Search Results

Search found 15021 results on 601 pages for 'location aware'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 22/601 | < Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >

  • Call the official *Settings* app from my app on iPhone(Location Service)

    - by zt9788
    At one point in my app, I would like to redirect the user to the official Settings app. If possible, I also want go straight to the Location service section within the Settings app. i see Call the official *Settings* app from my app on iPhone but In iPhone4 the following code does not respond(my ios version 5.1.1): [[UIApplication sharedApplication] openURL:[NSURL URLWithString:@"prefs:root=LOCATION_SERVICES"]];//1 call Location service [[UIApplication sharedApplication] openURL:[NSURL URLWithString:@"prefs:root=WIFI"]];//2 //call wifi [[UIApplication sharedApplication] openURL:[NSURL URLWithString:@"prefs:root=General&path=Network"]];//3

    Read the article

  • HYPER-V R2 Can not mount ISO from network location (UNC Path)

    - by Entity_Razer
    So, as the name suggest I'm trying to mount a ISO from a network share using the UNC path to a HYPER-V R2 Cluster. This is a pure Demo / test case setup with: 2x HYPER-V R2 1X NAS/iSCSI CSV Cluster Management is happening through the MMC with RSAT tools. So what i've done so far is: Set up the cluster and configure Quorum, add CSV Shares and disks, set up 1 Virtual Machine on the Hyper-1 node. What i'm trying to do is, you go to settings --- DVD Drive --- use network location ---- Pick ISO file and press "apply". Error I'm getting is either "User account does not have rights to mount iso". I changed that or stopped getting that message when I went to the HYPER-V Node settings and tabbed on: "Use Default Credentials Automatically". Now I stopped getting the "user does not have right..." message but I get the following: Error applying DVD Drive Changes Failed to remove device microsoft synthetic DVD Drive:" the specified network resource or device is no longer available" I've google'd the problem but am unable to find a solution. Anyone here able to help me out ? Much abbliged !

    Read the article

  • Kickstart installation from USB -- Kickstart location

    - by dooffas
    After managing to get a Fedora ISO to rebuild successfully (for a USB stick) after adding a kickstart file (http://serverfault.com/questions/548405/), I now have an issue with locating the kickstart file on the USB media. When this is done from a CDROM you can simply kickckstart by adding this parameter to boot: linux ks=cdrom This will kickstart (providing the kickstart file is named ks.cfg and is in the root of the disk). Now, obviously this will be different for the USB drive, so from my research, I assumed that this line would do the job: linux ks=hd:sdb1:/ks.cfg Evidently this does not work. I get an error informing me this drive is already mounted and cannot be remounted. EDIT: Actual error message: mount: /dev/sdb1 is already mounted or /run/install/tmpmnt0 busy Warning: Can't get kickstart from /dev/sdb1:/ks.cfg To test that the syntax was correct I placed the kickstart file on another USB stick and loaded the same command to grab ks.cfg from the new location: linux ks=hd:sdc1:/ks.cfg This does work (providing USB sticks are mounted in order, boot - sdb1, kickstart - sdc1). The install will kickstart and complete the install with no issue. Obviously having to use 2 pen drives is somewhat frustrating and unreliable. Is there a way around this?

    Read the article

  • samba4 dc "network location cannot be reached"

    - by mitchell babies peters
    to clear the air centos 6.4? (maybe 6.3) as the server, running samba 4.0.10, trying to add a windows 7 client that has connectivity to the server. this is what windows shouts as me as it mocks my dependence on network infrastructure. "the network location cannot be reached." i have access to the domain contoller (dc) im using the dc as the domain name server (dns) already, and the name is correctly resolving, and it is correctly forwarding outbound traffic. i have nothing but self taught experience with active directory(ad) so if i am missing something obvious, please shout it out, but keep the verbal abuse to a minimum. i checked samba4DC + my error and found nothing relevant to my issue, if i missed something please point me in that direction. the weekend is just starting as i write this so i probably wont be back on to check this post for a day or three, but i might because this mystery is killing me. i followed the samba4 as a dc guide here and i supplimented gaps with this i have tested kerberos, ntp, and set my DC as the clock to sync to in my windows client and it appears to be a very small fraction of a second off so that shouldn't be it. also, firewall and selinux are both off for testing. i have also tried disabling ipv6, and cleared the registry of ipv6 records (allegedly the default samba4 as a DC runs as windows server 2003 which allegedly does not support or tolerate the existence of ipv6, fair warning, i heard this on the internet so it is probably a lie) i have tried a few other things that i have forgotten because i have been doing this for a day and a half now. ideas welcome. suggestions for alternatives are also welcome, as long as they are free. i was given a budget of $0 dollars and told to implement active directory (no prior knowledge of active directory at that point).

    Read the article

  • Moving Farm to co-location hosting - network settings requirements

    - by Saariko
    I am moving my farm (2 Dell's R620) to a co-location hosting service. I am trying to figure out the secure way to have my network settings The requirements are: VM1 is the working HOST, includes: esxi 5.1, vSphere, 4 clients (w2008r2 all) VM2 has esxi 5.1 installed, and a single machine with Veeam Backup and copy 6.5 - keeping a copy of VM1 clients on the VM2 internal storage (this solution is due to a very small budget - in case of failure on Host 1 - can redirect IP's) Only 2 VM clients require network address and access from the WWAN - ISP provides IP's range for them (with Gateway and DNS) I need connection to the iDrac's from my office (option to create a VPN-SSL tunnel) Connection to the vSphere appliances I want to be able to RDP to the VM clients The current configuration is that each host has the iDrac dedicated nic connected , and another (NIC #1) connected - with a static IP on 192.168.3.x The iDrac's have a static IP from the same network range (19.168.3.x) It will look something like this: My thoughts: On NIC#2 of both hosts I will connected a crossed cable I will give each VM clients that needs internet access a 2ndry VM network with the assigned IP from the ISP open only to web - can not access from the My Question: Should I give IP's (external) to the machines who DO NOT require WWAN Access? - I can't see a way to RDP to them directly if not. Should I use the crossed cable? or just plug NIC #2 to the switch? Will this setup even work? What do I need to verify? What Virtual nic's and/or switches should I create on the Hosts?

    Read the article

  • SkyDrive broken after upgrade to Windows 8.1: "This location can't be found, please try later"

    - by avo
    Upgrading from Windows 8 to Windows 8.1 via the Store upgrade path has screwed my SkyDrive. The C:\Users\<user name>\SkyDrive folder is empty (it only has single file desktop.ini). When I open the native (Store) SkyDrive app, I see "This location can't be found, please try later". I'm glad to still have my files alive online in my SkyDrive account. I tried disconneting from / reconnecting to my Microsoft Account with no luck. Anyone has an idea on how to fix this without reinstalling/refreshing Windows 8.1? From Event Viewer: Faulting application name: skydrive.exe, version: 6.3.9600.16412, time stamp: 0x5243d370 Faulting module name: unknown, version: 0.0.0.0, time stamp: 0x00000000 Exception code: 0x00000000 Fault offset: 0x0000000000000000 Faulting process ID: 0x4e8 Faulting application start time: 0x01cece256589c7ee Faulting application path: C:\Windows\System32\skydrive.exe Faulting module path: unknown Report ID: {...} Faulting package full name: Faulting package-relative application ID: Also: The machine-default permission settings do not grant Local Activation permission for the COM Server application with CLSID {C2F03A33-21F5-47FA-B4BB-156362A2F239} and APPID {316CDED5-E4AE-4B15-9113-7055D84DCC97} to the user NT AUTHORITY\LOCAL SERVICE SID (S-1-5-19) from address LocalHost (Using LRPC) running in the application container Unavailable SID (Unavailable). This security permission can be modified using the Component Services administrative tool. Never was a big fan of in-place upgrade anyway, but this time it was a machine which I use for work, with a lot of stuff already installed on it. Shouldn't have tried to upgrade it in the first place, but was convinced Windows 8.1 is a solid update. Another lesson learnt.

