Search Results

Search found 33258 results on 1331 pages for 'search form'.

Page 216/1331 | < Previous Page | 212 213 214 215 216 217 218 219 220 221 222 223  | Next Page >

• Embedding a File Explorer instance in a WinForms app form

  - by Unsliced

  My (C#, .NET 3.5) app generates files and, in addition to raising events that can be caught and reacted to, I want to display the target folder to the user in a form. The file-list is being shown within the same form as other information. I'm using an instance of the WebBrowser control (System.Windows.Forms.WebBrowser), then navigating to the folder. This shows some default view of the explorer window, with the file summary panel on the left and the files in the 'Tiles' (large icon and text) view. e.g. wb.Navigate(@"c:\path\to\folder\"); I'd like to suppress the panel and to view the file list in the Details view. The user can get to this via a right-click, context menu, but I'd like it to come up automatically. I'd rather not have to build my own TreeView, DataGridView or whatever; the WebBrowser control does all the updating and re-sorting and whatnot 'for free'. Does anybody have a better suggestion? A different control to use or some additional arguments to pass to the control? And if I could trap events (e.g. files being selected/renamed/double-clicked, etc.) then all the better!

  Read the article

• search data from FileReader in Java

  - by maya

  hi I'm new in java how to read and search data from file (txt) and then display the data in TextArea or Jtable. for example I have file txt contains data and I need to display this data in textarea after I clicked a button, I have used FileReader , and t1 t2 tp are attributes in the file import java.io.FileReader; import java.io.IOException; String t1,t2,tp; Ffile f1= new Ffile(); FileReader fin = new FileReader("test2.txt"); Scanner src = new Scanner(fin); while (src.hasNext()) { t1 = src.next(); textarea.setText(t1); t2 = src.next(); textarea.setText(t2); tp = src.next(); textarea.setText(tp); f1.insert(t1,t2,tp); } fin.close(); also I have used the inputstream DataInputStream dis = null; String dbRecord = null; try { File f = new File("text2.text"); FileInputStream fis = new FileInputStream(f); BufferedInputStream bis = new BufferedInputStream(fis); dis = new DataInputStream while ( (dbRecord = dis.readLine()) != null) { StringTokenizer st = new StringTokenizer(dbRecord, ":"); String t1 = st.nextToken(); String t2 = st.nextToken(); String tp = st.nextToken(); textarea.setText(textarea.getText()+t1); textarea.setText(textarea.getText()+t2); textarea.setText(textarea.getText()+tp); } } catch (IOException e) { // catch io errors from FileInputStream or readLine() System.out.println("Uh oh, got an IOException error: " + e.getMessage()); } finally { } but both of them don't work ,so please any one help me I want to know how to read data and also search it from file and i need to display the data in textarea . thanks in advance

  Read the article

• Search XDocument with LINQ with out knowing the Namespace

  - by BarDev

  Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

  Read the article

• Using a redirect of any form to remove a query string with Apache

  - by Bart B

  Because of the silly way iTunes works the only way to update the URL for a feed is by setting up a permanent redirect from the old feed to the new. This seems easy, but I've hit a snag. The old URL ended in /?feed=rss2, the new URL is just a file, so it ends in podcast.xml. When I redirected from the old URL to the new, iTunes picked up the new URL BUT, WITH the query string, so now the URL ends in podcast.xml?feed=rss2. This is allowing listers to download the show - which is good, but causing some other problems. Is there any possible way to set up a permanent redirect that will redired podcast.xml?feed=rss2 to just podcast.xml? Mod_Rewrite seems to just pass through query strings, so I'm at a loss! Bart.

  Read the article

• How to use jquery+thickbox open the SubForm, and pass the value to parent form

  - by Curie

  like this example: aa.jsp(parent form) <head> <script language="javascript" type="text/javascript" src="<%=basePath%>js/jquery-1.7.2.min.js"></script> <script language="javascript" type="text/javascript" src="<%=basePath%>js/thickbox.js"></script> <link rel="stylesheet" type="text/css" href="<%=basePath%>js/thickbox.css"> </head> <body> <a href="bb.jsp?TB_iframe=true&placeValuesBeforeTB_=savedValues&height=400&width=170" title="input value" class="thickbox"> <input type="text" name="txtA" id="txtA"/> </a> </body> I use the js of jquery and thickbox in the head. And apply them. Click txt textbox to open sub page. bb.jsp(sub form): <body> <input type="text" name="txtB" id="txtB"> </body> There is one textbox txtB in sub page. How could I type the context in textbox txtB of bb.jsp, and pass the context to parent page of aa.jsp. Then the context will be diaplayed in textbox txtA in parent page.

  Read the article

• SQL Full-Text Indexing Issue

  - by Phil

  UPDATE: I have figured out a way using a form of dynamic sql to fix this problem, thanks anyway for any help. Hi, there is something that I need to accomplish with the use of Full-Text Indexing. This is it: The fact of the matter is when I run a query (with a stored procedure) that looks like (with a parameter (@name) that was obviously defined above (not shown here), this parameter is sent to the stored procedure by an asp.net page, from user input): SELECT Name FROMdbo.UsersTable WHERE FREETEXT(Name, @name) Well, the fact of the matter is that a query like this will return values if, say the parameter @name's value is Joe, and say, there are 10 records of names with Joe in them, but if @name's value is just Jo, then it returns nothing, and this is the problem. Say that there are other records in this table that have Jo in them, like for example, Jole, or John. So the real question is, how do I get it to return values that are not full words, or phrases, but just from part of the word/phrase (like I said above)? Like FREETEXT(Name, @name*), which is not allowed to be used as a query, but, you get the idea. Is there a way to accomplish this? I'm sure there must be, I need to figure this out. Thanks for any help.

  Read the article

• Unable to use "Manage Content and Structure" after removing Project server form the SharePoint farm

  - by Brian

  We're no longer using Office Project Server, and I've removed it from the farm in which it was installed. However, now that it's been removed, I am unable to access the "Manage Content and Structure" link on some of our SharePoint sites. I get an error indicating that SharePoint Failed to find the XML file at location '12\Template\Features\PWSCommitments\feature.xml' Anyone have an idea how to fix this?

  Read the article

• Make an ActiveX control work without a form?

  - by Earlz

  We are using Topaz Signature pads. They provide their APIs in the from of an ActiveX control which is to be put on a Winform control. Well, the way our project will work we do not want to have a form(at least not visible). We just want for the signature ActiveX control to get an image in the background. static AxSigPlus sig = new AxSIGPLUSLib.AxSigPlus(); public static void Begin() { ((System.ComponentModel.ISupportInitialize)(sig)).BeginInit(); sig.Name = "sig"; sig.Location = new System.Drawing.Point(0, 0); sig.Size = new System.Drawing.Size(0, 0); sig.Enabled = true; sig.TabletState = 1; //error here sig.SigCompressionMode = 0; } Ok so I get an error at the marked line. The exception is Exception of type 'System.Windows.Forms.AxHost+InvalidActiveXStateException' was thrown. What do I do to solve this problem? Would it just be easier to create a new hidden form and put the control on it so it's invisible?

  Read the article

• Is there a normal search in Windows 7?

  - by atch

  Which basically mean where I could specify more than just a file name;

  Read the article

• Previously working emberjs1.0-pre form on jsfiddle returns "error": "Please use POST request"

  - by brg

  This code ** http://jsfiddle.net/wagenet/ACzaJ/8/ ** was working a few days ago, when i returned to it today, it throws {"error": "Please use POST request"}, when i click add button Also the jsfiddle editor.js always throws exception on this line: function stop(){cc = stop; throw StopIteration;}; Does anyone knows the cause of this issue. Many thanks Update 1 Based on @Peter Wagenet's suggestions below, the form now logs entries or inputs to the console but it doesn't display on the result section of jsfiddle instead what is displayed on jsfiddle result section or page is still this error {"error": "Please use POST request"} ** http://jsfiddle.net/ACzaJ/18/ Update 2 In this fiddle, http://jsfiddle.net/ACzaJ/19/, i have successfully eliminated this error {"error": "Please use POST request"} by adding event.preventDefault(); to the submit action in Todos.TodoFormView. That allows us to use arbitrary view methods as action handlers. The existing issue is that the input to the form, only displays on the console and not on jsfiddle result section, though no error displays on the result section, there is a new error appearing in the console of the updated fiddle: Uncaught Error: Cannot perform operations on a Metamorph that is not in the DOM. Finally solved I needed to comment out App.initialize() for it to work as expected. This the working fiddle ** http://jsfiddle.net/ACzaJ/20/. I don't know why that is so, but my guess is that, App.initialize works with other parts like the router for routing, ApplicationController and ApplicationView with {{outlet}} in the handlebars, which i didn't need for this fiddle. Finally Finally and completely solved This ** http://jsfiddle.net/tQWn8/ works with App.initialize. But you have to declare all those components above and pass the router to App.initialize, like this App..initialize(router). If you don't do this, then you will get the old error Uncaught Error: Cannot perform operations on a Metamorph that is not in the DOM.

  Read the article

• Ability to draw and record a signature as part of a form - iphone

  - by mustic

  Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Getting error while opening form in visual studio 2005

  - by Ravisha

  i am getting below excetion on opening a form on visual studio work bench Its not always but sometime it opens without any problem Does anyone has a solution for this? The path is not of a legal form. Hide at System.IO.Path.NormalizePathFast(String path, Boolean fullCheck) at System.IO.Path.NormalizePath(String path, Boolean fullCheck) at System.IO.Path.GetFullPathInternal(String path) at System.Reflection.AssemblyName.GetAssemblyName(String assemblyFile) at Microsoft.VisualStudio.Design.VSTypeResolutionService.AddProjectDependencies(Project project) at Microsoft.VisualStudio.Design.VSTypeResolutionService.AssemblyEntry.get_Assembly() at Microsoft.VisualStudio.Design.VSTypeResolutionService.AssemblyEntry.Search(String fullName, String typeName, Boolean ignoreTypeCase, Assembly& assembly, String description) at Microsoft.VisualStudio.Design.VSTypeResolutionService.SearchProjectEntries(AssemblyName assemblyName, String typeName, Boolean ignoreTypeCase, Assembly& assembly) at Microsoft.VisualStudio.Design.VSTypeResolutionService.GetType(String typeName, Boolean throwOnError, Boolean ignoreCase, ReferenceType refType) at Microsoft.VisualStudio.Design.Serialization.CodeDom.AggregateTypeResolutionService.GetType(String name, Boolean throwOnError, Boolean ignoreCase) at Microsoft.VisualStudio.Design.Serialization.CodeDom.AggregateTypeResolutionService.GetType(String name, Boolean throwOnError) at System.ComponentModel.Design.Serialization.CodeDomSerializerBase.GetType(ITypeResolutionService trs, String name, Dictionary2 names) at System.ComponentModel.Design.Serialization.CodeDomSerializerBase.FillStatementTable(IDesignerSerializationManager manager, IDictionary table, Dictionary2 names, CodeStatementCollection statements, String className) at System.ComponentModel.Design.Serialization.TypeCodeDomSerializer.Deserialize(IDesignerSerializationManager manager, CodeTypeDeclaration declaration) at System.ComponentModel.Design.Serialization.CodeDomDesignerLoader.PerformLoad(IDesignerSerializationManager manager) at Microsoft.VisualStudio.Design.Serialization.CodeDom.VSCodeDomDesignerLoader.PerformLoad(IDesignerSerializationManager serializationManager) at Microsoft.VisualStudio.Design.Serialization.CodeDom.VSCodeDomDesignerLoader.DeferredLoadHandler.Microsoft.VisualStudio.TextManager.Interop.IVsTextBufferDataEvents.OnLoadCompleted(Int32 fReload)

  Read the article

• AutoCompleteExtender not suggesting search terms

  - by Phil

  My codebehind method: <System.Web.Services.WebMethodAttribute(), System.Web.Script.Services.ScriptMethodAttribute()> _ Public Shared Function GetCompletionList(ByVal prefixText As String, ByVal count As Integer, ByVal contextKey As String) As String() ' Create array of movies Dim movies() As String = {"Star Wars", "Star Trek", "Superman", "Memento", "Shrek", "Shrek II"} ' Return matching movies Return From m In movies Where (m.StartsWith(prefixText, StringComparison.CurrentCultureIgnoreCase)) Select m _ .Take(count).ToArray() End Function End Class Then in my aspx page I have: <form id="form1" runat="server"> <div> <asp:ToolkitScriptManager ID="ToolkitScriptManager1" runat="server"> </asp:ToolkitScriptManager> <br /> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> <asp:AutoCompleteExtender ID="TextBox1_AutoCompleteExtender" runat="server" DelimiterCharacters="" Enabled="True" ServiceMethod="GetCompletionList" ServicePath="" TargetControlID="TextBox1" UseContextKey="True" MinimumPrefixLength="2"> </asp:AutoCompleteExtender> </div> </form> When I run the page there are no errors, but there also are no auto complete suggestions. Please help!

  Read the article

• Django access data passed to form

  - by realshadow

  Hey, I have got a choiceField in my form, where I display filtered data. To filter the data I need two arguments. The first one is not a problem, because I can take it directly from an object, but the second one is dynamically generated. Here is some code: class GroupAdd(forms.Form): def __init__(self, *args, **kwargs): self.pid = kwargs.pop('parent_id', None) super(GroupAdd, self).__init__(*args, **kwargs) parent_id = forms.IntegerField(widget=forms.HiddenInput) choices = forms.ChoiceField( choices = [ [group.node_id, group.name] for group in Objtree.objects.filter( type_id = ObjtreeTypes.objects.values_list('type_id').filter(name = 'group'), parent_id = 50 ).distinct()] + [[0, 'Add a new one'] ], widget = forms.Select( attrs = { 'id': 'group_select' } ) ) I would like to change the parent_id that is passed into the Objtree.objects.filter. As you can see I tried in the init function, as well with kwargs['initial']['parent_id'] and then calling it with self, but that doesnt work, since its out of scope... it was pretty much my last effort. I need to acccess it either trough the initial parameter or directly trough parent_id field, since it already holds its value (passed trough initial). Any help is appreciated, as I am running out of ideas.

  Read the article

• Creating stored procedure having different WHERE clause on different search criteria without putting

  - by Muhammad Kashif Nadeem

  Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

  Read the article

• Explaining verity index and document search limits

  - by Ahmad

  As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

  Read the article

• Rails form protection questions, hidden field

  - by user284194

  I have a live rails website and I want to have a form with a lot of fields on it. I have set up validations and allowed formatting for every field. I've tested it quite a bit and it seems to catch anything I throw at it. I think it's almost ready to go live, but I want to quadruple check if there's anything else I should do to protect it. My site has a low volume of visitors, but I want it to be a safe as possible. I'd like to avoid using a captcha if I can. I've read that you can use a hidden field to protect forms against bots. Do people recommend this instead of using a captcha, or even using it with a captcha? my form is really standard: <% form_for(@entry) do |f| %> ... <%= f.submit 'Create' %> <% end %> Any suggestions or code samples would be greatly appreciated.

  Read the article

• Determining which form input failed validation?

  - by Alastair Pitts

  I am designing a creation wizard in ASP.NET MVC 1 and instead of posting back each step, I'm using javascript to toggle the display of the different steps divs. This is a quick sample of the code, just to explain. <% using (Html.BeginForm()) {%> <fieldset> <legend>Fields</legend> <div id="wizardStep1"> <% Html.RenderPartial("CreateStep1", Model); %> </div> <div id="wizardStep2"> <% Html.RenderPartial("CreateStep2", Model); %> </div> <div id="wizardStep3"> <% Html.RenderPartial("CreateStep3", Model); %> </div> </fieldset> <% } %> I have javascript that just toggles the visibility of the divs, with each partial view containing a different section of the input form (which is pretty large by itself) My question is, if the form fails validation and I reload the page with the validation errors, is there a way for me to determine which div contains the error? Either in javascript or other? Failing that, is there a good client-side validation library for MVC 1? Ideally I'd love to move to MVC2 and the client side validation built into that, but I am required to use MVC1

  Read the article

• Scribe-LinkedIn Search API

  - by Rupeshit

  Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

  Read the article

• Draw gridlines in C# form

  - by Jaosn

  Basically, i have it drawn out but i would like to scale it to a fixed cm scale like 0.3, 0.5 cm, 0.7cm and 1 cm respectively. How can i make sure that it is of a fixed scale?

  Read the article

• Search for index.php and index.html and replace string

  - by Jonas

  Hello. I recently had some sort of Malware on my computer that added to all index.php and index.html ON THE WEBSERVER! the following string(s): echo "<iframe src=\"http://fabujob.com/?click=AD4A4\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; echo "<iframe src=\"http://fabujob.com/?click=AC785\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; So the parameter after "click=" always changes. These two were only examples. Is there a way to do that quick and fast? . . EDIT: It is on my webserver, so no use of find...

  Read the article

• Content search through source code in finder

  - by gf

  I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

  Read the article

• JS encodeURIComponent result different from the one created by FORM

  - by Marco Demaio

  I thought values entered in forms are properly encoded by browsers. But this simple test shows it's not true: <!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html><head> <meta http-equiv="Content-Type" content="text/html; charset=windows-1252"> <title></title> </head><body> <form id="test" action="test_get_vs_encodeuri.html" method="GET" onsubmit="alert(encodeURIComponent(this.one.value));"> <input name="one" type="text" value="Euro-€"> <input type="submit" value="SUBMIT"> </form> </body></html> When hitting submit button: encodeURICompenent encodes input value into "Euro-%E2%82%AC" while browser into the GET query writes only a simple "Euro-%80" Could somone explain? Or is encodeURIComponent doing unnecessary conversions?

  Read the article

• php scandir --> search for files/directories

  - by Peter

  Hi! I searched before I ask, without lucky.. I looking for a simple script for myself, which I can search for files/folders. Found this code snippet in the php manual (I think I need this), but it is not work for me. "Was looking for a simple way to search for a file/directory using a mask. Here is such a function. By default, this function will keep in memory the scandir() result, to avoid scaning multiple time for the same directory." <?php function sdir( $path='.', $mask='*', $nocache=0 ){ static $dir = array(); // cache result in memory if ( !isset($dir[$path]) || $nocache) { $dir[$path] = scandir($path); } foreach ($dir[$path] as $i=>$entry) { if ($entry!='.' && $entry!='..' && fnmatch($mask, $entry) ) { $sdir[] = $entry; } } return ($sdir); } ?> Thank you for any help, Peter

  Read the article

< Previous Page | 212 213 214 215 216 217 218 219 220 221 222 223  | Next Page >