePoint admin should configure SharePoint FBA to talk to these sources? Let's say I'm talking to a Web Service of SharePoint protected by SiteMinder. Shall I make a Authentication.asmx-Login call to create a authentication ticket or this schema is somehow changed by the SiteMinder? If such call is needed, do I also need a SiteMinder authentication sequence? What prevents me from rewriting request headers (say, manually in Fiddler) before posting request to the SharePoint protected by SiteMinder to override its defence? Pity, but I do not have access to deployed SiteMinder + SharePoint, so need to investigate some question blindly. Thanks.

  Read the article

• How do I pass arguments to pages in a WPF application?

  - by Rod

  I'm working on upgrading a really old VB6 app to a WPF application. This will be a page-based app, but not a XBAP. The old VB6 app had a start form where a user would enter search criteria. Then they would get results in a grid, select a row in the grid and then click on one of 3 buttons. I am thinking that what I'll do is use hyperlink controls on the WPF app. No matter what button the user clicked on the old VB6 app, it would go to a second form. What it did on the second form was dependent upon which button the user clicked on the first form. So, I want the first page in my WPF app to do the same thing, but depending upon which hyperlink they click on will dictate what happens on the second page. They will either (a) go to the second page to edit the details as well as a lot more information, related to what they selected on the first page, or (b) enter a new record and all associated data (a new client, in this case), or (c) create a new case for the same client, selected on the first page. For me the hard thing is I don't know how to pass that information along to the second page. Is there something in WPF like in HTML where there's a query string? Or how do you get information from the first page to the second page, in WPF? I'm working in VS 2008.

  Read the article

• SQL (mySQL) update some value in all records processed by a select

  - by jdmuys

  I am using mySQL from their C API, but that shouldn't be relevant. My code must process records from a table that match some criteria, and then update the said records to flag them as processed. The lines in the table are modified/inserted/deleted by another process I don't control. I am afraid in the following, the UPDATE might flag some records erroneously since the set of records matching might have changed between step 1 and step 3. SELECT * FROM myTable WHERE <CONDITION>; # step 1 <iterate over the selected set of lines. This may take some time.> # step 2 UPDATE myTable SET processed=1 WHERE <CONDITION> # step 3 What's the smart way to ensure that the UPDATE updates all the lines processed, and only them? A transaction doesn't seem to fit the bill as it doesn't provide isolation of that sort: a recently modified record not in the originally selected set might still be targeted by the UPDATE statement. For the same reason, SELECT ... FOR UPDATE doesn't seem to help, though it sounds promising :-) The only way I can see is to use a temporary table to memorize the set of rows to be processed, doing something like: CREATE TEMPORARY TABLE workOrder (jobId INT(11)); INSERT INTO workOrder SELECT myID as jobId FROM myTable WHERE <CONDITION>; SELECT * FROM myTable WHERE myID IN (SELECT * FROM workOrder); <iterate over the selected set of lines. This may take some time.> UPDATE myTable SET processed=1 WHERE myID IN (SELECT * FROM workOrder); DROP TABLE workOrder; But this seems wasteful and not very efficient. Is there anything smarter? Many thanks from a SQL newbie.

  Read the article

• Initialization of controllers in a for loop - leaking problem ?

  - by gotye

  Hey, I am creating a kinda gallery and for each gallery I created a view controller whose view is added to a scrollview (see code below) : GalleryViewController *galViewController; for (NSUInteger i = 0 ; i < [galleries count]; i++) { galViewController = [[GalleryViewController alloc] init]; galViewController.record = [galleries objectAtIndex:i]; //galViewController.position = i; galViewController.view.frame = CGRectMake(i%3*100,i/3*150,100,150); [galViewController setDelegate:self]; [self.scrollView addSubview:galViewController.view]; //[galViewController release]; } Is this code leaking ? I think so ... but the thing is that I don't know what to do with these controllers ... i can't release them (cause I got some code to use in the future like touches event) and I don't need to save them somewhere ... Is this a problem to have this kind of code ? Thks, Gotye

  Read the article

• Authlogic Current User Question - hiding admin links...

  - by bgadoci

  I think I am missing something while using the Authlogic gem w/ Rails. To set the stage I have multiple users and each user can create posts and comments. Upon the display of a post or comment I would like to give the user who created them the option to edit or destroy. I am successfully using the following code to hide and show elements based on if a user is logged in or not but can't seem to find out how to only show these links to the actual user who created them...not any user that is logged in. <% if current_user %> <%= link_to 'Edit', edit_question_path(question) %> | <%= link_to 'Destroy', question, :confirm => 'Are you sure?', :method => :delete %> <% else %> <p>nothing to see here</p> <% end %> Here is the def of current_user located in the application controller in case I need to change something here. class ApplicationController < ActionController::Base helper :all # include all helpers, all the time protect_from_forgery # See ActionController::RequestForgeryProtection for details# helper_method :current_user private def current_user_session return @current_user_session if defined?(@current_user_session) @current_user_session = UserSession.find end def current_user return @current_user if defined?(@current_user) @current_user = current_user_session && current_user_session.record end end

  Read the article

• delayed evaluation of code in subroutines - 5.8 vs. 5.10 and 5.12

  - by Brock

  This bit of code behaves differently under perl 5.8 than it does under perl 5.12: my $badcode = sub { 1 / 0 }; print "Made it past the bad code.\n"; [brock@chase tmp]$ /usr/bin/perl -v This is perl, v5.8.8 built for i486-linux-gnu-thread-multi [brock@chase tmp]$ /usr/bin/perl badcode.pl Illegal division by zero at badcode.pl line 1. [brock@chase tmp]$ /usr/local/bin/perl -v This is perl 5, version 12, subversion 0 (v5.12.0) built for i686-linux [brock@chase tmp]$ /usr/local/bin/perl badcode.pl Made it past the bad code. Under perl 5.10.1, it behaves as it does under 5.12: brock@laptop:/var/tmp$ perl -v This is perl, v5.10.1 (*) built for i486-linux-gnu-thread-multi brock@laptop:/var/tmp$ perl badcode.pl Made it past the bad code. I get the same results with a named subroutine, e.g. sub badcode { 1 / 0 } I don't see anything about this in the perl5100delta pod. Is this an undocumented change? A unintended side effect of some other change? (For the record, I think 5.10 and 5.12 are doing the Right Thing.)

  Read the article

• when does factory girl create objects in db?

  - by Pavel K.

  i am trying to simulate a session using factory girl/shoulda (it worked with fixtures but i am having problems with using factories). i have following factories (user login and email both have 'unique' validations): Factory.define :user do |u| u.login 'quentin' u.email '[email protected]' end Factory.define :session_user, :class => Session do |u| u.association :user, :factory => :user u.session_id 'session_user' end and here's the test class MessagesControllerTest < ActionController::TestCase context "normal user" do setup do @request.session[:user_id]=Factory(:user).id @request.session[:session_id]=Factory(:session_user).session_id end should "be able to access new message creation" do get :new assert_response :success end end end but when i run "rake test:functionals", i get this test result 1) Error: test: normal user should be able to access new message creation. (MessagesControllerTest): ActiveRecord::RecordInvalid: Validation failed: Account name already exists!, Email already exists! which means that record already exists in db when i am referring to it in test setup. is there something i don't understand here? does factory girl create all factories in db on startup? rails 2.3.5/shoulda/factory girl

  Read the article

• LPX-00607 for ora:contains in java but not sqlplus

  - by Windle

  Hey all, I am trying to doing some sql querys out of Oracle 11g and am having issues using ora:contains. I am using spring's jdbc impl and my code generates the sql statement: select * from view_name where column_a = ? and column_b = ? and existsNode(xmltype(clob_column), 'record/name [ora:contains(text(), "name1") 0]', 'xmlns:ora="http://xmlns.oralce.com/xdb"') = 1 I have removed the actual view / column names obviously, but when I copy that into sqlplus and substitute in random values, the select executes properly. When I try to run it in my DAO code I get this stack trace: org.springframework.jdbc.UncatergorizedSQLException: PreparedStatementCallback; uncatergorizedSQLException for SQL [the big select above]; SQL state [99999]; error code [31011]; ORA-31011: XML parsing failed. ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' ;nested exception is java.sql.SQLException: ORA-31011: XML parsing failed ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' (continues on like this for awhile....) I think it is worth mentioning that I am using maven and it is possible I am missing some dependency that is required for this. Sorry the post is so long, but I wanted to err on the side of too much info. Thanks for taking the time to read this at least =) -Windle

  Read the article

• Cross domain login - what to store in the database?

  - by Jenkz

  I'm working on a system which will allow me to login to the same system via various domains. (www.example.com, www.mydomain.com, sub.domain.com etc) The following threads form the basis of my research so far: Single Sign On across multiple domains Cross web domain login with .net membership What I want to happen is that If I am logged in on the master domain and I visit a page on a client domain to be automatically logged in on the client. Obviously If I am not logged in on the master, I will need to enter my username and password. Walkthrough: 1. User logs in on master site 2. User navigates to client site 3. Client site re-directs to master site to see if User is logged in. 4. If User is logged in on master, record a RFC 4122 token ID and send this back to the client site. 5. Client site then looks up the token ID in the central database and logs this user in. This might eventually end up running on more than once instance of PHP and Apache, so I can't just store: token_id, php_session_id, created Is there any problem with me storing and using this: token_id, username, hashed_password, created Which is deleted on use, or automatically after x seconds.

  Read the article

• Newbie database index question

  - by RenderIn

  I have a table with multiple indexes, several of which duplicate the same columns: Index 1 columns: X, B, C, D Index 2 columns: Y, B, C, D Index 3 columns: Z, B, C, D I'm not very knowledgeable on indexing in practice, so I'm wondering if somebody can explain why X, Y and Z were paired with these same columns. B is an effective date. C is a semi-unique key ID for this table for a specific effective date B. D is a sequence that identifies the priority of this record for the identifier C. Why not just create 6 indexes, one for each X, Y, Z, B, C, D? I want to add an index to another column T, but in some contexts I'll only be querying on T alone while in others I will also be specifying the B, C and D columns... so should I create just one index like above or should I create one for T and one for (T, B, C, D)? I've not had as much luck as expected when googling for comprehensive coverage of indexing. Any resources where I can get a through explanation and lots of examples of B-tree indexing?

  Read the article

• Program Structure Design Tools? (Top Down Design)

  - by Lee Olayvar

  I have been looking to expand my methodologies to better involve Unit testing, and i stumbled upon Behavioral Driven Design (Namely Cucumber, and a few others). I am quite intrigued by the concept as i have never been able to properly design top down, only because keeping track of the design gets lost without a decent way to record it. So on that note, in a mostly language agnostic way, are there any useful tools out there i am (probably) unaware of? Eg, i have often been tempted to try building flow charts for my programs, but i am not sure how much that will help, and it seems a bit confusing to me how i could make a complex enough flow chart to handle the logic of a full program, and all its features.. ie, it just seems like flow charts would be limiting in the design scheme.. or possibly grow to an unmaintainable scale. BDD methods are nice, but with a system that is so tied to structure, tying into the language and unit testing seems like a must (for it to be worth it) and it seems to be hard to find something to work well with both Python and Java (my two main languages). So anyway.. on that note, any comments are much appreciated. I have searched around on here and it seems like top down design is a well discussed topic, but i haven't seen too much reference to tools themselves, eg, flow chart programs, etc. I am on Linux, if it matters (in the case of programs).

  Read the article

• number of args for stored procedure PLS00306

  - by Peter Kaleta

  Hi I have problem with calling for my procedure.Oracle scrams pls00306 Error: Wrong number of types of arguments in call to procedure. With my type declaration procedure has exact the same declaration like in header below. If I run it as separate prcedure it works , when i work in ODCI interface for exensible index creation , it throws pls 00306. MEMBER PROCEDURE FILL_TREE_LVL(target_column VARCHAR2, cur_lvl NUMBER, max_lvl NUMBER, parent_rect NUMBER,start_x NUMBER, start_y NUMBER,end_x NUMBER, end_y NUMBER) IS stmt VARCHAR2(2000); rect_id NUMBER; diff_x NUMBER; diff_y NUMBER; new_start_x NUMBER; new_end_x NUMBER; i NUMBER; j NUMBER; BEGIN {...} END FILL_TREE_LVL; STATIC FUNCTION ODCIINDEXCREATE (ia SYS.ODCIINDEXINFO, parms VARCHAR2, env SYS.ODCIEnv) RETURN NUMBER IS stmt VARCHAR2(2000); stmt2 VARCHAR2(2000); min_x NUMBER; max_x NUMBER; min_y NUMBER; max_y NUMBER; lvl NUMBER; rect_id NUMBER; pt_tab VARCHAR2(50); rect_tab VARCHAR2(50); cnum NUMBER; TYPE point_rect is RECORD( point_id NUMBER, rect_id NUMBER ); TYPE point_rect_tab IS TABLE OF point_rect; pr_table point_rect_tab; BEGIN {...} FILL_TREE_LVL('any string',0,lvl,min_x,min_y,max_x, max_y); {...} END;

  Read the article

• How to delete duplicate records in MySQL by retaining those fields with data in the duplicate item b

  - by NJTechGuy

  I have few thousands of records with few 100 fields in a MySQL Table. Some records are duplicates and are marked as such. Now while I can simply delete the dupes, I want to retain any other possible valuable non-null data which is not present in the original version of the record. Hope I made sense. For instance : a b c d e f key dupe -------------------- 1 d c f k l 1 x 2 g h j 1 3 i h u u 2 4 u r t 2 x From the above sample table, the desired output is : a b c d e f key dupe -------------------- 2 g c h k j 1 3 i r h u u 2 If you look at it closely, the duplicate is determined by using the key (it is the same for 2 records, so the one that has an 'x' for dupe field is the one to be deleted by retaining some of the fields from the dupe (like c, e values for key 1). Please let me know if you need more info about this puzzling problem. Thanks a tonne! p.s : If it is not possible using MySQL, a PERL/Python script sample would be awesome! Thanks!

  Read the article

• How to stop MVC caching the results of invoking and action method?

  - by Trey Carroll

  I am experiencing a problem with IE caching the results of an action method. Other articles I found were related to security and the [Authorize] attribute. This problem has nothing to do with security. This is a very simple "record a vote, grab the average, return the avg and the number of votes" method. The only slightly interesting thing about it is that it is invoked via Ajax and returns a Json object. I believe that it is the Json object that is getting catched. When I run it from FireFox and watch the XHR traffic with Firebug, everything works perfectly. However, under IE 8 the "throbber" graphic doesn't ever have time to show up and the page elements that display the "new" avg and count that are being injected into the page with jQuery are never different. I need a way to tell MVC to never cache this action method. This article seems to address the problem, but I cannot understand it: http://stackoverflow.com/questions/1441467/prevent-caching-of-attributes-in-asp-net-mvc-force-attribute-execution-every-tim I need a bit more context for the solution to understand how to extend AuthorizationAttribute. Please address your answer as if you were speaking to someone who lacks a deep understanding of MVC even if that means replying with an article on some basics/prerequisites that are required. Thanks, Trey Carroll

  Read the article

• DataBinding the AJAX Control Toolkit's Rating Control

  - by Nevada

  I'm attempting to use the AJAX Control Toolkit's Rating control in a DataBinding scenario. I have a ReuseRating column in my database that is a tinyint. It can hold values 1 through 5. Every record in the table has the value set to 1 currently. If I do this in my ItemTemplate everything works fine. I get 1 star filled in on my rating control. <act:Rating ID="ReuseRatingRating" runat="server" CurrentRating='<%# Convert.ToInt16(Eval("ReuseRating")) %>' MaxRating="5" StarCssClass="ratingStar" WaitingStarCssClass="savedRatingStar" FilledStarCssClass="filledRatingStar" EmptyStarCssClass="emptyRatingStar" /> Now I want to DataBind this in my EditTemplate like so. <act:Rating ID="ReuseRatingRating" runat="server" CurrentRating='<%# Convert.ToInt16(Bind("ReuseRating")) %>' MaxRating="5" StarCssClass="ratingStar" WaitingStarCssClass="savedRatingStar" FilledStarCssClass="filledRatingStar" EmptyStarCssClass="emptyRatingStar" /> Note, that I changed my Eval to a Bind in the CurrentRating property. This throws the following error. CS0103: The name 'Bind' does not exist in the current context Can anyone help me out on this one? I've been knocking my head against the wall for a couple of hours now.

  Read the article

• Dynamic Google Maps API InfoWindow HTML Content

  - by Peter Hanneman

  I am working in Flash Builder 4 with Google Map's ActionScript API. I have created a map, loaded some custom markers onto it and added some MouseEvent listeners to each marker. The trouble comes when I load an InfoWindow panel. I want to dynamically set the htmlContent based off of information stored in a database. The trouble is that this information can change every couple of seconds and each marker has a unique data set so I can not statically set it at the time I actually create the markers. I have a method that will every minute or so load all of the records from my database into an Object variable. Everything I need to display in the htmlContent is contained in this object under a unique identifier. The basic crux of the problem is that there is no way for me to uniquely identify an info window, so I can not determine what information to pull into the panel. marker.addEventListener(MapMouseEvent.ROLL_OVER, function(e:MapMouseEvent):void { showInfoWindow(e.latLng) }, false, 0, false); That is my mouse event listener. The function I call, "showInfowindow" looks like this: private function showInfoWindow(latlng:LatLng):void { var options:InfoWindowOptions = new InfoWindowOptions({title: appData[*I NEED A UNIQUE ID HERE!!!*].type + " Summary", contentHTML: appData[*I NEED A UNIQUE ID HERE!!!*].info}); this.map.openInfoWindow(latlng, options); } I thought I was onto something by being able to pass a variable in my event listener declaration, but it simply hates having a dynamic variable passed through, it only returns the last value use. Example: marker.addEventListener(MapMouseEvent.ROLL_OVER, function(e:MapMouseEvent):void { showInfoWindow(e.latLng, record.unit_id) }, false, 0, false); That solution is painfully close to working. I iterate through a loop to create my markers when I try the above solution and roll over a marker I get information, but every marker's information reflects whatever information the last marker created had. I apologize for the long explaination but I just wanted to make my question as clear as possible. Does anyone have any ideas about how to patch up my almost-there-solution that I posted at the bottom or any from the ground up solutions? Thanks in advance, Peter Hanneman

  Read the article

• Parsing large delimited files with dynamic number of columns

  - by annelie

  Hi, What would be the best approach to parse a delimited file when the columns are unknown before parsing the file? The file format is Rightmove v3 (.blm), the structure looks like this: #HEADER# Version : 3 EOF : '^' EOR : '~' #DEFINITION# AGENT_REF^ADDRESS_1^POSTCODE1^MEDIA_IMAGE_00~ // can be any number of columns #DATA# agent1^the address^the postcode^an image~ agent2^the address^the postcode^^~ // the records have to have the same number of columns as specified in the definition, however they can be empty etc #END# The files can potentially be very large, the example file I have is 40Mb but they could be several hundred megabytes. Below is the code I had started on before I realised the columns were dynamic, I'm opening a filestream as I read that was the best way to handle large files. I'm not sure my idea of putting every record in a list then processing is any good though, don't know if that will work with such large files. List<string> recordList = new List<string>(); try { using (FileStream fs = new FileStream(path, FileMode.Open, FileAccess.Read)) { StreamReader file = new StreamReader(fs); string line; while ((line = file.ReadLine()) != null) { string[] records = line.Split('~'); foreach (string item in records) { if (item != String.Empty) { recordList.Add(item); } } } } } catch (FileNotFoundException ex) { Console.WriteLine(ex.Message); } foreach (string r in recordList) { Property property = new Property(); string[] fields = r.Split('^'); // can't do this as I don't know which field is the post code property.PostCode = fields[2]; // etc propertyList.Add(property); } Any ideas of how to do this better? It's C# 3.0 and .Net 3.5 if that helps. Thanks, Annelie

  Read the article

• Jquery: Create hidden attributes? I need to reduce tag bulkyness.

  - by Dan

  I'm sure we've all done this before: <a id="232" rel="link_to_user" name="user_details" class="list hoverable clickable selectable"> USER #232 </a> But then we say, oh my, I need more ways to store tracking info about this div! <a id="232-343-22" rel="link_to_user:fotomeshed" name="user_details" class="groupcolor-45 elements-698 list hoverable clickable selectable"> User: John Doe </a> And the sickness keeps growing. We just keep on packing it inside that poor little element and it's attributes. All so we can keep track of who it is. So with my limited knowledge of JS, someone please tell me how to do something like this: <a id="33">USER #33</a> $(#33).attr({title:'User Record','username':'john', 'group_color':'green', 'element_num':78}); So here we just added what I would call invisible attributes, because we just played God and made those attributes up on the fly like it was no problem. The cool part is that these would be kept in their own little object somewhere in variable land. NOT in the tag itself. Then later on, in a code nested far far away, be able to say, oh, i wonder what group_color John is... user_group_color = $(table).find(a['username':'john']).attr('group_color'); THEN BAM!!!! POW!!!! alert(user_group_color + " is a bitchin color!"); You get to know his group color... all without adding a bunch of bloated element tracking nonsense into our tags. So does this sort of thing exist? If not, how do I make it?

  Read the article

• php get, random records, and the back button

  - by Andrew Heath

  My site has a library full of games, nations, game scenarios, etc. library.php is given a type=___ & id=___ for example library.php?type=scenario&id=ABCD001 library.php saves the id to a session variable and loads an include appropriate for the type This all works just dandy. Now, I wanted to give my users the option of pulling up a random scenario. To do that, I added a special id to the logic within lib-scenario.php (the include) such that if given library.php?type=scenario&id=random the include knows to run an alternate query for a random record rather than for the actual id This also works just dandy... unless someone hits the Random Scenario button two+ times in a row, and decides that the previous random scenario was way cooler, I want to go back to that. Because the http address is always directory/library.php?type=scenario&id=random no matter how many times you click Random Scenario, as soon as you click back you'll be taken to the last page with an alternate address you visited. So, if you start at the Home page, and hit Random Scenario 35 times, then decide the 34th one was what you wanted and click BACK, you'll be put back onto the Home page. I must admit this was not a problem I had anticipated. One of my testers was the first to have the urge to back-up in the random scenario stream and here we are. How can I add back-up functionality to my script?

  Read the article

• AVAudioPlayer working in Simulator, but not on device

  - by cannyboy

  My mp3 playing code is: NSError *error; soundObject = [[AVAudioPlayer alloc] initWithContentsOfURL:[NSURL fileURLWithPath:audioPathString] error:&error]; if (soundObject == nil) NSLog(@"%@", [error description]); soundObject.delegate = self; soundObject.numberOfLoops = 0; soundObject.volume = 1.0; NSLog(@"about to play"); [soundObject prepareToPlay]; [soundObject play]; NSLog(@"[soundObject play];"); The mp3 used to play fine, and it still does on the simulator. But not on the device. I've recently added some sound recording code (not mine) to the software. It uses AudioQueue stuff which is slightly beyond me. Does that conflict with AVAudioPlayer? Or what could be the problem? I've noticed that as soon as the audiorecording code starts working, I can't adjust the volume on the device anymore, so maybe it blocks the audio playback?. EDIT The solution seems to be to put this in my code. I put it in applicationDidFinishLaunching: [[AVAudioSession sharedInstance] setCategory: AVAudioSessionCategoryPlayAndRecord error: nil]; UInt32 audioRouteOverride = kAudioSessionOverrideAudioRoute_Speaker; AudioSessionSetProperty (kAudioSessionProperty_OverrideAudioRoute,sizeof (audioRouteOverride),&audioRouteOverride); The first line allows both play and record, whilst the other lines apparently reroute things to make the volume louder. All audio code is voodoo to me.

  Read the article

< Previous Page | 207 208 209 210 211 212 213 214 215 216 217 218  | Next Page >