Search Results

Search found 1157 results on 47 pages for 'recursive descent'.

Page 22/47 | < Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >

  • No idea how to solve SICP exercise 1.11

    - by Javier Badia
    This is not homework. Exercise 1.11: A function f is defined by the rule that f(n) = n if n<3 and f(n) = f(n - 1) + 2f(n - 2) + 3f(n - 3) if n 3. Write a procedure that computes f by means of a recursive process. Write a procedure that computes f by means of an iterative process. Implementing it recursively is simple enough. But I couldn't figure out how to do it iteratively. I tried comparing with the Fibonacci example given, but I didn't know how to use it as an analogy. So I gave up (shame on me) and Googled for an explanation, and I found this: (define (f n) (if (< n 3) n (f-iter 2 1 0 n))) (define (f-iter a b c count) (if (< count 3) a (f-iter (+ a (* 2 b) (* 3 c)) a b (- count 1)))) After reading it, I understand the code and how it works. But what I don't understand is the process needed to get from the recursive defintion of the function to this. I don't get how the code formed in someone's head. Could you explain the thought process needed to arrive at the solution?

    Read the article

  • Running a Model::find in for loop in cakephp v1.3

    - by Gaurav Sharma
    Hi all, How can I achieve the following result in cakephp: In my application a Topic is related to category, category is related to city and city is finally related to state in other words: topic belongs to category, category belongs to city , city belongs to state.. Now in the Topic controller's index action I want to find out all the topics and it's city and state. How can I do this. I can easily do this using a custom query ($this-Model-query() function ) but then I will be facing pagination difficulties. I tried doing like this function index() { $this->Topic->recursive = 0; $topics = $this->paginate(); for($i=0; $i<count($topics);$i++) { $topics[$i]['City'] = $this->Topic->Category->City->find('all', array('conditions' => array('City.id' => $topics[$i]['Category']['city_id']))); } $this->set(compact('messages')); } The method that I have adopted is not a good one (running query in a loop) Using the recursive property and setting it to highest value (2) will degrade performance and is not going to yield me state information. How shall I solve this ? Please help Thanks

    Read the article

  • How to work with CTE. There is some error related to anchor.

    - by Shantanu Gupta
    I am creating a hierarchy representaion of a column. But an error occurs Details are Msg 240, Level 16, State 1, Line 1 Types don't match between the anchor and the recursive part in column "DISPLAY" of recursive query "CTE". I know there is some typecasting error. But I dont know how to remove error. Please just dont only sort out my error. I need explanation why this error is coming. When this error occurs. I am trying to sort table on the basis of sort col that i m introducing. I want to add '-' at every level and want to sort accordingly. Please help WITH CTE (PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH) AS ( SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, '-' AS DISPLAY, '--' AS SORT, 0 AS DEPTH FROM dbo.L_CATEGORY_TYPE WHERE FK_CATEGORY_ID IS NULL UNION ALL SELECT T.PK_CATEGORY_ID, T.[DESCRIPTION], T.FK_CATEGORY_ID, CAST(DISPLAY+T.[DESCRIPTION] AS VARCHAR(1000)), '--' AS SORT, C.DEPTH +1 FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.PK_CATEGORY_ID = T.FK_CATEGORY_ID --SELECT T.PK_CATEGORY_ID, C.SORT+T.[DESCRIPTION], T.FK_CATEGORY_ID --, CAST('--' + C.SORT AS VARCHAR(1000)) AS SORT, CAST(DEPTH +1 AS INT) AS DEPTH --FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.FK_CATEGORY_ID = T.PK_CATEGORY_ID ) SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH FROM CTE ORDER BY SORT

    Read the article

  • C# Recursion SumOfOnlyNeg Elements

    - by Chris
    Hello, A array gets filled up with random elements (negative and positive). Now i want to calculate the sum of ONLY the postive elements. Iterative there is no problem, but in the recursion version i can only get the sum of both negative and postive. How can i "check" in the recursive version that it only sums up the Postive elements? Best Regards. Iterative version: public int IterSomPosElem(int[] tabel, int n) { n = 0; for (int i = 0; i < tabel.Length; i++) { if (tabel[i] >= 0) { n += tabel[i]; } } return n; } Recursive version atm (sums up all the elements insteed, of only the positive) public int RecuSomPosElem(int[] tabel, int n) { if(n == 1) return tabel[0]; //stopCriterium else { return (tabel[n - 1] + RecuSomPosElem(tabel, n - 1)); // how to check, so it only sums up the postive elements and "ignores" the negative elements. } }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Efficient Multiplication of Varying-Length #s [Conceptual]

