Search Results

Search found 5784 results on 232 pages for 'points'.

Page 213/232 | < Previous Page | 209 210 211 212 213 214 215 216 217 218 219 220  | Next Page >

• Optimizing Vector elements swaps using CUDA

  - by Orion Nebula

  Hi all, Since I am new to cuda .. I need your kind help I have this long vector, for each group of 24 elements, I need to do the following: for the first 12 elements, the even numbered elements are multiplied by -1, for the second 12 elements, the odd numbered elements are multiplied by -1 then the following swap takes place: Graph: because I don't yet have enough points, I couldn't post the image so here it is: http://www.freeimagehosting.net/image.php?e4b88fb666.png I have written this piece of code, and wonder if you could help me further optimize it to solve for divergence or bank conflicts .. //subvector is a multiple of 24, Mds and Nds are shared memory _shared_ double Mds[subVector]; _shared_ double Nds[subVector]; int tx = threadIdx.x; int tx_mod = tx ^ 0x0001; int basex = __umul24(blockDim.x, blockIdx.x); Mds[tx] = M.elements[basex + tx]; __syncthreads(); // flip the signs if (tx < (tx/24)*24 + 12) { //if < 12 and even if ((tx & 0x0001)==0) Mds[tx] = -Mds[tx]; } else if (tx < (tx/24)*24 + 24) { //if >12 and < 24 and odd if ((tx & 0x0001)==1) Mds[tx] = -Mds[tx]; } __syncthreads(); if (tx < (tx/24)*24 + 6) { //for the first 6 elements .. swap with last six in the 24elements group (see graph) Nds[tx] = Mds[tx_mod + 18]; Mds [tx_mod + 18] = Mds [tx]; Mds[tx] = Nds[tx]; } else if (tx < (tx/24)*24 + 12) { // for the second 6 elements .. swp with next adjacent group (see graph) Nds[tx] = Mds[tx_mod + 6]; Mds [tx_mod + 6] = Mds [tx]; Mds[tx] = Nds[tx]; } __syncthreads(); Thanks in advance ..

  Read the article

• Basic Custom String Class for C++

  - by wdow88

  Hey all, I'm working on building my own string class with very basic functionality. I am having difficulty understand what is going on with the basic class that I have define, and believe there is some sort of error dealing with the scope occurring. When I try to view the objects I created, all the fields are described as (obviously bad pointer). Also, if I make the data fields public or build an accessor method, the program crashes. For some reason the pointer for the object is 0xccccccccc which points to no where. How can a I fix this? Any help/comments are much appreciated. //This is a custom string class, so far the only functions are //constructing and appending #include<iostream> using namespace std; class MyString1 { public: MyString1() { //no arg constructor char *string; string = new char[0]; string[0] ='\0'; std::cout << string; size = 1; } //constructor receives pointer to character array MyString1(char* chars) { int index = 0; //Determine the length of the array while (chars[index] != NULL) index++; //Allocate dynamic memory on the heap char *string; string = new char[index+1]; //Copy the contents of the array pointed by chars into string, the char array of the object for (int ii = 0; ii < index; ii++) string[ii] = chars[ii]; string[index+1] = '\0'; size = index+1; } MyString1 append(MyString1 s) { //determine new size of the appended array and allocate memory int newsize = s.size + size; MyString1 MyString2; char *newstring; newstring = new char[newsize+1]; int index = 0; //load the first string into the array while (string[index] != NULL) { newstring[index] = string[index]; index++; } //load the second string while (s.string[index] != NULL) { newstring[index] = s.string[index]; index++; } //null terminate newstring[newsize+1] = '\0'; delete string; //generate the object for return MyString2.string=newstring; MyString2.size=newsize; return MyString2; } private: char *string; int size; }; int main() { MyString1 string1; MyString1 string2("Hello There"); MyString1 string3("Buddy"); string2.append(string3); return 0; }

  Read the article

• Changing Data in ListView

  - by legr3c

  Hi In my app I use a ListView to display data from the database. The data changes sometimes, for example when the user applies new filters or changes the sorting method. I use AsyncTask to get the databsase cursor that points to the new data set because sometimes data needs to be loaded from the net which can take some time. What I do now looks something like this: private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); mCursorAdapter = new MyCustomCursorAdapter(MyActivity.this, mCursor); mListView.setAdapter(mCursorAdapter); } } } This works so far but I realize that creating a new CursorAdapter and calling setAdapter on my ListView each time isn't the correct way to do it. Also, after setAdapter the scroll position of the list is set back to the top. I found this post which describes how to do it properly. So now I want to do something like this: onCreate(){ // ... // create the CursorAdapter using null as the initial cursor MyCustomCursorAdapter cursorAdapter = new MyCustomCursorAdapter(this, null); mListView.setAdapter(cursorAdapter); // ... } private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ // this returns null! MyCustomCursorAdapter cursorAdapter = (MyCustomCursorAdapter)mListView.getAdapter(); Cursor oldCursor = cursorAdapter.getCursor(); if(oldCursor!=null){ MyActivity.this.stopManagingCursor(oldCursor); oldCursor.close(); } if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); cursorAdapter.changeCursor(mCursor); } } } This however doesn't work for me because (MyCustomCursorAdapter)mListView.getAdapter(); always returns null. Why does this happen? What am I doing wrong? Edit: Some additional information: my adapter implements SectionIndexer. I don't really think that this has anything to do with my problem but it has caused me some troubles before so I thought I'd mention it.

  Read the article

• Multi-threaded Pooled Allocators

  - by Darren Engwirda

  I'm having some issues using pooled memory allocators for std::list objects in a multi-threaded application. The part of the code I'm concerned with runs each thread function in isolation (i.e. there is no communication or synchronization between threads) and therefore I'd like to setup separate memory pools for each thread, where each pool is not thread-safe (and hence fast). I've tried using a shared thread-safe singleton memory pool and found the performance to be poor, as expected. This is a heavily simplified version of the type of thing I'm trying to do. A lot has been included in a pseudo-code kind of way, sorry if it's confusing. /* The thread functor - one instance of MAKE_QUADTREE created for each thread */ class make_quadtree { private: /* A non-thread-safe memory pool for int linked list items, let's say that it's * something along the lines of BOOST::OBJECT_POOL */ pooled_allocator<int> item_pool; /* The problem! - a local class that would be constructed within each std::list as the * allocator but really just delegates to ITEM_POOL */ class local_alloc { public : //!! I understand that I can't access ITEM_POOL from within a nested class like //!! this, that's really my question - can I get something along these lines to //!! work?? pointer allocate (size_t n) { return ( item_pool.allocate(n) ); } }; public : make_quadtree (): item_pool() // only construct 1 instance of ITEM_POOL per // MAKE_QUADTREE object { /* The kind of data structures - vectors of linked lists * The idea is that all of the linked lists should share a local pooled allocator */ std::vector<std::list<int, local_alloc>> lists; /* The actual operations - too complicated to show, but in general: * * - The vector LISTS is grown as a quadtree is built, it's size is the number of * quadtree "boxes" * * - Each element of LISTS (each linked list) represents the ID's of items * contained within each quadtree box (say they're xy points), as the quadtree * is grown a lot of ID pop/push-ing between lists occurs, hence the memory pool * is important for performance */ } }; So really my problem is that I'd like to have one memory pool instance per thread functor instance, but within each thread functor share the pool between multiple std::list objects.

  Read the article

• Migrating from hand-written persistence layer to ORM

  - by Sergey Mikhanov

  Hi community, We are currently evaluating options for migrating from hand-written persistence layer to ORM. We have a bunch of legacy persistent objects (~200), that implement simple interface like this: interface JDBC { public long getId(); public void setId(long id); public void retrieve(); public void setDataSource(DataSource ds); } When retrieve() is called, object populates itself by issuing handwritten SQL queries to the connection provided using the ID it received in the setter (this usually is the only parameter to the query). It manages its statements, result sets, etc itself. Some of the objects have special flavors of retrive() method, like retrieveByName(), in this case a different SQL is issued. Queries could be quite complex, we often join several tables to populate the sets representing relations to other objects, sometimes join queries are issued on-demand in the specific getter (lazy loading). So basically, we have implemented most of the ORM's functionality manually. The reason for that was performance. We have very strong requirements for speed, and back in 2005 (when this code was written) performance tests has shown that none of mainstream ORMs were that fast as hand-written SQL. The problems we are facing now that make us think of ORM are: Most of the paths in this code are well-tested and are stable. However, some rarely-used code is prone to result set and connection leaks that are very hard to detect We are currently squeezing some additional performance by adding caching to our persistence layer and it's a huge pain to maintain the cached objects manually in this setup Support of this code when DB schema changes is a big problem. I am looking for an advice on what could be the best alternative for us. As far as I know, ORMs has advanced in last 5 years, so it might be that now there's one that offers an acceptable performance. As I see this issue, we need to address those points: Find some way to reuse at least some of the written SQL to express mappings Have the possibility to issue native SQL queries without the necessity to manually decompose their results (i.e. avoid manual rs.getInt(42) as they are very sensitive to schema changes) Add a non-intrusive caching layer Keep the performance figures. Is there any ORM framework you could recommend with regards to that?

  Read the article

• Scalable Database Tagging Schema

  - by Longpoke

  EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

  Read the article

• Throwing cats out of windows

  - by AndrewF

  Imagine you're in a tall building with a cat. The cat can survive a fall out of a low story window, but will die if thrown from a high floor. How can you figure out the longest drop that the cat can survive, using the least number of attempts? Obviously, if you only have one cat, then you can only search linearly. First throw the cat from the first floor. If it survives, throw it from the second. Eventually, after being thrown from floor f, the cat will die. You then know that floor f-1 was the maximal safe floor. But what if you have more than one cat? You can now try some sort of logarithmic search. Let's say that the build has 100 floors and you have two identical cats. If you throw the first cat out of the 50th floor and it dies, then you only have to search 50 floors linearly. You can do even better if you choose a lower floor for your first attempt. Let's say that you choose to tackle the problem 20 floors at a time and that the first fatal floor is #50. In that case, your first cat will survive flights from floors 20 and 40 before dying from floor 60. You just have to check floors 41 through 49 individually. That's a total of 12 attempts, which is much better than the 50 you would need had you attempted to use binary elimination. In general, what's the best strategy and it's worst-case complexity for an n-storied building with 2 cats? What about for n floors and m cats? Assume that all cats are equivalent: they will all survive or die from a fall from a given window. Also, every attempt is independent: if a cat survives a fall, it is completely unharmed. This isn't homework, although I may have solved it for school assignment once. It's just a whimsical problem that popped into my head today and I don't remember the solution. Bonus points if anyone knows the name of this problem or of the solution algorithm.

  Read the article

• WPF ClickOnce Bootstrap Dection Failure on One Machine

  - by Dexter Morgan

  Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

  Read the article

• grdb not working variables

  - by stupid_idiot

  hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

  Read the article

• Representing xml through a single class

  - by Charles

  I am trying to abstract away the difficulties of configuring an application that we use. This application takes a xml configuration file and it can be a bit bothersome to manually edit this file, especially when we are trying to setup some automatic testing scenarios. I am finding that reading xml is nice, pretty easy, you get a network of element nodes that you can just go through and build your structures quite nicely. However I am slowly finding that the reverse is not quite so nice. I want to be able to build a xml configuration file through a single easy to use interface and because xml is composed of a system of nodes I am having a lot of struggle trying to maintain the 'easy' part. Does anyone know of any examples or samples that easily and intuitively build xml files without declaring a bunch of element type classes and expect the user to build the network themselves? For example if my desired xml output is like so <cook version="1.1"> <recipe name="chocolate chip cookie"> <ingredients> <ingredient name="flour" amount="2" units="cups"/> <ingredient name="eggs" amount="2" units="" /> <ingredient name="cooking chocolate" amount="5" units="cups" /> </ingredients> <directions> <direction name="step 1">Preheat oven</direction> <direction name="step 2">Mix flour, egg, and chocolate</direction> <direction name="step 2">bake</direction> </directions> </recipe> <recipe name="hot dog"> ... How would I go about designing a class to build that network of elements and make one easy to use interface for creating recipes? Right now I have a recipe object, an ingredient object, and a direction object. The user must make each one, set the attributes in the class and attach them to the root object which assembles the xml elements and outputs the formatted xml. Its not very pretty and I just know there has to be a better way. I am using python so bonus points for pythonic solutions

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• SQL Server architecture guidance

  - by Liam

  Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

  Read the article

• Programmatically Binding to a Property

  - by M312V

  I know it's a generic title, but my question is specific. I think it will boil down to a question of practice. So, I have the following code: public class Component : UIElement { public Component() { this.InputBindings.Add(new MouseBinding(SomeCommandProperty, new MouseGesture(MouseAction.LeftClick))); } } I could easily aggregate the ViewModel that owns SomeCommandProperty into the Component class, but I'm currently waiving that option assuming there is another way. Component is a child of ComponentCollection which is child of a Grid which DataContext is the ViewModel. ComponentCollection as the name suggests contains a collection of Components. <Grid Name="myGrid"> <someNamespace:ComponentCollection x:Name="componentCollection"/> </Grid> It's the same scenario as the XAML below, but with TextBlock. I guess I'm trying to replicate what's being done in the XAML below programatically. Again, Component's top most ancestor's DataContext is set to ViewModel. <Grid Name="myGrid"> <TextBlock Text="SomeText"> <TextBlock.InputBindings> <MouseBinding Command="{Binding SomeCommandProperty}" MouseAction="LeftClick" /> </TextBlock.InputBindings> </TextBlock> </Grid> Update 1 Sorry, I'm unable to comment because I lack the reputation points. Basically, I have a custom control which inherit from a Panel which children are a collection of Component. It's not a hack, like I've mentioned, I could directly have access to SomeCommandProperty If I aggregate the ViewModel into Component. Doing so, however, feels icky. That is, having direct access to ViewModel from a Model. I guess the question I'm asking is. Given the situation that Component's parent UIElement's DataContext is set to ViewModel, is it possible to access SomeCommandProperty without Component owning a reference to the ViewModel that owns SomeCommandProperty? Programatically, that is. Using ItemsControl doesn't change the fact that I still need to bind SomeCommandProperty to each Items.

  Read the article

• git: setting a single tracking remote from a public repo.

  - by Gauthier

  I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

  Read the article

• Java java.util.ConcurrentModificationException error

  - by vijay

  Hi all, please can anybody help me solve this problem last so many days I could not able to solve this error. I tried using synchronized method and other ways but did not work so please help me Error java.util.ConcurrentModificationException at java.util.AbstractList$Itr.checkForComodification(Unknown Source) at java.util.AbstractList$Itr.remove(Unknown Source) at JCA.startAnalysis(JCA.java:103) at PrgMain2.doPost(PrgMain2.java:235) Code public synchronized void startAnalysis() { //set Starting centroid positions - Start of Step 1 setInitialCentroids(); Iterator<DataPoint> n = mDataPoints.iterator(); //assign DataPoint to clusters loop1: while (true) { for (Cluster c : clusters) { c.addDataPoint(n.next()); if (!n.hasNext()) break loop1; } } //calculate E for all the clusters calcSWCSS(); //recalculate Cluster centroids - Start of Step 2 for (Cluster c : clusters) { c.getCentroid().calcCentroid(); } //recalculate E for all the clusters calcSWCSS(); // List copy = new ArrayList(originalList); //synchronized (c) { for (int i = 0; i < miter; i++) { //enter the loop for cluster 1 for (Cluster c : clusters) { for (Iterator<DataPoint> k = c.getDataPoints().iterator(); k.hasNext(); ) { // synchronized (k) { DataPoint dp = k.next(); System.out.println("Value of DP" +dp); //pick the first element of the first cluster //get the current Euclidean distance double tempEuDt = dp.getCurrentEuDt(); Cluster tempCluster = null; boolean matchFoundFlag = false; //call testEuclidean distance for all clusters for (Cluster d : clusters) { //if testEuclidean < currentEuclidean then if (tempEuDt > dp.testEuclideanDistance(d.getCentroid())) { tempEuDt = dp.testEuclideanDistance(d.getCentroid()); tempCluster = d; matchFoundFlag = true; } //if statement - Check whether the Last EuDt is > Present EuDt } //for variable 'd' - Looping between different Clusters for matching a Data Point. //add DataPoint to the cluster and calcSWCSS if (matchFoundFlag) { tempCluster.addDataPoint(dp); //k.notify(); // if(k.hasNext()) k.remove(); for (Cluster d : clusters) { d.getCentroid().calcCentroid(); } //for variable 'd' - Recalculating centroids for all Clusters calcSWCSS(); } //if statement - A Data Point is eligible for transfer between Clusters. // }// syn } //for variable 'k' - Looping through all Data Points of the current Cluster. }//for variable 'c' - Looping through all the Clusters. }//for variable 'i' - Number of iterations. // syn }

  Read the article

• Patterns for dynamic CMS components (event driven?)

  - by CitrusTree

  Sorry my title is not great, this is my first real punt at moving 100% to OO as I've been procedural for more years than I can remember. I'm finding it hard to understand if what I'm trying to do is possible. Depending on people's thoughts on the 2 following points, I'll go down that route. The CMS I'm putting together is quote small, however focuses very much on different types of content. I could easily use Drupal which I'm very comfortable with, but I want to give myself a really good reasons to move myself into design patterns / OO-PHP 1) I have created a base 'content' class which I wish to be able to extend to handle different types of content. The base class, for example, handles HTML content, and extensions might handle XML or PDF output instead. On the other hand, at some point I may wish to extend the base class for a given project completely. I.e. if class 'content-v2' extended class 'content' for that site, any calls to that class should actually call 'content-v2' instead. Is that possible? If the code instantiates an object of type 'content' - I actually want it to instantiate one of type 'content-v2'... I can see how to do it using inheritance, but that appears to involve referring to the class explicitly, I can't see how to link the class I want it to use instead dynamically. 2) Secondly, the way I'm building this at the moment is horrible, I'm not happy with it. It feels very linear indeed - i.e. get session details get content build navigation theme page publish. To do this all the objects are called 1-by-1 which is all very static. I'd like it to be more dynamic so that I can add to it at a later date (very closely related to first question). Is there a way that instead of my orchestrator class calling all the other classes 1-by-1, then building the whole thing up at the end, that instead each of the other classes can 'listen' for specific events, then at the applicable point jump in and do their but? That way the orchestrator class would not need to know what other classes were required, and call them 1-by-1. Sorry if I've got this all twisted in my head. I'm trying to build this so it's really flexible.

  Read the article

• Should I create a unique clustered index, or non-unique clustered index on this SQL 2005 table?

  - by Bremer

  I have a table storing millions of rows. It looks something like this: Table_Docs ID, Bigint (Identity col) OutputFileID, int Sequence, int …(many other fields) We find ourselves in a situation where the developer who designed it made the OutputFileID the clustered index. It is not unique. There can be thousands of records with this ID. It has no benefit to any processes using this table, so we plan to remove it. The question, is what to change it to… I have two candidates, the ID identity column is a natural choice. However, we have a process which does a lot of update commands on this table, and it uses the Sequence to do so. The Sequence is non-unique. Most records only contain one, but about 20% can have two or more records with the same Sequence. The INSERT app is a VB6 piece of crud throwing thousands insert commands at the table. The Inserted values are never in any particular order. So the Sequence of one insert may be 12345, and the next could be 12245. I know that this could cause SQL to move a lot of data to keep the clustered index in order. However, the Sequence of the inserts are generally close to being in order. All inserts would take place at the end of the clustered table. Eg: I have 5 million records with Sequence spanning 1 to 5 million. The INSERT app will be inserting sequence’s at the end of that range at any given time. Reordering of the data should be minimal (tens of thousands of records at most). Now, the UPDATE app is our .NET star. It does all UPDATES on the Sequence column. “Update Table_Docs Set Feild1=This, Field2=That…WHERE Sequence =12345” – hundreds of thousands of these a day. The UPDATES are completely and totally, random, touching all points of the table. All other processes are simply doing SELECT’s on this (Web pages). Regular indexes cover those. So my question is, what’s better….a unique clustered index on the ID column, benefiting the INSERT app, or a non-unique clustered index on the Sequence, benefiting the UPDATE app?

  Read the article

• plane bombing problems- help

  - by peiska

  I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

  Read the article

• Correlation formula explanation needed d3.js

  - by divakar

  function getCorrelation(xArray, yArray) { alert(xArray); alert(yArray); function sum(m, v) {return m + v;} function sumSquares(m, v) {return m + v * v;} function filterNaN(m, v, i) {isNaN(v) ? null : m.push(i); return m;} // clean the data (because we know that some values are missing) var xNaN = _.reduce(xArray, filterNaN , []); var yNaN = _.reduce(yArray, filterNaN , []); var include = _.intersection(xNaN, yNaN); var fX = _.map(include, function(d) {return xArray[d];}); var fY = _.map(include, function(d) {return yArray[d];}); var sumX = _.reduce(fX, sum, 0); var sumY = _.reduce(fY, sum, 0); var sumX2 = _.reduce(fX, sumSquares, 0); var sumY2 = _.reduce(fY, sumSquares, 0); var sumXY = _.reduce(fX, function(m, v, i) {return m + v * fY[i];}, 0); var n = fX.length; var ntor = ( ( sumXY ) - ( sumX * sumY / n) ); var dtorX = sumX2 - ( sumX * sumX / n); var dtorY = sumY2 - ( sumY * sumY / n); var r = ntor / (Math.sqrt( dtorX * dtorY )); // Pearson ( http://www.stat.wmich.edu/s216/book/node122.html ) var m = ntor / dtorX; // y = mx + b var b = ( sumY - m * sumX ) / n; // console.log(r, m, b); return {r: r, m: m, b: b}; } I have finding correlation between the points i plot using this function which is not written by me. my xarray=[120,110,130,132,120,118,134,105,120,0,0,0,0,137,125,120,127,120,160,120,148] yarray=[80,70,70,80,70,62,69,70,70,62,90,42,80,72,0,0,0,0,78,82,68,60,58,82,60,76,86,82,70] I can t able to understand the function perfectly. Can anybody explain it with the data i pasted here. I also wanted to remove the zeros getting calculated from this function.

  Read the article

• Avoiding explicit recursion in Haskell

  - by Travis Brown

  The following simple function applies a given monadic function iteratively until it hits a Nothing, at which point it returns the last non-Nothing value. It does what I need, and I understand how it works. lastJustM :: (Monad m) => (a -> m (Maybe a)) -> a -> m a lastJustM g x = g x >>= maybe (return x) (lastJustM g) As part of my self-education in Haskell I'm trying to avoid explicit recursion (or at least understand how to) whenever I can. It seems like there should be a simple non-explicitly recursive solution in this case, but I'm having trouble figuring it out. I don't want something like a monadic version of takeWhile, since it could be expensive to collect all the pre-Nothing values, and I don't care about them anyway. I checked Hoogle for the signature and nothing shows up. The m (Maybe a) bit makes me think a monad transformer might be useful here, but I don't really have the intuitions I'd need to come up with the details (yet). It's probably either embarrassingly easy to do this or embarrassingly easy to see why it can't or shouldn't be done, but this wouldn't be the first time I've used self-embarrassment as a pedagogical strategy. Background: Here's a simplified working example for context: suppose we're interested in random walks in the unit square, but we only care about points of exit. We have the following step function: randomStep :: (Floating a, Ord a, Random a) => a -> (a, a) -> State StdGen (Maybe (a, a)) randomStep s (x, y) = do (a, gen') <- randomR (0, 2 * pi) <$> get put gen' let (x', y') = (x + s * cos a, y + s * sin a) if x' < 0 || x' > 1 || y' < 0 || y' > 1 then return Nothing else return $ Just (x', y') Something like evalState (lastJustM (randomStep 0.01) (0.5, 0.5)) <$> newStdGen will give us a new data point.

  Read the article

• choosing an image locally from http url and serving that image without a server round trip

  - by serverman

  Hi folks I am a complete novice to Flash (never created anything in flash). I am quite familiar with web applications (J2EE based) and have a reasonable expertise in Javascript. Here is my requirement. I want the user to select (via an html form) an image. Normally in the post, this image would be sent to server and may be stored there to be served later. I do not want that. I want to store this image locally and then serve it via HTTP to the user. So, the flow is: 1. Go to the "select image url":mywebsite.com/selectImage Browse the image and select the image This would transfer control locally to some code running on the client (Javascript or flash), which would then store the image locally at some place on the client machine. Go to the "show image url": mywebsite.com/showImage This would eventually result in some client code running on the browser that retrieves the image and renders it (without any server round trips.) I considered the following options: Use HTML5 local storage. Since I am a complete novice to flash, I looked into this. I found that it is fairly straightforward to store and retrieve images in javascript (only strings are allowed but I am hoping storing base64 encoded strings would work at least for small images). However, how do I serve the image via http url that points to my server without a server round trip? I saw the interesting article at http://hacks.mozilla.org/category/fileapi/ but that would work only in firefox and I need to work on all latest browsers (at least the ones supporting HTML5 local storage) Use flash SharedObjects. OK, this would have been good - the only thing is I am not sure where to start. Snippets of actionscripts to do this are scattered everywhere but I do not know how to use those scripts in an actual html page:) I do not need to create any movies or anything - just need to store an image and serve it locally. If I go this route, I would also use it to store other "strings" locally. If you suggest this, please give me the exact steps (could be pointers to other web sites) on how to do this. I would like to avoid paying for any flash development environment software ideally:) Thank you!

  Read the article

• Is there a programming language with be semantics close to English ?

  - by ivo s

  Most languages allow to 'tweek' to certain extend parts of the syntax (C++,C#) and/or semantics that you will be using in your code (Katahdin, lua). But I have not heard of a language that can just completely define how your code will look like. So isn't there some language which already exists that has such capabilities to override all syntax & define semantics ? Example of what I want to do is basically from the C# code below: foreach(Fruit fruit in Fruits) { if(fruit is Apple) { fruit.Price = fruit.Price/2; } } I want do be able to to write the above code in my perfect language like this: Check if any fruits are Macintosh apples and discount the price by 50%. The advantages that come to my mind looking from a coder's perspective in this "imaginary" language are: It's very clear what is going on (self descriptive) - it's plain English after all even kid would understand my program Hides all complexities which I have to write in C#. But why should I care to learn that if statements, arithmetic operators etc since there are already implemented The disadvantages that I see for a coder who will maintain this program are: Maybe you would express this program differently from me so you may not get all the information that I've expressed in my sentence Programs can be quite verbose and hard to debug but if possible to even proximate this type of syntax above maybe more people would start programming right? That would be amazing I think. I can go to work and just write an essay to draw a square on a winform like this: Create a form called MyGreetingForm. Draw a square with in the middle of MyGreetingFormwith a side of 100 points. In the middle of the square write "Hello! Click here to continue" in Arial font. In the above code the parser must basically guess that I want to use the unnamed square from the previous sentence, it'd be hard to write such a smart parser I guess, yet it's so simple what I want to do. If the user clicks on square in the middle of MyGreetingForm show MyMainForm. In the above code 'basically' the compiler must: 1)generate an event handler 2) check if there is any square in the middle of the form and if there is - 3) hide the form and show another form It looks very hard to do but it doesn't look impossible IMO to me at least approximate this (I can personally generate a parser to perform the 3 steps above np & it's basically the same that it has to do any way when you add even in c# a.MyEvent=+handler; so I don't see a problem here) so I'm thinking maybe somebody already did something like this ? Or is there some practical burden of complexity to create such a 'essay style' programming language which I can't see ? I mean what's the worse that can happen if the parser is not that good? - your program will crash so you have to re-word it:)

