Search Results

Search found 21212 results on 849 pages for 'apt key'.

Page 218/849 | < Previous Page | 214 215 216 217 218 219 220 221 222 223 224 225  | Next Page >

  • Entity Framework doesn't like 0..1 to * relationships.

    - by Orion Adrian
    I have a database framework where I have two tables. The first table has a single column that is an identity and primary key. The second table contains two columns. One is a nvarchar primary key and the other is a nullable foreign key to the first table. On the default import of the database I get the following error: Condition cannot be specified for Column member 'ForeignKeyId' because it is marked with a 'Computed' or 'Identity' StoreGeneratedPattern. where ForeignKeyId is the second foreign key reference in the second table. Is this just something the entity model doesn't do? Or am I missing something?

    Read the article

  • Why is win32com so much slower than xlrd?

    - by Josh
    I have the same code, written using win32com and xlrd. xlrd preforms the algorithm in less than a second, while win32com takes minutes. Here is the win32com: def makeDict(ws): """makes dict with key as header name, value as tuple of column begin and column end (inclusive)""" wsHeaders = {} # key is header name, value is column begin and end inclusive for cnum in xrange(9, find_last_col(ws)): if ws.Cells(7, cnum).Value: wsHeaders[str(ws.Cells(7, cnum).Value)] = (cnum, find_last_col(ws)) for cend in xrange(cnum + 1, find_last_col(ws)): #finds end column if ws.Cells(7, cend).Value: wsHeaders[str(ws.Cells(7, cnum).Value)] = (cnum, cend - 1) break return wsHeaders And the xlrd def makeDict(ws): """makes dict with key as header name, value as tuple of column begin and column end (inclusive)""" wsHeaders = {} # key is header name, value is column begin and end inclusive for cnum in xrange(8, ws.ncols): if ws.cell_value(6, cnum): wsHeaders[str(ws.cell_value(6, cnum))] = (cnum, ws.ncols) for cend in xrange(cnum + 1, ws.ncols):#finds end column if ws.cell_value(6, cend): wsHeaders[str(ws.cell_value(6, cnum))] = (cnum, cend - 1) break return wsHeaders

    Read the article

  • mysql composite unique on FK's

    - by m2o
    I want to implement the following constraints in mysql: create table TypeMapping( ... constraint unique(server_id,type_id), constraint foreign key(server_id) references Server(id), constraint foreign key(type_id) references Type(id) ); This throws a 'ERROR 1062 (23000): Duplicate entry '3-4' for key 'server_id'' when I issue an insert/update that would break the constraint. Is this type of constraint even possible? If so how? Thank you.

    Read the article

  • dual map structure implementation?

    - by Danra
    Hey, I'm looking for a standard dual-map structure - is there one implemented in std/boost/another standard C++ library? When I say "dual-map" I mean a map which can be indexed efficiently both by the key and the "value" (it actually has two key types instead of one key type and one value type). for example: dualmap<int,string> m; m[1] = "foo"; m["bar"] = 2 int a = m["bar"]; // a = 2 Thanks, Dan

    Read the article

  • Is there a way to move two squares in OpenGL simultaneously?

    - by thyrgle
    Hi, so I have a function that handles key presses in a game I'm working on in OpenGL. But, the thing is that even though I have made two squares and they both move when the correct key is pressed only one square is moved. Is there a way I can make the two squares move. This is the glutKeyboardFunc function I implimented: void handleKeypress(unsigned char key, int x, int y) { switch (key) { case 27: exit(0); break; case 'w': glutTimerFunc(0.001, moveSquareUp, 0); break; case 'd': glutTimerFunc(0.001, moveSquareRight, 0); break; case 's': glutTimerFunc(0.001, moveSquareDown, 0); break; case 'a': glutTimerFunc(0.001, moveSquareLeft, 0); break; } } If you need any more code just ask.