    - by Milan Patel
    Write the pseudocode of an algorithm that takes in two arbitrary length numbers (provided as strings), and computes the product of these numbers. Use an efficient procedure for multiplication of large numbers of arbitrary length. Analyze the efficiency of your algorithm. I decided to take the (semi) easy way out and use the Russian Peasant Algorithm. It works like this: a * b = a/2 * 2b if a is even a * b = (a-1)/2 * 2b + a if a is odd My pseudocode is: rpa(x, y){ if x is 1 return y if x is even return rpa(x/2, 2y) if x is odd return rpa((x-1)/2, 2y) + y } I have 3 questions: Is this efficient for arbitrary length numbers? I implemented it in C and tried varying length numbers. The run-time in was near-instant in all cases so it's hard to tell empirically... Can I apply the Master's Theorem to understand the complexity...? a = # subproblems in recursion = 1 (max 1 recursive call across all states) n / b = size of each subproblem = n / 1 - b = 1 (problem doesn't change size...?) f(n^d) = work done outside recursive calls = 1 - d = 0 (the addition when a is odd) a = 1, b^d = 1, a = b^d - complexity is in n^d*log(n) = log(n) this makes sense logically since we are halving the problem at each step, right? What might my professor mean by providing arbitrary length numbers "as strings". Why do that? Many thanks in advance

    Read the article

  • git submodule pull and commit automatically on webserver

    - by Lukas Oppermann
    I have the following setup, I am working on a project project with the submodule submodule. Whenever I push changes to github it sends a post request to update.php on the server. This php file executes a git command. Without submodules I can just do a git pull and everything is fine but with submodules it is much more difficult. I have this at the moment, but it does not do what I want. I should git pull the repo and update and pull the latest version of each submodule. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -m "updating"' && git pull && git submodule foreach 'git add -A .' && git commit -m "updating to latest version including submodules" 2>&1s`; EDIT// Okay, I got it half way done. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -am "updating"; echo "updated"' && git pull && git commit -am "updating to latest version including submodules" && echo 'updated'`; The echo prevents the script to stop because of non-zero returned. It works 100% fine when I run it from the console using php update.php. When github initialized the file, or I run it from the browser it still does not work. Any ideas?

    Read the article

  • Top n items in a List ( including duplicates )

    - by Krishnan
    Trying to find an efficient way to obtain the top N items in a very large list, possibly containing duplicates. I first tried sorting & slicing, which works. But this seems unnnecessary. You shouldn't need to sort a very large list if you just want the top 20 members. So I wrote a recursive routine which builds the top-n list. This also works, but is very much slower than the non-recursive one! Question: Which is my second routine (elite2) so much slower than elite, and how do I make it faster ? My code is attached below. Thanks. import scala.collection.SeqView import scala.math.min object X { def elite(s: SeqView[Int, List[Int]], k:Int):List[Int] = { s.sorted.reverse.force.slice(0,min(k,s.size)) } def elite2(s: SeqView[Int, List[Int]], k:Int, s2:List[Int]=Nil):List[Int] = { if( k == 0 || s.size == 0) s2.reverse else { val m = s.max val parts = s.force.partition(_==m) val whole = if( parts._1.size > 1) parts._1.tail:::parts._2 else parts._2 elite2( whole.view, k-1, m::s2 ) } } def main(args:Array[String]) = { val N = 1000000/3 val x = List(N to 1 by -1).flatten.map(x=>List(x,x,x)).flatten.view println(elite2(x,20)) println(elite(x,20)) } }

    Read the article

  • Insertion into BST without header Node JAVA

    - by Petiatil
    I am working on a recursive insertion method for a BST. This function is suppose to be a recursive helper method and is in a private class called Node. The Node class is in a class called BinarySearchTree which contains an instance variable for the root. When I am trying to insert an element, I get a NullPointerException at : this.left = insert(((Node)left).element); I am unsure about why this occurs. If I understand correctly, in a BST, I am suppose to insert the item at the last spot on the path transversed. Any help is appreciated! private class Node implements BinaryNode<E> { E item; BinaryNode<E> left, right; public BinaryNode<E> insert(E item) { int compare = item.compareTo(((Node)root).item); if(root == null) { root = new Node(); ((Node)root).item = item; } else if(compare < 0) { this.left = insert(((Node)left).item); } else if(compare > 0) { this.right = insert(((Node)right).item); } return root; } }

    Read the article

  • What causes style corruption in MS Word?

    - by Phil.Wheeler
    I've had a few documents across my desk that appear to have a corrupted or recursive style for much of the body text: Char char char char char char Does anyone know what causes this and how to permanently delete this style? When I try to delete it, it disappears from the Styles and Formatting pane of Word, only to reappear later when different text is selected. Input or guidance much appreciated.

    Read the article

  • Windows: File copy/move with filename regular expressions?

    - by Ian Boyd
    i basically want to run: C:\>xcopy [0-9]{13}\.(gif|jpg|png) s:\TargetFolder /s i know xcopy doesn't support regular-express filename searches. i can't find out how to find out if PowerShell has a Cmdlet to copy files; and if it does, how to find out if it supports regular expression filename matching. Can anyone think of a way to perform a recursive file copy/move with regex filename matching?

    Read the article

  • Windows: View "all" permissions of a specific user or group

    - by peterchen
    For a Windows domain, is there a way to see for a certain user or group, where the user/group has permissions? Primarily: List which files / folders the user can access on a certain network share. (Kind of a recursive "effective permissions") However, other permissions would be cool as well. I believe I've seen such a tool in action, but I can't remember anything beyond that - so this might be a false memory. Recommendations?

    Read the article

  • Enterprise IPv6 Migration - End of proxypac ? Start of Point-to-Point ? +10K users

    - by Yohann
    Let's start with a diagram : We can see a "typical" IPv4 company network with : An Internet acces through a proxy An "Others companys" access through an dedicated proxy A direct access to local resources All computers have a proxy.pac file that indicates which proxy to use or whether to connect directly. Computers have access to just a local DNS (no name resolution for google.com for example.) By the way ... The company does not respect the RFC1918 internally and uses public addresses! (historical reason). The use of internet proxy explicitly makes it possible to not to have problem. What if we would migrate to IPv6? Step 1 : IPv6 internet access Internet access in IPv6 is easy. Indeed, just connect the proxy in Internet IPv4 and IPv6. There is nothing to do in internal network : Step 2 : IPv6 AND IPv4 in internal network And why not full IPv6 network directly? Because there is always the old servers that are not compatible IPv6 .. Option 1 : Same architecture as in IPv4 with a proxy pac This is probably the easiest solution. But is this the best? I think the transition to IPv6 is an opportunity not to bother with this proxy pac! Option 2 : New architecture with transparent proxy, whithout proxypac, recursive DNS Oh yes! In this new architecture, we have: Explicit Internet Proxy becomes a Transparent Internet Proxy Local DNS becomes a Normal Recursive DNS + authorative for local domains No proxypac Explicit Company Proxy becomes a Transparent Company Proxy Routing Internal Routers reditect IP of appx.ext.example.com to Company Proxy. The default gateway is the Transparent Internet proxy. Questions What do you think of this architecture IPv6? This architecture will reveal the IP addresses of our internal network but it is protected by firewalls. Is this a real big problem? Should we keep the explicit use of a proxy? -How would you make for this migration scenario? -And you, how do you do in your company? Thanks! Feel free to edit my post to make it better.

    Read the article

  • How can I recursively verify the permissions within a given subdirectory?

    - by Mike
    I'd like to verify that nothing within /foo/bar is chmod 777. Or, alternatively, I'd like to make sure that nothing within /foo/bar us owned by user1 or in group1. Is there any way I can recursively verify the permissions within a given subdirectory to make sure there aren't any security holes? Notice that I do not want to change all the permissions to something specific, nor do I want to change the owner to something specific, so a recursive chmod or chown won't do it... Thanks!

    Read the article

  • Oracle error when logging into database

    - by Bryan
    When I try to log into my db with a specific user I get this message. Below is from the alert log. I can login as system just fine. Anyone know how to figure out what is causing this? Thanks in advance for the help. ----- Error Stack Dump ----- ORA-00604: error occurred at recursive SQL level 1 ORA-01438: value larger than specified precision allowed for this column ORA-06512: at line 2 Oracle 10g OEL 5.5

    Read the article

  • How to give user read/write access to folders?

    - by Will
    I'm running a certain script that is using a non-root user to do the following... mkdir: cannot create directory `/srv/www/example.com/releases' *** [err :: 12.23.45.789] : Permission denied How would I allow user xyz to have permanent permissions to do so and still keep this web server secure? Also is it possible to make it recursive for all subfolders? I know its probably chmod something but I'm not that linux savy, thanks.

    Read the article

  • C++ : C++ Primer (Stanley Lipmann) or The C++ programming language (special edition)

    - by Kim
    I have a Computer Science degree (long2 time ago) .. I do know Java OOP but i am now trying to pick up C++. I do have C and of course data structure using C or pascal. I have started reading Bjarne Stroustrup book (The C++ Programming Language - Special Edition) but find it extremely difficult esp. some section which i don't have exposure such as Recursive Descent Parser (chapter 6). In terms of the language i don't foresee i have problem but i have problem as mentioned cos' those topic are usually covered in a Master Degree program such as construction of compiler. I just bought a book called C++ primer (Stanley Lipmann) which i heard it is a very good book for C++. Only setback is it's of course no match with the amount of information from the original C++ creator. Please advice. Thanks.

    Read the article

  • ASP.NET Session expires in no time?

    - by Galilyou
    Weired problem! ASP.NET Session expires instantly. In my web.config I have this session settings: <sessionState mode="InProc" timeout="10000" /> AFAIK the timeout attribute's value is in minutes and can't be greater than 525,600 minutes (1 year). I don't understand what I am doing wrong here. Why is the session expiring. Is it a server memory issue? I don't think so, the server is pretty descent and it has only one site which isn't doing much after all. Ideas? EDIT: After setting the cookiless attribute to true, and while noticing the session id on the url, I can see that the session id CHANGING. I assume that this means the session is expiring. The IIS Settings are correct AFAIK (the enable session state checkbox is checked, and the value of the time is 20). A Picture is worth 100 words:

    Read the article

  • C++ Primer (Stanley Lipmann) or The C++ programming language (special edition)

    - by Kim
    I have a Computer Science degree (long2 time ago) .. I do know Java OOP but i am now trying to pick up C++. I do have C and of course data structure using C or pascal. I have started reading Bjarne Stroustrup book (The C++ Programming Language - Special Edition) but find it extremely difficult esp. some section which i don't have exposure such as Recursive Descent Parser (chapter 6). In terms of the language i don't foresee i have problem but i have problem as mentioned cos' those topic are usually covered in a Master Degree program such as construction of compiler. I just bought a book called C++ primer (Stanley Lipmann) which i heard it is a very good book for C++. Only setback is it's of course no match with the amount of information from the original C++ creator. Please advice. Thanks.

    Read the article

  • Rtti for Variant Records

    - by Coco
    I try to write a kind of object/record serializer with Delphi 2010 and wonder if there is a way to detect, if a record is a variant record. E.g. the TRect record as defined in Types.pas: TRect = record case Integer of 0: (Left, Top, Right, Bottom: Longint); 1: (TopLeft, BottomRight: TPoint); end; As my serializer should work recursively on my data structures, it will descent on the TPoint records and generate redundant information in my serialized file. Is there a way to avoid this, by getting detailed information on the record?

    Read the article

  • What would be a good "CMS" for me to use?

    - by Tim Geerts
    Hey, I'm looking for some sort of CMS system to implement here in terms of "documentation" system. Now, I'm not to sure about which system(s) would suit my needs best, so I thought I'd come here and type up my requirements so you could help me in narrowing down all the different options. One important note to make is that I'm not looking at a system where I can store certain documents (word, pdf, whatever). Rather at a system where I can type the "documentation"-text in some sort of post (like a blog). Requirements: - Multilanguage support - Tagging - Decent search support (tags, groupings, categories) - Version-control of posts/articles - Possibility of exporting post(s) to a pdf file - Support for multi-user (usergroup X can only see those posts, usergroup Y can see others, etc...) I know, these are some strange requirements if they're all combined, and I reckon most of you would perhaps say that I'd have to develop something like this inhouse rather then finding a descent working product out there (open source if possible). None the less, I thought I'd at least ask the opinion of y'all. Regards, Tim

    Read the article

  • Django: Proper place to unregister ModelAdmins

    - by lazerscience
    Sometimes I need to UNREGISTER some ModelAdmins from the admin site, because I don't want them to be there as they are, eg. if I'm using the Sites framework, and I dont want it to appear in the admin. It's no big deal to e.g. call admin.site.unregister(Site) to do so. In most cases I put it in admin.py of some related app that I have made, but sometimes I end up putting it in a place that hasn't much to do with the original app; another possibility would be making a "dummy app" and put it there... Does anybody know a more descent place where these calls can live?

    Read the article

  • Looking for a Silverlight 3 or 4 Menu control providing decent keyboard support.

    - by Geo
    I've an N-Tier application using Silverlight for the client. The customer as one particular request - I thought was more than reasonable: all actions – including menu navigation – has to be available through keyboard. When I tried Silverlight 4 I was surprised not to find any menu control so I downloaded several open source and commercial menu controls. I was very disappointed, after having searched for a couple of hours I didn’t manage to find any control that provide a decent keyboard support. Most controls provide no support or some basic support but not one control enabled to gain focus on the first item through the keyboard. You are able to use the keyboard (arrow keys) but you need first to select the control with the mouse! Not one control provided support for Keyboard shortcuts. Does anyone know of any Silverlight control providing descent support?

    Read the article

< Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >