Search Results

Search found 6630 results on 266 pages for 'cname record'.

Page 220/266 | < Previous Page | 216 217 218 219 220 221 222 223 224 225 226 227  | Next Page >

• Magento started showing PHP language errors since I downloaded the blank theme using Connect

  - by Aayush

  I used the Magento Connect downloader to install the blank theme extension, but I did not switch to it as I was unable to access any-page anymore. Instead, it started showing php errors for front-end and Magento generated security errors for admin. Frontend Error: Fatal error: Call to a member function toHtml() on a non-object in D:\xampp\htdocs\newpinch\app\code\core\Mage\Core\Model\Layout.php on line 529 Admin error on Log-in: There has been an error processing your request Exception printing is disabled by default for security reasons. Error log record number: 1608724822 Link to the theme extension I installed. I didn't even change the theme from the default, can anyone please tell me what am I doing wrong. I just installed the theme and then clicked on "Return to admin" in Magento Connect but it was unable to go instead started refreshed the Magento Connect page, only this time without any CSS styling. The only page that still appears correctly is the admin log-in page. Please help me, I have already tried the forums at magentocommerce.com and their community sucks. 0 views & 0 replies. please help...

  Read the article

• Anyone got a nifty credit expiry algorithm?

  - by garethkeenan

  Our website uses a credit system to allow users to purchase inexpensive digital goods (eg. photos). We use credits, rather than asking the user to pay for items individually, because the items are cheap and we are trying to keep our credit-card/PayPal overhead low. Because we aren't a bank, we have to expire credits after a certain amount of time. We expire deposit credits after a year, but other types of credits (bonuses, prizes, refunds) may have a different shelf-life. When a buyer buys an item, we spend the credit that is going to expire first. Our current system keeps track of every deposit by storing the original value and the remainder to be spent. We keep a list of all purchases as well, of course. I am currently moving to a system which is much more like a traditional double-entry accounting system. A deposit will create a ledger item, increasing the user's 'spending' account balance. Every purchase will also create a ledger item, decreasing the user's 'spending' account balance. The new system has running balances, while the old system does not, which greatly improves our ability to find problems and do reconciliations. We do not want to use the old system of keeping a 'remainder' value attached to each deposit record because it is inefficient to replay a user's activities to calculate what the remainder of each deposit is over time (for the user's statement). So, after all of this verbose introduction, my question is "Does anyone else out there have a similar system of expiring credits?" If you could describe how you calculate expired credits it would be a great help. If all expired credits had the exact same shelf life, we would be able to calculate the expired amount using: Total Deposits - Total Spending - Deposits Not Due To Expire = Amount to Expire However, because deposits can have different shelf lives, this formula does not work because more than one deposit can be partially spent at any given time.

  Read the article

• Castle ActiveRecord / NHibernate Linq Querys with ValueTypes

  - by Thomas Schreiner

  Given the following code for our Active Record Entites and ValueTypes Linq is not working for us. [ActiveRecord("Person")] public class PersonEntity : ActiveRecordLinqBase<PersonEntity> { string _name; [Property("Name", Length = 20, ColumnType = "string", Access = PropertyAccess.FieldCamelcaseUnderscore)] public Name Name { get { return NameValue.Create(_name);} set { _name = value.DataBaseValue; } } ... } public abstract class Name : IValueType { string DataBaseValue {get;set;} ... } public class Namevalue : Name { string _name; private NameValue(string name) { _name = name; } public static NameValue Create(string name) { return new NameValue(name); } ... } We tried to use linq in the following way so far with no success: var result = from PersonEntity p in PersonEntity.Queryable where p.Name == "Thomas" select p; return result.First(); // throws exception Cannot convert string into Name We tried and implemented a TypeConverter for Name, but the converter never got called. Is there a way to have linq working with this ValueTypes? Update: Using NHibernate.UserTypes.IUserType it sortof works. I Implemented the Interface as described here: http://stackoverflow.com/questions/1565056/how-to-implement-correctly-iusertype I still had to add a ConversionOperator from string to Name and had to call it Explicitly in the linq Statement, even though it was defined as implicit. var result = from PersonEntity p in PersonEntity.Queryable where p.Name == (Name)"Thomas" select p; return result.First(); //Now works

  Read the article

• managed beans as managed properties

  - by Sean

  I am using JSF 1.1 on WebSphere 6.1. I am building search functionality within an application and am having some issues. I've stripped out the extras, and have left myself with the following: 4 managed beans: SearchController - Controller bean, session scope SearchResults - session scope (store the results) ProductSearch - session scope (store the search conditions) ResultsBacking - Backing bean for DataTable, used to determine which row was clicked, request scope The SearchController bean has, as managed properties, the other 3. All except ResultsBacking are session scoped. If there is only 1 item in the search results, I want to bring up that record directly. I call setFirst(0) for the data table in the ResultsBacking method (I want to use the existing method that handle which item was clicked, so this is called right after the setFirst). When I go to do another search, I get an IllegalArgumentException when calling getRowData in the data table. According to the api, this is thrown 'if now(sic) row data is available at the currently specified row index'. I'm confused as to why this happens. It works the first time but not the second. Do I need to remove the ResultsBacking on a new search to get rid of the old state?

  Read the article

• How to import data to SAP

  - by Mehmet AVSAR

  Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

  Read the article

• MS-Access: What could cause one form with a join query to load right and another not?

  - by Daniel Straight

  Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

  Read the article

• Selenium onChange not working

  - by tohop

  Hi, I have tried a number of things to try and get Selenium to pick up an 'onchange' event from a drop down menu, none of which has worked. The offending HTML is: <select onchange="doOpperation(this.options[this.selectedIndex]); this.selectedIndex = 0;" name="opps_ondemand" id="opps_ondemand"> <option value="none" id="ondemand">Mark as...</option> <option cmd="blah1" value="add">Something</option> <option cmd="blah2" value="remove">None</option> </select> I have read that Selenium IDE doesn't record some on* events, and so it would be wise to use fireEvent(): $this->click("opps_ondemand"); $this->select("opps_ondemand", "label=Mark as..."); $this->click("//option[@value='add']"); sleep(3); $this->fireEvent("//select[@id='opps_ondemand']", "change"); However, this does not work (with or without the fireEvent). I have also tried using $this->fireEvent("locator", "click"); instead of $this->click("locator"); but this did nothing. Selenium does not complain about these locators not existing so I am assuming it can see the select/option elements fine. The problem seems to be the onChange event. Does anyone know how to resolve this? Thanks.

  Read the article

• PHP/MySQL Printing Duplicate Labels

  - by Michael

  Using an addon of FPDF, I am printing labels using PHP/MySQL (http://www.fpdf.de/downloads/addons/29/). I'd like to be able to have the user select how many labels to print. For example, if the query puts out 10 records and the user wants to print 3 labels for each record, it prints them all in one set. 1,1,1,2,2,2,3,3,3...etc. Any ideas? <?php require_once('auth.php'); require_once('../config.php'); require_once('../connect.php'); require('pdf/PDF_Label.php'); $sql="SELECT $tbl_members.lastname, $tbl_members.firstname, $tbl_members.username, $tbl_items.username, $tbl_items.itemname FROM $tbl_members, $tbl_items WHERE $tbl_members.username = $tbl_items.username"; $result=mysql_query($sql); if(mysql_num_rows($result) == 0){ echo "Your search criteria does not return any results, please try again."; exit(); } $pdf = new PDF_Label("5160"); $pdf->AddPage(); // Print labels while($rows=mysql_fetch_array($result)){ $name = $rows['lastname'].', '.$rows['firstname'; $item= $rows['itemname']; $text = sprintf(" * %s *\n %s\n", $name, $item); $pdf->Add_Label($text); } $pdf->Output('labels.pdf', 'D'); ?>

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Passing a LINQ DataRow Reference in a GridView's ItemTemplate