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in SQL Server 2008

    - by bodziec
    I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

  • Clean way to perform commands in the Emacs minibuffer

    - by Christopher Monsanto
    Consider the following example: I want to read a file using ido from the minibuffer, but merge in all of the directories I use often. I can't just execute (ido-find-file) (ido-merge-work-directories) Because the second sexp will only execute after the user is finished selecting the file. The question then is: what is the best/cleanest way to execute commands in the minibuffer's command loop? The only way I know to do this is to bind my desired command to a key sequence, and add that sequence to unread-command-events so the key runs once we enter the minibuffer command loop: (setq unread-command-events (append (listify-key-sequence (kbd "M-s")) unread-command-events)) ; std key-binding for ido-merge-work-directories (ido-find-file) But that is very hacky, and I would like to know if there is a better solution. Thanks!

    Read the article

  • NSFetchedResultsController sections localized sorted

    - by Gerd
    How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

    Read the article

  • Generating short license keys with OpenSSL

    - by Marc Charbonneau
    I'm working on a new licensing scheme for my software, based on OpenSSL public / private key encryption. My past approach, based on this article, was to use a large private key size and encrypt an SHA1 hashed string, which I sent to the customer as a license file (the base64 encoded hash is about a paragraph in length). I know someone could still easily crack my application, but it prevented someone from making a key generator, which I think would hurt more in the long run. For various reasons I want to move away from license files and simply email a 16 character base32 string the customer can type into the application. Even using small private keys (which I understand are trivial to crack), it's hard to get the encrypted hash this small. Would there be any benefit to using the same strategy to generated an encrypted hash, but simply using the first 16 characters as a license key? If not, is there a better alternative that will create keys in the format I want?

    Read the article

  • Magic Methods in Python

    - by dArignac
    Howdy, I'm kind of new to Python and I wonder if there is a way to create something like the magic methods in PHP (http://www.php.net/manual/en/language.oop5.overloading.php#language.oop5.overloading.methods) My aim is to ease the access of child classes in my model. I basically have a parent class that has n child classes. These classes have three values, a language key, a translation key and a translation value. The are describing a kind of generic translation handling. The parent class can have translations for different translation key each in different languages. E.g. the key "title" can be translated into german and english and the key "description" too (and so far and so on) I don't want to get the child classes and filter by the set values (at least I want but not explicitly, the concrete implementation behind the magic method would do this). I want to call parent_class.title['de'] # or also possible maybe parent_class.title('de') for getting the translation of title in german (de). So there has to be a magic method that takes the name of the called method and their params (as in PHP). As far as I dug into Python this is only possible with simple attributes (_getattr_, _setattr_) or with setting/getting directly within the class (_getitem_, _setitem_) which both do not fit my needs. Maybe there is a solution for this? Please help! Thanks in advance!

    Read the article

  • Hot to get custom http-header in asp.net?

    - by Sirius Lampochkin
    I have an asp.net appliction on the one server. There I've added code on server-side in Page_Load: Response.AddHeader("key", "password-key-from-hotel"); On the client side I have a form: $lt;form ... action="www.link-to-another-domaint" >   <input type="hidden" id="asd" value="fgh" > .... </form> <script type="text/javascript">   document.forms[0].submit(); </script> Then on the other domain - there is also my other application - I'm trying to get the hedaer "key" by this code: Request.Headers["key"].ToString(); But there is no such header. Is there is a desicion? Where is my mistake?

    Read the article

  • What benefits are there to storing Javascript in external files vs in the <head>?

    - by RenderIn
    I have an Ajax-enabled CRUD application. If I display a record from my database it shows that record's values for each column, including its primary key. For the Ajax actions tied to buttons on the page I am able to set up their calls by printing the ID directly into their onclick functions when rendering the HTML server-side. For example, to save changes to the record I may have a button as follows, with '123' being the primary key of the record. <button type="button" onclick="saveRecord('123')">Save</button> Sometimes I have pages with Javascript generating HTML and Javascript. In some of these cases the primary key is not naturally available at that place in the code. In these cases I took a shortcut and generate buttons like so, taking the primary key from a place it happens to be displayed on screen for visual consumption: ... <td>Primary Key: </td> <td><span id="PRIM_KEY">123</span></td> ... <button type="button" onclick="saveRecord(jQuery('#PRIM_KEY').text())">DoSomething</button> This definitely works, but it seems wrong to drive database queries based on the value of text whose purpose was user consumption rather than method consumption. I could solve this by adding a series of additional parameters to various methods to usher the primary key along until it is eventually needed, but that also seems clunky. The most natural way for me to solve this problem would be to simply situate all the Javascript which currently lives in external files, in the <head> of the page. In that way I could generate custom Javascript methods without having to pass around as many parameters. Other than readability, I'm struggling to see what benefit there is to storing Javascript externally. It seems like it makes the already weak marriage between HTML/DOM and Javascript all the more distant. I've seen some people suggest that I leave the Javascript external, but do set various "custom" variables on the page itself, for example, in PHP: <script type="text/javascript"> var primaryKey = <?php print $primaryKey; ?>; </script> <script type="text/javascript" src="my-external-js-file-depending-on-primaryKey-being-set.js"></script> How is this any better than just putting all the Javascript on the page in the first place? There HTML and Javascript are still strongly dependent on each other.

    Read the article

  • MSI Installer start auto-repair when service starts

    - by Josh Clark
    I have a WiX based MSI that installs a service and some shortcuts (and lots of other files that don't). The shortcut is created as described in the WiX docs with a registry key under HKCU as the key file. This is an all users install, but to get past ICE38, this registry key has to be under the current user. When the service starts (it runs under the SYSTEM account) it notices that that registry key isn't valid (at least of that user) and runs the install again to "repair". In the Event Log I get MsiInstaller Events 1001 and 1004 showing that "The resource 'HKEY_CURRENT_USER\SOFTWARE\MyInstaller\Foo' does not exist." This isn't surprising since the SYSTEM user wouldn't have this key. I turned on system wide MSI logging and the auto-repair created its log file in the C:\Windows\Temp folder rather than a specific user's TEMP folder which seems to imply the current user was SYSTEM (plus the log file shows the "Calling process" to be my service). Is there something I can do to disable the auto-repair functionality? Am I doing something wrong or breaking some MSI rule? Any hints on where to look next?

    Read the article

  • What's wrong with my code? (pdcurses/getmaxyx)

    - by flarn2006
    It gives me an access violation on the getmaxyx line (second line in the main function) and also gives me these two warnings: LINK : warning LNK4049: locally defined symbol "_stdscr" imported LINK : warning LNK4049: locally defined symbol "_SP" imported Yes, it's the same code as in another question I asked, it's just that I'm making it more clear. And yes, I have written programs with pdcurses before with no problems. #include <time.h> #include <curses.h> #include "Ball.h" #include "Paddle.h" #include "config.h" int main(int argc, char *argv[]) { int maxY, maxX; getmaxyx(stdscr, maxY, maxX); Paddle *paddleLeft = new Paddle(0, KEY_L_UP, KEY_L_DOWN); Paddle *paddleRight = new Paddle(maxX, KEY_R_UP, KEY_R_DOWN); Ball *ball = new Ball(paddleLeft, paddleRight); int key = 0; initscr(); cbreak(); noecho(); curs_set(0); while (key != KEY_QUIT) { key = getch(); paddleLeft->OnKeyPress(key); paddleRight->OnKeyPress(key); } endwin(); return 0; }

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in MSSQL2008

    - by bodziec
    Hi, I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

  • How to store an inventory using hashtables?

    - by Harm De Weirdt
    Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

    Read the article

  • Design for tagging system in GAE-J

    - by tempy
    I need a simple tagging system in GAE-J. As I see it, the entity that is being tagged should have a collection of keys referring to the tags with which it's associated. A tag entity should simply contain the tag string itself, and a collection of keys pointing to the entities associated with the tag. When an entity's list of tags is altered, the system will create a new tag if the tag is unknown, and then append the entity's key to that tag's key collection. If the tag already exists, then the entity's key is simply appended to the tag's key collection. This seems relatively straight-forward and uncontroversial to me, but I would like some feedback on this design, just to be sure.

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

  • Python to C# with openSSL requirement

    - by fonix232
    Hey there again! Today I ran into a problem when I was making a new theme creator for chrome. As you may know, Chrome uses a "new" file format, called CRX, to manage it's plugins and themes. It is a basic zip file, but a bit modified: "Cr24" + derkey + signature + zipFile And here comes the problem. There are only two CRX creators, written in Ruby or Python. I don't know neither language too much (had some basic experience in Python though, but mostly with PyS60), so I would like to ask you to help me convert this python app to a C# class. Also, here is the source of crxmake.py: #!/usr/bin/python # Cribbed from http://github.com/Constellation/crxmake/blob/master/lib/crxmake.rb # and http://src.chromium.org/viewvc/chrome/trunk/src/chrome/tools/extensions/chromium_extension.py?revision=14872&content-type=text/plain&pathrev=14872 # from: http://grack.com/blog/2009/11/09/packing-chrome-extensions-in-python/ import sys from array import * from subprocess import * import os import tempfile def main(argv): arg0,dir,key,output = argv # zip up the directory input = dir + ".zip" if not os.path.exists(input): os.system("cd %(dir)s; zip -r ../%(input)s . -x '.svn/*'" % locals()) else: print "'%s' already exists using it" % input # Sign the zip file with the private key in PEM format signature = Popen(["openssl", "sha1", "-sign", key, input], stdout=PIPE).stdout.read(); # Convert the PEM key to DER (and extract the public form) for inclusion in the CRX header derkey = Popen(["openssl", "rsa", "-pubout", "-inform", "PEM", "-outform", "DER", "-in", key], stdout=PIPE).stdout.read(); out=open(output, "wb"); out.write("Cr24") # Extension file magic number header = array("l"); header.append(2); # Version 2 header.append(len(derkey)); header.append(len(signature)); header.tofile(out); out.write(derkey) out.write(signature) out.write(open(input).read()) os.unlink(input) print "Done." if __name__ == '__main__': main(sys.argv) Please could you help me?

    Read the article

  • MySQL DDL error creating tables

    - by Alexandstein
    I am attempting to create tables for a MySQL database, but I am having some syntactical issues. It would seem that syntax checking is behaving differently between tables for some reason. While I've gotten all the other tables to go through, the table, 'stock' doesn't seem to be working, despite seeming to use the same syntax patterns. CREATE TABLE users ( user_id SMALLINT UNSIGNED NOT NULL AUTO_INCREMENT, username VARCHAR(30) NOT NULL, password CHAR(41) NOT NULL, date_joined DATETIME NOT NULL, funds DOUBLE UNSIGNED NOT NULL, PRIMARY KEY(user_id), UNIQUE KEY(username) ); CREATE TABLE owned_stocks ( id SMALLINT UNSIGNED NOT NULL AUTO_INCREMENT, user_id SMALLINT UNSIGNED NOT NULL, paid_price DOUBLE UNSIGNED NOT NULL, quantity MEDIUMINT UNSIGNED NOT NULL, purchase_date DATETIME NOT NULL, PRIMARY KEY(id) ); CREATE TABLE tracking_stocks ( ticker VARCHAR(5) NOT NULL, user_id SMALLINT UNSIGNED NOT NULL, PRIMARY KEY(ticker) ); CREATE TABLE stocks ( ticker VARCHAR(5) NOT NULL, last DOUBLE UNSIGNED NOT NULL, high DOUBLE UNSIGNED NOT NULL, low DOUBLE UNSIGNED NOT NULL, company_name VARCHAR(30) NOT NULL, last_updated INT UNSIGNED NOT NULL, change DOUBLE NOT NULL, percent_change DOUBLE NOT NULL, PRIMARY KEY(ticker) ); Am I just missing a really obvious syntactical issue? ERROR: #1064 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'change DOUBLE NOT NULL, percent_change DOUBLE NOT NULL, last DOUBLE' at line 4

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • A scheme for expiring downloaded content?

    - by Chad Johnson
    I am going to offer a web API service that allows users to download and "rent" content for a monthly subscription fee. The API will either be open to everyone or possibly just select parties (not sure yet). Each developer must agree to a license, and they receive a developer key for their person. Each software application will have its own key as well. So then end-users will download the software which will interact with my service's API. Each user will have a key for each application as well (probably using OAuth). Content will be cached on first download and accessible offline via just the third-party application that cached the content. If a user cancels their subscription, I plan on doing the following: Deactivate the user's OAuth key for all applications. Do not allow the user's account to download new content via the API (and subsequently any software that uses the API). Now, the big question is: how do I make content expire if they cancel their subscription? If they cancel, they should not have access to content anymore. Here are ideas I've thought of (some of these are half-solutions, not yet fully fleshed out): Require that applications encrypt downloaded content using the user's OAuth key, making it available to only the application. This will prevent most users from going to the cache directory and just copying and keeping files. Update the user's key once a month, forcing content to re-cache on a monthly basic. Users could then access content for a month after they cancel their subscription. Require applications to "phone home" [to the service] periodically and check whether the user's subscription has terminated. If so, require in the API developer license that applications expire cache. If it is found that applications do not comply, their keys (and possibly keys for all developers) are permanently deactivated as a consequence. One major worry is that some applications may blatantly ignore constraints of the license. Is it generally acceptable to rely on applications abiding by the licensing constraints? Bad idea? Any other ideas? Maybe a way to make content auto-expire after x days? Something else? I'm open to out-of-the-box ideas.

    Read the article

  • atk4 advanced crud?

    - by thindery
    I have the following tables: -- ----------------------------------------------------- -- Table `product` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `product` ( `id` INT NOT NULL AUTO_INCREMENT , `productName` VARCHAR(255) NULL , `s7location` VARCHAR(255) NULL , PRIMARY KEY (`id`) ) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `pages` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `pages` ( `id` INT NOT NULL AUTO_INCREMENT , `productID` INT NULL , `pageName` VARCHAR(255) NOT NULL , `isBlank` TINYINT(1) NULL , `pageOrder` INT(11) NULL , `s7page` INT(11) NULL , PRIMARY KEY (`id`) , INDEX `productID` (`productID` ASC) , CONSTRAINT `productID` FOREIGN KEY (`productID` ) REFERENCES `product` (`id` ) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `field` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `field` ( `id` INT NOT NULL AUTO_INCREMENT , `pagesID` INT NULL , `fieldName` VARCHAR(255) NOT NULL , `fieldType` VARCHAR(255) NOT NULL , `fieldDefaultValue` VARCHAR(255) NULL , PRIMARY KEY (`id`) , INDEX `id` (`pagesID` ASC) , CONSTRAINT `pagesID` FOREIGN KEY (`pagesID` ) REFERENCES `pages` (`id` ) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; I have gotten CRUD to work on the 'product' table. //addproduct.php class page_addproduct extends Page { function init(){ parent::init(); $crud=$this->add('CRUD')->setModel('Product'); } } This works. but I need to get it so that when a new product is created it basically allows me to add new rows into the pages and field tables. For example, the products in the tables are a print product(like a greeting card) that has multiple pages to render. Page 1 may have 2 text fields that can be customized, page 2 may have 3 text fields, a slider to define text size, and a drop down list to pick a color, and page 3 may have five text fields that can all be customized. All three pages (and all form elements, 12 in this example) are associated with 1 product. So when I create the product, could i add a button to create a page for that product, then within the page i can add a button to add a new form element field? I'm still somewhat new to this, so my db structure may not be ideal. i'd appreciate any suggestions and feedback! Could someone point me toward some information, tutorials, documentation, ideas, suggestions, on how I can implement this?

    Read the article

  • I made a horrible loop.... help fix my logic please

    - by Webnet
    I know I'm doing this a bad way... but I'm having trouble seeing any alternatives. I have an array of products that I need to select 4 of randomly. $rawUpsellList is an array of all of the possible upsells based off of the items in their cart. Each value is a product object. I know this is horribly ugly code but I don't see an alternative now.... someone please put me out of my misery so this code doesn't make it to production..... $rawUpsellList = array(); foreach ($tru->global->cart->getItemList() as $item) { $product = $item->getProduct(); $rawUpsellList = array_merge($rawUpsellList, $product->getUpsellList()); } $upsellCount = count($rawUpsellList); $showItems = 4; if ($upsellCount < $showItems) { $showItems = $upsellCount; } $maxLoop = 20; $upsellList = array(); for ($x = 0; $x <= $showItems; $x++) { $key = rand(0, $upsellCount); if (!array_key_exists($key, $upsellList) && is_object($rawUpsellList[$key])) { $upsellList[$key] = $rawUpsellList[$key]; $x++; } if ($x == $maxLoop) { break; } } Posting this code was highly embarassing...

    Read the article

< Previous Page | 214 215 216 217 218 219 220 221 222 223 224 225  | Next Page >