  Read the article

• Intent filter for browsing XML (specifically rss) in android

  - by Leif Andersen

  I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

  Read the article

• Can I use the [] operator in C++ to create virtual arrays

  - by Shane MacLaughlin

  I have a large code base, originally C ported to C++ many years ago, that is operating on a number of large arrays of spatial data. These arrays contain structs representing point and triangle entities that represent surface models. I need to refactor the code such that the specific way these entities are stored internally varies for specific scenarios. For example if the points lie on a regular flat grid, I don't need to store the X and Y coordinates, as they can be calculated on the fly, as can the triangles. Similarly, I want to take advantage of out of core tools such as STXXL for storage. The simplest way of doing this is replacing array access with put and get type functions, e.g. point[i].x = XV; becomes Point p = GetPoint(i); p.x = XV; PutPoint(i,p); As you can imagine, this is a very tedious refactor on a large code base, prone to all sorts of errors en route. What I'd like to do is write a class that mimics the array by overloading the [] operator. As the arrays already live on the heap, and move around with reallocs, the code already assumes that references into the array such as point *p = point + i; may not be used. Is this class feasible to write? For example writing the methods below in terms of the [] operator; void MyClass::PutPoint(int Index, Point p) { if (m_StorageStrategy == RegularGrid) { int xoffs,yoffs; ComputeGridFromIndex(Index,xoffs,yoffs); StoreGridPoint(xoffs,yoffs,p.z); } else m_PointArray[Index] = p; } } Point MyClass::GetPoint(int Index) { if (m_StorageStrategy == RegularGrid) { int xoffs,yoffs; ComputeGridFromIndex(Index,xoffs,yoffs); return GetGridPoint(xoffs,yoffs); // GetGridPoint returns Point } else return m_PointArray[Index]; } } My concern is that all the array classes I've seen tend to pass by reference, whereas I think I'll have to pass structs by value. I think it should work put other than performance, can anyone see any major pitfalls with this approach. n.b. the reason I have to pass by value is to get point[a].z = point[b].z + point[c].z to work correctly where the underlying storage type varies.

  Read the article

• In R, how do you get the best fitting equation to a set of data?

  - by Matherion

  I'm not sure wether R can do this (I assume it can, but maybe that's just because I tend to assume that R can do anything :-)). What I need is to find the best fitting equation to describe a dataset. For example, if you have these points: df = data.frame(x = c(1, 5, 10, 25, 50, 100), y = c(100, 75, 50, 40, 30, 25)) How do you get the best fitting equation? I know that you can get the best fitting curve with: plot(loess(df$y ~ df$x)) But as I understood you can't extract the equation, see Loess Fit and Resulting Equation. When I try to build it myself (note, I'm not a mathematician, so this is probably not the ideal approach :-)), I end up with smth like: y.predicted = 12.71 + ( 95 / (( (1 + df$x) ^ .5 ) / 1.3)) Which kind of seems to approximate it - but I can't help to think that smth more elegant probably exists :-) I have the feeling that fitting a linear or polynomial model also wouldn't work, because the formula seems different from what those models generally use (i.e. this one seems to need divisions, powers, etc). For example, the approach in Fitting polynomial model to data in R gives pretty bad approximations. I remember from a long time ago that there exist languages (Matlab may be one of them?) that do this kind of stuff. Can R do this as well, or am I just at the wrong place? (Background info: basically, what we need to do is find an equation for determining numbers in the second column based on the numbers in the first column; but we decide the numbers ourselves. We have an idea of how we want the curve to look like, but we can adjust these numbers to an equation if we get a better fit. It's about the pricing for a product (a cheaper alternative to current expensive software for qualitative data analysis); the more 'project credits' you buy, the cheaper it should become. Rather than forcing people to buy a given number (i.e. 5 or 10 or 25), it would be nicer to have a formula so people can buy exactly what they need - but of course this requires a formula. We have an idea for some prices we think are ok, but now we need to translate this into an equation.

  Read the article

< Previous Page | 209 210 211 212 213 214 215 216 217 218 219 220  | Next Page >