  - by Bob Kaufman

  Given the following GridView: <asp:GridView runat="server" ID="GridView1" AutoGenerateColumns="false" DataKeyNames="UniqueID" OnSelectedIndexChanging="GridView1_SelectedIndexChanging" > <Columns> <asp:BoundField HeaderText="Remarks" DataField="Remarks" /> <asp:TemplateField HeaderText="Listing"> <ItemTemplate> <%# ShowListingTitle( ( ( System.Data.DataRowView ) ( Container.DataItem ) ).Row ) %> </ItemTemplate> </asp:TemplateField> <asp:BoundField HeaderText="Amount" DataField="Amount" DataFormatString="{0:C}" /> </Columns> </asp:GridView> which refers to the following code-behind method: protected String ShowListingTitle( DataRow row ) { Listing listing = ( Listing ) row; return NicelyFormattedString( listing.field1, listing.field2, ... ); } The cast from DataRow to Listing is failing (cannot convert from DataRow to Listing) I'm certain the problem lies in what I'm passing from within the ItemTemplate, which is simply not the right reference to the current record from the LINQ to SQL data set that I've created, which looks like this: private void PopulateGrid() { using ( MyDataContext context = new MyDataContext() ) { IQueryable < Listing > listings = from l in context.Listings where l.AccountID == myAccountID select l; GridView1.DataSource = listings; GridView1.DataBind(); } }

  Read the article

• SharePoint 2007 and SiteMinder

  - by pborovik

  Here is a question regarding some details how SiteMinder secures access to the SharePoint 2007. I've read a bunch of materials regarding this and have some picture for SharePoint 2010 FBA claims-based + SiteMinder security (can be wrong here, of course): SiteMinder is registered as a trusted identity provider for the SharePoint; It means (to my mind) that SharePoint has no need to go into all those user directories like AD, RDBMS or whatever to create a record for user being granted access to SharePoint - instead it consumes a claims-based id supplied by SiteMinder SiteMinder checks all requests to SharePoint resources and starts login sequence via SiteMinder if does not find required headers in the request (SMSESSION, etc.) SiteMinder creates a GenericIdentity with the user login name if headers are OK, so SharePoint recognizes the user as authenticated But in the case of SharePoint 2007 with FBA + SiteMinder, I cannot find an answer for questions like: Does SharePoint need to go to all those user directories like AD to know something about users (as SiteMinder is not in charge of providing user info like claims-based ids)? So, SharePoint admin should configure SharePoint FBA to talk to these sources? Let's say I'm talking to a Web Service of SharePoint protected by SiteMinder. Shall I make a Authentication.asmx-Login call to create a authentication ticket or this schema is somehow changed by the SiteMinder? If such call is needed, do I also need a SiteMinder authentication sequence? What prevents me from rewriting request headers (say, manually in Fiddler) before posting request to the SharePoint protected by SiteMinder to override its defence? Pity, but I do not have access to deployed SiteMinder + SharePoint, so need to investigate some question blindly. Thanks.

  Read the article

• symfony get data from array

  - by iggnition

  Hi, I'm trying to use an SQL query to get data from my database into the template of a symfony project. my query: SQL: SELECT l.loc_id AS l__loc_id, l.naam AS l__naam, l.straat AS l__straat, l.huisnummer AS l__huisnummer, l.plaats AS l__plaats, l.postcode AS l__postcode, l.telefoon AS l__telefoon, l.opmerking AS l__opmerking, o.org_id AS o__org_id, o.naam AS o__naam FROM locatie l LEFT JOIN organisatie o ON l.org_id = o.org_id This is generated by this DQL: DQL: $this->q = Doctrine_Query::create() ->select('l.naam, o.naam, l.straat, l.huisnummer, l.plaats, l.postcode, l.telefoon, l.opmerking') ->from('Locatie l') ->leftJoin('l.Organisatie o') ->execute(); But now when i try to acces this data in the template by either doing: <?php foreach ($q as $locatie): ?> <?php echo $locatie['o.naam'] ?> or <?php foreach ($q as $locatie): ?> <?php echo $locatie['o__naam'] ?> i get the error from symfony: 500 | Internal Server Error | Doctrine_Record_UnknownPropertyException Unknown record property / related component "o__naam" on "Locatie" Does anyone know what is going wrong here? i dont know how to call the value from the array if the names in both query's dont work.

  Read the article

• LPX-00607 for ora:contains in java but not sqlplus

  - by Windle

  Hey all, I am trying to doing some sql querys out of Oracle 11g and am having issues using ora:contains. I am using spring's jdbc impl and my code generates the sql statement: select * from view_name where column_a = ? and column_b = ? and existsNode(xmltype(clob_column), 'record/name [ora:contains(text(), "name1") 0]', 'xmlns:ora="http://xmlns.oralce.com/xdb"') = 1 I have removed the actual view / column names obviously, but when I copy that into sqlplus and substitute in random values, the select executes properly. When I try to run it in my DAO code I get this stack trace: org.springframework.jdbc.UncatergorizedSQLException: PreparedStatementCallback; uncatergorizedSQLException for SQL [the big select above]; SQL state [99999]; error code [31011]; ORA-31011: XML parsing failed. ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' ;nested exception is java.sql.SQLException: ORA-31011: XML parsing failed ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' (continues on like this for awhile....) I think it is worth mentioning that I am using maven and it is possible I am missing some dependency that is required for this. Sorry the post is so long, but I wanted to err on the side of too much info. Thanks for taking the time to read this at least =) -Windle

  Read the article

• SQL (mySQL) update some value in all records processed by a select

  - by jdmuys

  I am using mySQL from their C API, but that shouldn't be relevant. My code must process records from a table that match some criteria, and then update the said records to flag them as processed. The lines in the table are modified/inserted/deleted by another process I don't control. I am afraid in the following, the UPDATE might flag some records erroneously since the set of records matching might have changed between step 1 and step 3. SELECT * FROM myTable WHERE <CONDITION>; # step 1 <iterate over the selected set of lines. This may take some time.> # step 2 UPDATE myTable SET processed=1 WHERE <CONDITION> # step 3 What's the smart way to ensure that the UPDATE updates all the lines processed, and only them? A transaction doesn't seem to fit the bill as it doesn't provide isolation of that sort: a recently modified record not in the originally selected set might still be targeted by the UPDATE statement. For the same reason, SELECT ... FOR UPDATE doesn't seem to help, though it sounds promising :-) The only way I can see is to use a temporary table to memorize the set of rows to be processed, doing something like: CREATE TEMPORARY TABLE workOrder (jobId INT(11)); INSERT INTO workOrder SELECT myID as jobId FROM myTable WHERE <CONDITION>; SELECT * FROM myTable WHERE myID IN (SELECT * FROM workOrder); <iterate over the selected set of lines. This may take some time.> UPDATE myTable SET processed=1 WHERE myID IN (SELECT * FROM workOrder); DROP TABLE workOrder; But this seems wasteful and not very efficient. Is there anything smarter? Many thanks from a SQL newbie.

  Read the article

• Cross domain login - what to store in the database?

  - by Jenkz

  I'm working on a system which will allow me to login to the same system via various domains. (www.example.com, www.mydomain.com, sub.domain.com etc) The following threads form the basis of my research so far: Single Sign On across multiple domains Cross web domain login with .net membership What I want to happen is that If I am logged in on the master domain and I visit a page on a client domain to be automatically logged in on the client. Obviously If I am not logged in on the master, I will need to enter my username and password. Walkthrough: 1. User logs in on master site 2. User navigates to client site 3. Client site re-directs to master site to see if User is logged in. 4. If User is logged in on master, record a RFC 4122 token ID and send this back to the client site. 5. Client site then looks up the token ID in the central database and logs this user in. This might eventually end up running on more than once instance of PHP and Apache, so I can't just store: token_id, php_session_id, created Is there any problem with me storing and using this: token_id, username, hashed_password, created Which is deleted on use, or automatically after x seconds.

  Read the article

• Authlogic Current User Question - hiding admin links...

  - by bgadoci

  I think I am missing something while using the Authlogic gem w/ Rails. To set the stage I have multiple users and each user can create posts and comments. Upon the display of a post or comment I would like to give the user who created them the option to edit or destroy. I am successfully using the following code to hide and show elements based on if a user is logged in or not but can't seem to find out how to only show these links to the actual user who created them...not any user that is logged in. <% if current_user %> <%= link_to 'Edit', edit_question_path(question) %> | <%= link_to 'Destroy', question, :confirm => 'Are you sure?', :method => :delete %> <% else %> <p>nothing to see here</p> <% end %> Here is the def of current_user located in the application controller in case I need to change something here. class ApplicationController < ActionController::Base helper :all # include all helpers, all the time protect_from_forgery # See ActionController::RequestForgeryProtection for details# helper_method :current_user private def current_user_session return @current_user_session if defined?(@current_user_session) @current_user_session = UserSession.find end def current_user return @current_user if defined?(@current_user) @current_user = current_user_session && current_user_session.record end end

  Read the article

• How do I pass arguments to pages in a WPF application?

  - by Rod

  I'm working on upgrading a really old VB6 app to a WPF application. This will be a page-based app, but not a XBAP. The old VB6 app had a start form where a user would enter search criteria. Then they would get results in a grid, select a row in the grid and then click on one of 3 buttons. I am thinking that what I'll do is use hyperlink controls on the WPF app. No matter what button the user clicked on the old VB6 app, it would go to a second form. What it did on the second form was dependent upon which button the user clicked on the first form. So, I want the first page in my WPF app to do the same thing, but depending upon which hyperlink they click on will dictate what happens on the second page. They will either (a) go to the second page to edit the details as well as a lot more information, related to what they selected on the first page, or (b) enter a new record and all associated data (a new client, in this case), or (c) create a new case for the same client, selected on the first page. For me the hard thing is I don't know how to pass that information along to the second page. Is there something in WPF like in HTML where there's a query string? Or how do you get information from the first page to the second page, in WPF? I'm working in VS 2008.

  Read the article

• Program Structure Design Tools? (Top Down Design)

  - by Lee Olayvar

  I have been looking to expand my methodologies to better involve Unit testing, and i stumbled upon Behavioral Driven Design (Namely Cucumber, and a few others). I am quite intrigued by the concept as i have never been able to properly design top down, only because keeping track of the design gets lost without a decent way to record it. So on that note, in a mostly language agnostic way, are there any useful tools out there i am (probably) unaware of? Eg, i have often been tempted to try building flow charts for my programs, but i am not sure how much that will help, and it seems a bit confusing to me how i could make a complex enough flow chart to handle the logic of a full program, and all its features.. ie, it just seems like flow charts would be limiting in the design scheme.. or possibly grow to an unmaintainable scale. BDD methods are nice, but with a system that is so tied to structure, tying into the language and unit testing seems like a must (for it to be worth it) and it seems to be hard to find something to work well with both Python and Java (my two main languages). So anyway.. on that note, any comments are much appreciated. I have searched around on here and it seems like top down design is a well discussed topic, but i haven't seen too much reference to tools themselves, eg, flow chart programs, etc. I am on Linux, if it matters (in the case of programs).

  Read the article

• Newbie database index question

  - by RenderIn

  I have a table with multiple indexes, several of which duplicate the same columns: Index 1 columns: X, B, C, D Index 2 columns: Y, B, C, D Index 3 columns: Z, B, C, D I'm not very knowledgeable on indexing in practice, so I'm wondering if somebody can explain why X, Y and Z were paired with these same columns. B is an effective date. C is a semi-unique key ID for this table for a specific effective date B. D is a sequence that identifies the priority of this record for the identifier C. Why not just create 6 indexes, one for each X, Y, Z, B, C, D? I want to add an index to another column T, but in some contexts I'll only be querying on T alone while in others I will also be specifying the B, C and D columns... so should I create just one index like above or should I create one for T and one for (T, B, C, D)? I've not had as much luck as expected when googling for comprehensive coverage of indexing. Any resources where I can get a through explanation and lots of examples of B-tree indexing?

  Read the article

• Initialization of controllers in a for loop - leaking problem ?

  - by gotye

  Hey, I am creating a kinda gallery and for each gallery I created a view controller whose view is added to a scrollview (see code below) : GalleryViewController *galViewController; for (NSUInteger i = 0 ; i < [galleries count]; i++) { galViewController = [[GalleryViewController alloc] init]; galViewController.record = [galleries objectAtIndex:i]; //galViewController.position = i; galViewController.view.frame = CGRectMake(i%3*100,i/3*150,100,150); [galViewController setDelegate:self]; [self.scrollView addSubview:galViewController.view]; //[galViewController release]; } Is this code leaking ? I think so ... but the thing is that I don't know what to do with these controllers ... i can't release them (cause I got some code to use in the future like touches event) and I don't need to save them somewhere ... Is this a problem to have this kind of code ? Thks, Gotye

  Read the article

• delayed evaluation of code in subroutines - 5.8 vs. 5.10 and 5.12

  - by Brock

  This bit of code behaves differently under perl 5.8 than it does under perl 5.12: my $badcode = sub { 1 / 0 }; print "Made it past the bad code.\n"; [brock@chase tmp]$ /usr/bin/perl -v This is perl, v5.8.8 built for i486-linux-gnu-thread-multi [brock@chase tmp]$ /usr/bin/perl badcode.pl Illegal division by zero at badcode.pl line 1. [brock@chase tmp]$ /usr/local/bin/perl -v This is perl 5, version 12, subversion 0 (v5.12.0) built for i686-linux [brock@chase tmp]$ /usr/local/bin/perl badcode.pl Made it past the bad code. Under perl 5.10.1, it behaves as it does under 5.12: brock@laptop:/var/tmp$ perl -v This is perl, v5.10.1 (*) built for i486-linux-gnu-thread-multi brock@laptop:/var/tmp$ perl badcode.pl Made it past the bad code. I get the same results with a named subroutine, e.g. sub badcode { 1 / 0 } I don't see anything about this in the perl5100delta pod. Is this an undocumented change? A unintended side effect of some other change? (For the record, I think 5.10 and 5.12 are doing the Right Thing.)

  Read the article

• when does factory girl create objects in db?

  - by Pavel K.

  i am trying to simulate a session using factory girl/shoulda (it worked with fixtures but i am having problems with using factories). i have following factories (user login and email both have 'unique' validations): Factory.define :user do |u| u.login 'quentin' u.email '[email protected]' end Factory.define :session_user, :class => Session do |u| u.association :user, :factory => :user u.session_id 'session_user' end and here's the test class MessagesControllerTest < ActionController::TestCase context "normal user" do setup do @request.session[:user_id]=Factory(:user).id @request.session[:session_id]=Factory(:session_user).session_id end should "be able to access new message creation" do get :new assert_response :success end end end but when i run "rake test:functionals", i get this test result 1) Error: test: normal user should be able to access new message creation. (MessagesControllerTest): ActiveRecord::RecordInvalid: Validation failed: Account name already exists!, Email already exists! which means that record already exists in db when i am referring to it in test setup. is there something i don't understand here? does factory girl create all factories in db on startup? rails 2.3.5/shoulda/factory girl

  Read the article

• number of args for stored procedure PLS00306

  - by Peter Kaleta

  Hi I have problem with calling for my procedure.Oracle scrams pls00306 Error: Wrong number of types of arguments in call to procedure. With my type declaration procedure has exact the same declaration like in header below. If I run it as separate prcedure it works , when i work in ODCI interface for exensible index creation , it throws pls 00306. MEMBER PROCEDURE FILL_TREE_LVL(target_column VARCHAR2, cur_lvl NUMBER, max_lvl NUMBER, parent_rect NUMBER,start_x NUMBER, start_y NUMBER,end_x NUMBER, end_y NUMBER) IS stmt VARCHAR2(2000); rect_id NUMBER; diff_x NUMBER; diff_y NUMBER; new_start_x NUMBER; new_end_x NUMBER; i NUMBER; j NUMBER; BEGIN {...} END FILL_TREE_LVL; STATIC FUNCTION ODCIINDEXCREATE (ia SYS.ODCIINDEXINFO, parms VARCHAR2, env SYS.ODCIEnv) RETURN NUMBER IS stmt VARCHAR2(2000); stmt2 VARCHAR2(2000); min_x NUMBER; max_x NUMBER; min_y NUMBER; max_y NUMBER; lvl NUMBER; rect_id NUMBER; pt_tab VARCHAR2(50); rect_tab VARCHAR2(50); cnum NUMBER; TYPE point_rect is RECORD( point_id NUMBER, rect_id NUMBER ); TYPE point_rect_tab IS TABLE OF point_rect; pr_table point_rect_tab; BEGIN {...} FILL_TREE_LVL('any string',0,lvl,min_x,min_y,max_x, max_y); {...} END;

  Read the article

• How to stop MVC caching the results of invoking and action method?

  - by Trey Carroll

  I am experiencing a problem with IE caching the results of an action method. Other articles I found were related to security and the [Authorize] attribute. This problem has nothing to do with security. This is a very simple "record a vote, grab the average, return the avg and the number of votes" method. The only slightly interesting thing about it is that it is invoked via Ajax and returns a Json object. I believe that it is the Json object that is getting catched. When I run it from FireFox and watch the XHR traffic with Firebug, everything works perfectly. However, under IE 8 the "throbber" graphic doesn't ever have time to show up and the page elements that display the "new" avg and count that are being injected into the page with jQuery are never different. I need a way to tell MVC to never cache this action method. This article seems to address the problem, but I cannot understand it: http://stackoverflow.com/questions/1441467/prevent-caching-of-attributes-in-asp-net-mvc-force-attribute-execution-every-tim I need a bit more context for the solution to understand how to extend AuthorizationAttribute. Please address your answer as if you were speaking to someone who lacks a deep understanding of MVC even if that means replying with an article on some basics/prerequisites that are required. Thanks, Trey Carroll

  Read the article

• Dynamic Google Maps API InfoWindow HTML Content

  - by Peter Hanneman

  I am working in Flash Builder 4 with Google Map's ActionScript API. I have created a map, loaded some custom markers onto it and added some MouseEvent listeners to each marker. The trouble comes when I load an InfoWindow panel. I want to dynamically set the htmlContent based off of information stored in a database. The trouble is that this information can change every couple of seconds and each marker has a unique data set so I can not statically set it at the time I actually create the markers. I have a method that will every minute or so load all of the records from my database into an Object variable. Everything I need to display in the htmlContent is contained in this object under a unique identifier. The basic crux of the problem is that there is no way for me to uniquely identify an info window, so I can not determine what information to pull into the panel. marker.addEventListener(MapMouseEvent.ROLL_OVER, function(e:MapMouseEvent):void { showInfoWindow(e.latLng) }, false, 0, false); That is my mouse event listener. The function I call, "showInfowindow" looks like this: private function showInfoWindow(latlng:LatLng):void { var options:InfoWindowOptions = new InfoWindowOptions({title: appData[*I NEED A UNIQUE ID HERE!!!*].type + " Summary", contentHTML: appData[*I NEED A UNIQUE ID HERE!!!*].info}); this.map.openInfoWindow(latlng, options); } I thought I was onto something by being able to pass a variable in my event listener declaration, but it simply hates having a dynamic variable passed through, it only returns the last value use. Example: marker.addEventListener(MapMouseEvent.ROLL_OVER, function(e:MapMouseEvent):void { showInfoWindow(e.latLng, record.unit_id) }, false, 0, false); That solution is painfully close to working. I iterate through a loop to create my markers when I try the above solution and roll over a marker I get information, but every marker's information reflects whatever information the last marker created had. I apologize for the long explaination but I just wanted to make my question as clear as possible. Does anyone have any ideas about how to patch up my almost-there-solution that I posted at the bottom or any from the ground up solutions? Thanks in advance, Peter Hanneman

  Read the article

< Previous Page | 216 217 218 219 220 221 222 223 224 225 226 227  | Next Page >