    Read the article

  • Default /server-status location not inheriting in Apache

    - by rmalayter
    I'm having a problem getting /server-status to work Apache 2.2.14 on Ubuntu Server 10.04.1. The default symlinks for status.load and status.conf are present in /etc/apache2/mods-enabled. The status.conf does include the location /server-status and appropriate allow/deny directives. However, the only vhost I have in sites-enabled looks like this. The idea is to proxy anything with a Tomcat URL to a cluster of tomcats, and anything else to an IIS box. However, this seems to result in requests to /server-status being sent to IIS. Copying the /server-status in explicitly to the Vhost configuration doesn't seem to help, no matter what order I use. Is it possible to include /server-status do this within a vhost configuration that has a "default" proxy rule?: <VirtualHost *:80> ServerAdmin webmaster@localhost DocumentRoot /var/www Header add Set-Cookie "ROUTEID=.%{BALANCER_WORKER_ROUTE}e; path=/" env=BALANCER_ROUTE_CHANGED <Proxy balancer://tomcatCluster> BalancerMember ajp://qa-app1:8009 route=1 BalancerMember ajp://qa-app2:8009 route=2 ProxySet stickysession=ROUTEID </Proxy> <ProxyMatch "^/(mytomcatappA|mytomcatappB)/(.*)" > ProxyPassMatch balancer://tomcatCluster/$1/$2 </ProxyMatch> #proxy anything that's not a tomcat URL to IIS on port 80 <Proxy /> ProxyPass http://qa-web1/ </Proxy>

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • How to get location of sprite placed on rotating circle in cocos2d android?

    - by Real_steel4819
    I am developing a game using cocos2d and i got stuck here when finding location of sprite placed on rotating circle on background, so that when i hit at certain position on circle its not getting hit at wanted position,but its going away from it and placing target there.I tried printing the position of hit on spriteMoveFinished() and ccTouchesEnded(). Its giving initial position and not rotated position. CGPoint location = CCDirector.sharedDirector().convertToGL(CGPoint.ccp(event.getX(), event.getY())); This is what i am using to get location.

    Read the article

  • How to create Large resumable download from a secured location .NET

    - by Kelvin H
    I need to preface I'm not a .NET coder at all, but to get partial functionality, I modified a technet chunkedfilefetch.aspx script that uses chunked Data Reading and writing Streamed method of doing file transfer, to get me half-way. iStream = New System.IO.FileStream(path, System.IO.FileMode.Open, _ IO.FileAccess.Read, IO.FileShare.Read) dataToRead = iStream.Length Response.ContentType = "application/octet-stream" Response.AddHeader("Content-Length", file.Length.ToString()) Response.AddHeader("Content-Disposition", "attachment; filename=" & filedownload) ' Read and send the file 16,000 bytes at a time. ' While dataToRead 0 If Response.IsClientConnected Then length = iStream.Read(buffer, 0, 16000) Response.OutputStream.Write(buffer, 0, length) Response.Flush() ReDim buffer(16000) ' Clear the buffer ' dataToRead = dataToRead - length Else ' Prevent infinite loop if user disconnects ' dataToRead = -1 End If End While This works great on files up to 2GB and is fully functioning now.. But only one problem it doesn't allow for resume. I took the original code called it fetch.aspx and pass an orderNUM through the URL. fetch.aspx&ordernum=xxxxxxx It then reads the filename/location from the database occording to the ordernumber, and chunks it out from a secured location NOT under the webroot. I need a way to make this resumable, by the nature of the internet and large files people always get disconnected and would like to resume where they left off. But any resumable articles i've read, assume the file is within the webroot.. ie. http://www.devx.com/dotnet/Article/22533/1954 Great article and works well, but I need to stream from a secured location. I'm not a .NET coder at all, at best i can do a bit of coldfusion, if anyone could help me modify a handler to do this, i would really appreciate it. Requirements: I Have a working fetch.aspx script that functions well and uses the above code snippet as a base for the streamed downloading. Download files are large 600MB and are stored in a secured location outside of the webroot. Users click on the fetch.aspx to start the download, and would therefore be clicking it again if it was to fail. If the ext is a .ASPX and the file being sent is a AVI, clicking on it would completely bypass an IHTTP handler mapped to .AVI ext, so this confuses me From what I understand the browser will read and match etag value and file modified date to determine they are talking about the same file, then a subsequent accept-range is exchanged between the browser and IIS. Since this dialog happens with IIS, we need to use a handler to intercept and respond accordingly, but clicking on the link would send it to an ASPX file which the handeler needs to be on an AVI fiel.. Also confusing me. If there is a way to request the initial HTTP request header containing etag, accept-range into the normal .ASPX file, i could read those values and if the accept-range and etag exist, start chunking at that byte value somehow? but I couldn't find a way to transfer the http request headers since they seem to get lost at the IIS level. OrderNum which is passed in the URL string is unique and could be used as the ETag Response.AddHeader("ETag", request("ordernum")) Files need to be resumable and chunked out due to size. File extensions are .AVI so a handler could be written around it. IIS 6.0 Web Server Any help would really be appreciated, i've been reading and reading and downloading code, but none of the examples given meet my situation with the original file being streamed from outside of the webroot. Please help me get a handle on these httphandlers :)

    Read the article

  • how to remove location block from $uri in nginx configuration?

    - by Jason
    I have a rewrite in my ngix conf file that works properly except it seems to include the location block as part of the $uri variable. I only want the path after the location block. My current config code is: location /cargo { try_files $uri $uri/ /cargo/index.php?_REWRITE_COMMAND=$uri&args; } Using an example url of http://localhost/cargo/testpage the redirect works, however the value of the "_REWRITE_COMMAND" parameter received by my php file is "/cargo/testpage". I need to strip off the location block and just have "testpage" as the $uri I am pretty sure there is a regex syntax to split the $uri and assign it to a new variable using $1 $2 etc, but I can't find any example to do just a variable assignment using a regex that is not part of a rewrite statement. I've been looking and trying for hours and I just can't seem to get past this last step. I also know I could just strip this out on the application code, but the reason I want to try to fix it in the nginx conf is for compatibility reasons as it also runs on Apache. I also should say that I have figured out a really hacky way to do it, but it involves an "if" statement to check for file existance and the documentation specifically says not to do it that way. -- UPDATE: ANSWERED BY theuni: The regex goes in the location block definition. one note of caution is that php handler location needs to be ABOVE this location, otherwise you will get a server error because it goes into an infinite redirect loop location ~ ^/cargo/(.*) { try_files $1 /cargo/$1/ /cargo/index.php?_REWRITE_COMMAND=$1&args; }

    Read the article

  • How mail tracking works?

    - by abc
    whoreadme is the web site that helps to track mail reader's location as well as it acknowledges when reader opens mail. What is the concept of detection behind this?

    Read the article

  • Marking Current Location on Map, Android

    - by deewangan
    Hi every one, i followed some tutorials to create an application that shows the current position of the user on the map with a marking. but for some reasons i can't get to work the marking part? the other parts works well, but whenever i add the marking code the application crashes. i hope someone could help me.here is the code: public class LocationActivity extends MapActivity { /** Called when the activity is first created. */ private MapView mapView; private LocationManager lm; private LocationListener ll; private MapController mc; GeoPoint p = null; Drawable defaultMarker = null; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mapView = (MapView)findViewById(R.id.mapView); //show zoom in/out buttons mapView.setBuiltInZoomControls(true); //Standard view of the map(map/sat) mapView.setSatellite(false); //get controller of the map for zooming in/out mc = mapView.getController(); // Zoom Level mc.setZoom(18); MyLocationOverlay myLocationOverlay = new MyLocationOverlay(); List<Overlay> list = mapView.getOverlays(); list.add(myLocationOverlay); lm = (LocationManager)getSystemService(Context.LOCATION_SERVICE); ll = new MyLocationListener(); lm.requestLocationUpdates( LocationManager.GPS_PROVIDER, 0, 0, ll); //Get the current location in start-up GeoPoint initGeoPoint = new GeoPoint( (int)(lm.getLastKnownLocation( LocationManager.GPS_PROVIDER) .getLatitude()*1000000), (int)(lm.getLastKnownLocation( LocationManager.GPS_PROVIDER) .getLongitude()*1000000)); mc.animateTo(initGeoPoint); } protected class MyLocationOverlay extends com.google.android.maps.Overlay { @Override public boolean draw(Canvas canvas, MapView mapView, boolean shadow, long when) { Paint paint = new Paint(); super.draw(canvas, mapView, shadow); // Converts lat/lng-Point to OUR coordinates on the screen. Point myScreenCoords = new Point(); mapView.getProjection().toPixels(p, myScreenCoords); paint.setStrokeWidth(1); paint.setARGB(255, 255, 255, 255); paint.setStyle(Paint.Style.STROKE); Bitmap bmp = BitmapFactory.decodeResource(getResources(), R.drawable.push); canvas.drawBitmap(bmp, myScreenCoords.x, myScreenCoords.y, paint); canvas.drawText("I am here...", myScreenCoords.x, myScreenCoords.y, paint); return true; } } private class MyLocationListener implements LocationListener{ public void onLocationChanged(Location argLocation) { // TODO Auto-generated method stub GeoPoint myGeoPoint = new GeoPoint( (int)(argLocation.getLatitude()*1000000), (int)(argLocation.getLongitude()*1000000)); /* * it will show a message on * location change Toast.makeText(getBaseContext(), "New location latitude [" +argLocation.getLatitude() + "] longitude [" + argLocation.getLongitude()+"]", Toast.LENGTH_SHORT).show(); */ mc.animateTo(myGeoPoint); } public void onProviderDisabled(String provider) { // TODO Auto-generated method stub } public void onProviderEnabled(String provider) { // TODO Auto-generated method stub } public void onStatusChanged(String provider, int status, Bundle extras) { // TODO Auto-generated method stub } } protected boolean isRouteDisplayed() { return false; } } here is the logcat: 01-19 05:31:43.011: DEBUG/AndroidRuntime(759): >>>>>>>>>>>>>> AndroidRuntime START <<<<<<<<<<<<<< 01-19 05:31:43.011: DEBUG/AndroidRuntime(759): CheckJNI is ON 01-19 05:31:43.411: DEBUG/AndroidRuntime(759): --- registering native functions --- 01-19 05:31:43.431: INFO/jdwp(759): received file descriptor 19 from ADB 01-19 05:31:43.431: INFO/jdwp(759): Ignoring second debugger -- accepting and dropping 01-19 05:31:44.531: INFO/ActivityManager(583): Starting activity: Intent { flg=0x10000000 cmp=pro.googlemapp/.LocationActivity } 01-19 05:31:44.641: DEBUG/AndroidRuntime(759): Shutting down VM 01-19 05:31:44.641: DEBUG/dalvikvm(759): DestroyJavaVM waiting for non-daemon threads to exit 01-19 05:31:44.641: DEBUG/dalvikvm(759): DestroyJavaVM shutting VM down 01-19 05:31:44.641: DEBUG/dalvikvm(759): HeapWorker thread shutting down 01-19 05:31:44.651: DEBUG/dalvikvm(759): HeapWorker thread has shut down 01-19 05:31:44.651: DEBUG/jdwp(759): JDWP shutting down net... 01-19 05:31:44.651: DEBUG/jdwp(759): +++ peer disconnected 01-19 05:31:44.651: INFO/dalvikvm(759): Debugger has detached; object registry had 1 entries 01-19 05:31:44.661: DEBUG/dalvikvm(759): VM cleaning up 01-19 05:31:44.681: INFO/ActivityManager(583): Start proc pro.googlemapp for activity pro.googlemapp/.LocationActivity: pid=770 uid=10025 gids={3003} 01-19 05:31:44.761: DEBUG/dalvikvm(759): LinearAlloc 0x0 used 676436 of 4194304 (16%) 01-19 05:31:44.801: INFO/jdwp(770): received file descriptor 20 from ADB 01-19 05:31:44.822: INFO/dalvikvm(770): ignoring registerObject request in thread=3 01-19 05:31:44.851: INFO/jdwp(770): Ignoring second debugger -- accepting and dropping 01-19 05:31:44.851: ERROR/jdwp(770): Failed writing handshake bytes: Broken pipe (-1 of 14) 01-19 05:31:44.851: INFO/dalvikvm(770): Debugger has detached; object registry had 0 entries 01-19 05:31:45.320: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.320: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.340: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.781: DEBUG/LocationManager(770): Constructor: service = android.location.ILocationManager$Stub$Proxy@4379d9f0 01-19 05:31:45.791: WARN/GpsLocationProvider(583): Duplicate add listener for uid 10025 01-19 05:31:45.791: DEBUG/GpsLocationProvider(583): setMinTime 0 01-19 05:31:45.791: DEBUG/GpsLocationProvider(583): startNavigating 01-19 05:31:45.831: INFO/jdwp(770): received file descriptor 27 from ADB 01-19 05:31:46.001: INFO/MapActivity(770): Handling network change notification:CONNECTED 01-19 05:31:46.001: ERROR/MapActivity(770): Couldn't get connection factory client 01-19 05:31:46.451: DEBUG/dalvikvm(770): GC freed 4539 objects / 298952 bytes in 118ms 01-19 05:31:46.470: DEBUG/AndroidRuntime(770): Shutting down VM 01-19 05:31:46.470: WARN/dalvikvm(770): threadid=3: thread exiting with uncaught exception (group=0x4001aa28) 01-19 05:31:46.481: ERROR/AndroidRuntime(770): Uncaught handler: thread main exiting due to uncaught exception 01-19 05:31:46.541: ERROR/AndroidRuntime(770): java.lang.NullPointerException 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:58) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:48) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at pro.googlemapp.LocationActivity$MyLocationOverlay.draw(LocationActivity.java:101) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.OverlayBundle.draw(OverlayBundle.java:42) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.MapView.onDraw(MapView.java:476) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6274) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1526) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1524) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6277) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.widget.FrameLayout.draw(FrameLayout.java:352) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1526) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1524) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6277) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.widget.FrameLayout.draw(FrameLayout.java:352) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1883) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.draw(ViewRoot.java:1332) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.performTraversals(ViewRoot.java:1097) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.handleMessage(ViewRoot.java:1613) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.os.Handler.dispatchMessage(Handler.java:99) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.os.Looper.loop(Looper.java:123) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.app.ActivityThread.main(ActivityThread.java:4203) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at java.lang.reflect.Method.invokeNative(Native Method) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at java.lang.reflect.Method.invoke(Method.java:521) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:791) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:549) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at dalvik.system.NativeStart.main(Native Method) 01-19 05:31:46.551: INFO/Process(583): Sending signal. PID: 770 SIG: 3 01-19 05:31:46.581: INFO/dalvikvm(770): threadid=7: reacting to signal 3 01-19 05:31:46.661: INFO/dalvikvm(770): Wrote stack trace to '/data/anr/traces.txt' 01-19 05:31:46.871: INFO/ARMAssembler(583): generated scanline__00000077:03515104_00000000_00000000 [ 27 ipp] (41 ins) at [0x2c69c8:0x2c6a6c] in 973448 ns 01-19 05:31:46.911: INFO/ARMAssembler(583): generated scanline__00000077:03515104_00001001_00000000 [ 64 ipp] (84 ins) at [0x2c6a70:0x2c6bc0] in 1985378 ns 01-19 05:31:49.881: INFO/Process(770): Sending signal. PID: 770 SIG: 9 01-19 05:31:49.931: INFO/ActivityManager(583): Process pro.googlemapp (pid 770) has died. 01-19 05:31:49.941: WARN/GpsLocationProvider(583): Unneeded remove listener for uid 1000 01-19 05:31:49.941: DEBUG/GpsLocationProvider(583): stopNavigating 01-19 05:31:49.951: INFO/WindowManager(583): WIN DEATH: Window{438891c0 pro.googlemapp/pro.googlemapp.LocationActivity paused=false} 01-19 05:31:50.111: WARN/UsageStats(583): Unexpected resume of com.android.launcher while already resumed in pro.googlemapp 01-19 05:31:50.200: WARN/InputManagerService(583): Got RemoteException sending setActive(false) notification to pid 770 uid 10025

    Read the article

  • Distributing IronPython applications - how to detect the location of ipyw.exe

    - by Kragen
    I'm thinking of developing a small application using Iron python, however I want to distribute my app to non-techies and so ideally I want to be able to give them a standard shortcut to my application along with the instructions that they need to install IronPython first. If possible I even want my shortcut to detect if IronPython is not present and display a suitable warning if this is the case (which I can do using a simple VbScript) The trouble is that IronPython doesn't place itself in the %PATH% environment variable, and so if IronPython is installed to a nonstandard location my shortcut don't work. Now I could also tell my users "If you install IronPython to a different location you need to go and edit this shortcut and...", but this is all getting far too technical for my target audience. Is there any foolproof way of distributing my IronPython dependent app?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >