Search Results

Search found 6670 results on 267 pages for 'speed dial'.

Page 224/267 | < Previous Page | 220 221 222 223 224 225 226 227 228 229 230 231  | Next Page >

  • LINQ compiled query DataBind issue

    - by Brian
    Hello All, I have a pretty extensive reporting page that uses LINQ. There is one main function that returns an IQueryable object. I then further filter / aggregate the returned query depending on the report the user needs. I changed this function to a compiled query, it worked great, and the speed increase was astonishing. The only problem comes when i want to databind the results. I am databinding to a standard asp.net GridView and it works fine, no problems. I am also databinding to an asp.net chart control, this is where my page is throwing an error. this works well: GridView gv = new GridView(); gv.DataSource = gridSource; But this does not: Series s1 = new Series("Series One"); s1.Points.DataBindXY(gridSource, "Month", gridSource, "Success"); The error i receive is this: System.NotSupportedException Specified method is not supported When i look into my gridSource var at run time i see this using a typical linq query: SELECT [t33].[value2] AS [Year], [t33].[value22] AS [Month], [t33].[value3] AS [Calls]...... I see this after i change the query to compiled: {System.Linq.OrderedEnumerable<<>f__AnonymousType15<string,int,int,int,int,int,int,int>,string>} This is obviously the reason why the databindxy is no longer working, but i am not sure how to get around it. Any help would be appreciated! Thanks

    Read the article

  • How to implement a counter when using golang's goroutine?

    - by MrROY
    I'm trying to make a queue struct that have push and pop functions. I need to use 10 threads push and another 10 threads pop data, just like i did in the code below. Questions : 1. I need to print out how much i have pushed/popped, but i don't know how to do that. 2. Is there anyway to speed up my code ? the code is too slow for me. package main import ( "runtime" "time" ) const ( DATA_SIZE_PER_THREAD = 10000000 ) type Queue struct { records string } func (self Queue) push(record chan interface{}) { // need push counter record <- time.Now() } func (self Queue) pop(record chan interface{}) { // need pop counter <- record } func main() { runtime.GOMAXPROCS(runtime.NumCPU()) //record chan record := make(chan interface{},1000000) //finish flag chan finish := make(chan bool) queue := new(Queue) for i:=0; i<10; i++ { go func() { for j:=0; j<DATA_SIZE_PER_THREAD; j++ { queue.push(record) } finish<-true }() } for i:=0; i<10; i++ { go func() { for j:=0; j<DATA_SIZE_PER_THREAD; j++ { queue.pop(record) } finish<-true }() } for i:=0; i<20; i++ { <-finish } }

    Read the article

  • java distributed cache for low latency, high availability

    - by Shahbaz
    I've never used distributed caches/DHTs like memcached, jboss cache, ehcache, etc. I'm wondering which, if any, is appropriate for my use. First, I'm not doing web applications (as most of these project seem to be geared towards web apps). I write servers (Order Management Systems actually) for financial trading firms. The servers themselves are not too complicated. They need to receive information (market data, orders, executions, etc.) rout them to their destination while possibly transforming some of these messages. I am looking at these products to solve the following problems: * Safe repository of the state of the server. I'd rather build the logic of my application as a bunch of transformers (similar to Apache Camel) and store the state in a 'safe' place * This repository should be distributed: in case one of these data stores crashes, one or two more should be up and I should be able to switch to them seamlessly * This repository should be fast. Single digits milliseconds count here, in other words, systems which consume/process this data are automated systems, not humans clicking on links. This system needs to have high-throughput and low latency. By sending my data outside the process, I am necessarily slowing performance, but I am trying to balance absolute raw speed and absolute protection of data. * This repository should be safe. Similar to the point about several on-line backups, this system needs to write data to disk (potentially more than one disk). I'd really like to stop writing my own 'transaction servers.' Am I correct to be looking into projects such as jboss cache, ehcache, etc.? Thanks

    Read the article

  • Vote on Pros and Cons of Java HTML to XML cleaners

    - by George Bailey
    I am looking to allow HTML emails (and other HTML uploads) without letting in scripts and stuff. I plan to have a white list of safe tags and attributes as well as a whitelist of CSS tags and value regexes (to prevent automatic return receipt). I asked a question: Parse a badly formatted XML document (like an HTML file) I found there are many many ways to do this. Some systems have built in sanitizers (which I don't care so much about). This page is a very nice listing page but I get kinda lost http://java-source.net/open-source/html-parsers It is very important that the parsers never throw an exception. There should always be best guess results to the parse/clean. It is also very important that the result is valid XML that can be traversed in Java. I posted some product information and said Community Wiki. Please post any other product suggestions you like and say Community Wiki so they can be voted on. Also any comments or wiki edits on what part of a certain product is better and what is not would be greatly appreciated. (for example,, speed vs accuracy..) It seems that we will go with either jsoup (seems more active and up to date) or TagSoup (compatible with JDK4 and been around awhile). A +1 for any of these products would be if they could convert all style sheets into inline style on the elements.

    Read the article

  • YUI: ensuring DOM elements and scripts are ready

    - by dound
    If I put my inline script after the DOM elements it interacts with, should I still use YUI 3's domready event? I haven't noticed any problems, and it seems like I can count on the browser loading the page sequentially. (I already use YUI().use('node', ... to make sure the YUI functions I need have been loaded since the YUI script is a separate file.) Is there a way to speed up the loading of widgets like YUI 2's calendar? I load the appropriate script in <head> element of my page. I use YUI().use('yui2-calendar', ... to make sure the Calendar widget is available. Unfortunately, this causes a short but noticeable delay when I load my page with the calendar. If I omit the YUI().use('yui2-calendar', ... code then it shows up without a noticeable delay - but I guess this could cause the Calendar to not show up at all if the YUI script doesn't load in time? With regards to #2, is it possible to reduce the visual artifact of the calendar not being present and then showing up? I've made it slightly better by specifying a height and width for the parent div so that at least the space is already allocated = minimal shifting around when it does load.

    Read the article

  • What is the fastest way to pull a few element values out of XML files in Perl?

    - by Anon Guy
    I have a bunch of XML files that are about 1-2 megabytes in size. Actually, more than a bunch, there are millions. They're all well-formed and many are even validated against their schema (confirmed with libxml2). All were created by the same app, so they're in a consistent format (though this could theoretically change in the future). I want to check the values of one element in each file from within a Perl script. Speed is important (I'd like to take less than a second per file) and as noted I already know the files are well-formed. I am sorely tempted to simply 'open' the files in Perl and scan through until I see the element I am looking for, grab the value (which is near the start of the file), and close the file. On the other hand, I could use an XML parser (which might protect me from future changes to the XML formatting) but I suspect it will be slower than I'd like. Can anyone recommend an appropriate approach and/or parser? Thanks in advance.

    Read the article

  • WCF Double Hop questions about Security and Binding.

    - by Ken Maglio
    Background information: .Net Website which calls a service (aka external service) facade on an app server in the DMZ. This external service then calls the internal service which is on our internal app server. From there that internal service calls a stored procedure (Linq to SQL Classes), and passes the serialized data back though to the external service, and from there back to the website. We've done this so any communication goes through an external layer (our external app server) and allows interoperability; we access our data just like our clients consuming our services. We've gotten to the point in our development where we have completed the system and it all works, the double hop acts as it should. However now we are working on securing the entire process. We are looking at using TransportWithMessageCredentials. We want to have WS2007HttpBinding for the external for interoperability, but then netTCPBinding for the bridge through the firewall for security and speed. Questions: If we choose WS2007HttpBinding as the external services binding, and netTCPBinding for the internal service is this possible? I know WS-* supports this as does netTCP, however do they play nice when passing credential information like user/pass? If we go to Kerberos, will this impact anything? We may want to do impersonation in the future. If you can when you answer post any reference links about why you're answering the way you are, that would be very helpful to us. Thanks!

    Read the article

  • JSON: Jackson stream parser - is it really worth it?

    - by synic
    I'm making pretty heavy use of JSON parsing in an app I'm writing. Most of what I have done is already implemented using Android's built in JSONObject library (is it json-lib?). JSONObject appears to create instances of absolutely everything in the JSON string... even if I don't end up using all of them. My app currently runs pretty well, even on a G1. My question is this: are the speed and memory benefits from using a stream parser like Jackson worth all the trouble? By trouble, I mean this: As far as I can tell, there are three downsides to using Jackson instead of the built in library: Dependency on an external library. This makes your .apk bigger in the end. Not a huge deal. Your app is more fragile. Since the parsing is not done automatically, it is more vulnerable to changes in the JSON text that it's parsing. I'm extremely worried that malformed JSON will result in infinite loops (as pull parsing requires a lot of while loops). Writing code to parse JSON via a stream parser is ugly and tedious.

    Read the article

  • What strategy do you use to sync your code when working from home

    - by Ben Daniel
    At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

    Read the article

  • Unhandled Exception with c++ app on Visual Studio 2008 release build - occurs when returning from fu

    - by Rich
    Hi, I have a (rather large) application that I have written in C++ and until recently it has been running fine outside of visual studio from the release build. However, now, whenever I run it it says "Unhandled exception at 0x77cf205b in myprog.exe: 0xC0000005: Access violation writing location 0x45000200.", and leads me to "crtexe.c" at line 582 ("mainret = main(argc, argv, envp);") if I attempt to debug it. Note that this problem never shows if I run my debug executable outside of visual studio, or if I run my debug or release build within visual studio. It only happens when running the release build outside of visual studio. I have been through and put plenty of printfs and a couple of while(1)s in it to see when it actually crashed, and found that the access violation occurs at exactly the point that the value is returned from the function (I'm returning a pointer to an object). I don't fully understand why I would get an access violation at the point it returns, and it doesn't seem to matter what I'm returning as it still occurs when I return 0. The point it started crashing was when I added a function which does a lot of reading from a file using ifstream. I am opening the stream every time I attempt to read a new file and close it when I finish reading it. If I keep attempting to run it, it will run once in about 20 tries. It seems a lot more reliable if I run it off my pen drive (it seems to crash the first 3 or 4 times then run fine after that - maybe it's due to its slower read speed). Thanks for your help, and if I've missed anything let me know.

    Read the article

  • Is SQLDataReader slower than using the command line utility sqlcmd?

    - by Andrew
    I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

    Read the article

  • How to temporarily replace one primitive type with another when compiling to different targets in c#

    - by Keith
    How to easily/quickly replace float's for doubles (for example) for compiling to two different targets using these two particular choices of primitive types? Discussion: I have a large amount of c# code under development that I need to compile to alternatively use float, double or decimals depending on the use case of the target assembly. Using something like “class MYNumber : Double” so that it is only necessary to change one line of code does not work as Double is sealed, and obviously there is no #define in C#. Peppering the code with #if #else statements is also not an option, there is just too much supporting Math operators/related code using these particular primitive types. I am at a loss on how to do this apparently simple task, thanks! Edit: Just a quick comment in relation to boxing mentioned in Kyles reply: Unfortunately I need to avoid boxing, mainly since float's are being chosen when maximum speed is required, and decimals when maximum accuracy is the priority (and taking the 20x+ performance hit is acceptable). Boxing would probably rules out decimals as a valid choice and defeat the purpose somewhat. Edit2: For reference, those suggesting generics as a possible answer to this question note that there are many issues which count generics out (at least for our needs). For an overview and further references see Using generics for calculations

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • count on LINQ union

    - by brechtvhb
    I'm having this link statement: List<UserGroup> domains = UserRepository.Instance.UserIsAdminOf(currentUser.User_ID); query = (from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentFrom equals uug.User_ID where domains.Contains(uug.UserGroup) select doc) .Union(from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentTo equals uug.User_ID where domains.Contains(uug.UserGroup) select doc); Running this statement doesn't cause any problems. But when I want to count the resultset the query suddenly runs quite slow. totalRecords = query.Count(); The result of this query is : SELECT COUNT([t5].[DocumentID]) FROM ( SELECT [t4].[DocumentID], [t4].[DocumentFrom], [t4].[DocumentTo] FROM ( SELECT [t0].[DocumentID], [t0].[DocumentFrom], [t0].[DocumentTo FROM [dbo].[Document] AS [t0] INNER JOIN [dbo].[User_UserGroup] AS [t1] ON [t0].[DocumentFrom] = [t1].[User_ID] WHERE ([t1].[UserGroupID] = 2) OR ([t1].[UserGroupID] = 3) OR ([t1].[UserGroupID] = 6) UNION SELECT [t2].[DocumentID], [t2].[DocumentFrom], [t2].[DocumentTo] FROM [dbo].[Document] AS [t2] INNER JOIN [dbo].[User_UserGroup] AS [t3] ON [t2].[DocumentTo] = [t3].[User_ID] WHERE ([t3].[UserGroupID] = 2) OR ([t3].[UserGroupID] = 3) OR ([t3].[UserGroupID] = 6) ) AS [t4] ) AS [t5] Can anyone help me to improve the speed of the count query? Thanks in advance!

    Read the article

  • Can a GeneralPath be modified?

    - by Dov
    java2d is fairly expressive, but requires constructing lots of objects. In contrast, the older API would let you call methods to draw various shapes, but lacks all the new features like transparency, stroke, etc. Java has fairly high costs associated with object creation. For speed, I would like to create a GeneralPath whose structure does not change, but go in and change the x,y points inside. path = new GeneralPath(GeneralPath.WIND_EVEN_ODD, 10); path.moveTo(x,y); path.lineTo(x2, y2); double len = Math.sqrt((x2-x)*(x2-x) + (y2-y)*(y2-y)); double dx = (x-x2) * headLen / len; double dy = (y-y2) * headLen / len; double dx2 = -dy * (headWidth/headLen); double dy2 = dx * (headWidth/headLen); path.lineTo(x2 + dx + dx2, y2 + dy + dy2); path.moveTo(x2 + dx - dx2, y2 + dy - dy2); path.lineTo(x2,y2); This one isn't even that long. Imagine a much longer sequence of commands, and only the ones on the end are changing. I just want to be able to overwrite commands, to have an iterator effectively. Does that exist?

    Read the article

  • What is more viable to use? Javascript libraries or UI Programming tools?

    - by Haresh Karkar
    What is more viable to use:- Javascript Libraries: YUI, jQuery, ExtJs OR UI Programming tools: GWT, ExtGWT, SmartGWT It has become very difficult to choose between them as they are constantly increasing their capabilities to meet newer requirements. We all know the power of jQuery in UI manipulations. The latest news from Microsoft about jQuery being officially part of .Net developr’s toolkit will definitely make jQuery a preferred choice against other JavaScript libraries [See link: http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-and-microsoft.aspx]. But on the other hand, GWT is building a framework which could be used on client as well as on the sever side. This is definitely going to make developers’ life easy as it does not require developer to be an expert in browser quirks, XMLHttpRequest, and JavaScript in order to develop high-performance web applications. It includes SDK (Java API libraries, compiler, and development server which allows to write client-side applications in Java and deploy them as JavaScript), Speed Tracer and plug-in for Eclipse. GWT is used by many products like Google Wave and AdWords. So question is still un-answered, what is more viable to use? Any thoughts?

    Read the article

  • Banning by IP with php/mysql

    - by incrediman
    I want to be able to ban users by IP. My idea is to keep a list of IP's as rows in an BannedIPs table (the IP column would be an index). To check users' IP's against the table, I will keep a session variable called $_SESSION['IP'] for each session. If on any request, $_SESSION['IP'] doesn't match $_SERVER['REMOTE_ADDR'], I will update $_SESSION['IP'] and check the BannedIPs table to see if the IP is banned. (A flag will also be saved as a session variable specifying whether or not the user is banned) Here are the things I'm wondering: Does that sound like a good strategy with regards to speed and security (would someone be able to get around the IP ban somehow, other than changing IP's)? What's the best way to structure a mysql query that checks to see if a row exists? That is, what's the best way to query the db to see if a row with a certain IP exists (to check if it's banned)? Should I save the IP's as integers or strings? Note that... I estimate there will be between 1,000-10,000 banned IP's stored in the database. $_SERVER['REMOTE_ADDR'] is the IP from which the current request was sent.

    Read the article

  • JQuery Cycle fails on Page Refresh

    - by Darknight
    In a similar issue as this one: http://stackoverflow.com/questions/1719475/jquery-cycle-firefox-squishing-images I've managed to overcome the initial problem using Jeffs answer in the above link. However now I have noticed a new bug, upon page refresh it simply does not work. I have tried a hard refresh (ctrl+F5) but this does not work. However when you come page to the page it loads fine. here is my modified version (taken from Jeff's): <script type="text/javascript"> $(document).ready(function() { var imagesRemaining = $('#slideshow img').length; $('#slideshow img').bind('load', function(e) { imagesRemaining = imagesRemaining - 1; if (imagesRemaining == 0) { $('#slideshow').show(); $('#slideshow').cycle({ fx: 'shuffle', speed: 1200 }); } }); }); </script> Any ideas? I've also tried JQuery Live but could not implement it correctly. I've also tried Meta tags to force images to load. But it only works first time round.

    Read the article

  • WF performance with new 20,000 persisted workflow instances each month

    - by Nikola Stjelja
    Windows Workflow Foundation has a problem that is slow when doing WF instances persistace. I'm planning to do a project whose bussiness layer will be based on WF exposed WCF services. The project will have 20,000 new workflow instances created each month, each instance could take up to 2 months to finish. What I was lead to belive that given WF slownes when doing peristance my given problem would be unattainable given performance reasons. I have the following questions: Is this true? Will my performance be crap with that load(given WF persitance speed limitations) How can I solve the problem? We currently have two possible solutions: 1. Each new buisiness process request(e.g. Give me a new drivers license) will be a new WF instance, and the number of persistance operations will be limited by forwarding all status request operations to saved state values in a separate database. 2. Have only a small amount of Workflow Instances up at any give time, without any persistance ofso ever(only in case of system crashes etc.), by breaking each workflow stap in to a separate worklof and that workflow handling each business process request instance in the system that is at that current step(e.g. I'm submitting my driver license reques form, which is step one... we have 100 cases of that, and my step one workflow will handle every case simultaneusly). I'm very insterested in solution for that problem. If you want to discuss that problem pleas be free to mail me at [email protected]

    Read the article

  • Direct invocation vs indirect invocation in C

    - by Mohit Deshpande
    I am new to C and I was reading about how pointers "point" to the address of another variable. So I have tried indirect invocation and direct invocation and received the same results (as any C/C++ developer could have predicted). This is what I did: int cost; int *cost_ptr; int main() { cost_ptr = &cost; //assign pointer to cost cost = 100; //intialize cost with a value printf("\nDirect Access: %d", cost); cost = 0; //reset the value *cost_ptr = 100; printf("\nIndirect Access: %d", *cost_ptr); //some code here return 0; //1 } So I am wondering if indirect invocation with pointers has any advantages over direct invocation or vice-versa. Some advantages/disadvantages could include speed, amount of memory consumed performing the operation (most likely the same but I just wanted to put that out there), safeness (like dangling pointers) , good programming practice, etc. 1Funny thing, I am using the GNU C Compiler (gcc) and it still compiles without the return statement and everything is as expected. Maybe because the C++ compiler will automatically insert the return statement if you forget.

    Read the article

  • Haskell Linear Algebra Matrix Library for Arbitrary Element Types

    - by Johannes Weiß
    I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

    Read the article

  • Refactoring ADO.NET - SqlTransaction vs. TransactionScope

    - by marc_s
    I have "inherited" a little C# method that creates an ADO.NET SqlCommand object and loops over a list of items to be saved to the database (SQL Server 2005). Right now, the traditional SqlConnection/SqlCommand approach is used, and to make sure everything works, the two steps (delete old entries, then insert new ones) are wrapped into an ADO.NET SqlTransaction. using (SqlConnection _con = new SqlConnection(_connectionString)) { using (SqlTransaction _tran = _con.BeginTransaction()) { try { SqlCommand _deleteOld = new SqlCommand(......., _con); _deleteOld.Transaction = _tran; _deleteOld.Parameters.AddWithValue("@ID", 5); _con.Open(); _deleteOld.ExecuteNonQuery(); SqlCommand _insertCmd = new SqlCommand(......, _con); _insertCmd.Transaction = _tran; // add parameters to _insertCmd foreach (Item item in listOfItem) { _insertCmd.ExecuteNonQuery(); } _tran.Commit(); _con.Close(); } catch (Exception ex) { // log exception _tran.Rollback(); throw; } } } Now, I've been reading a lot about the .NET TransactionScope class lately, and I was wondering, what's the preferred approach here? Would I gain anything (readibility, speed, reliability) by switching to using using (TransactionScope _scope = new TransactionScope()) { using (SqlConnection _con = new SqlConnection(_connectionString)) { .... } _scope.Complete(); } What you would prefer, and why? Marc

    Read the article

  • jQuery image preload/cache halting browser

    - by Nathan Loding
    In short, I have a very large photo gallery and I'm trying to cache as many of the thumbnail images as I can when the first page loads. There could be 1000+ thumbnails. First question -- is it stupid to try to preload/cache that many? Second question -- when the preload() function fires, the entire browser stops responding for a minute to two. At which time the callback fires, so the preload is complete. Is there a way to accomplish "smart preloading" that doesn't impede on the user experience/speed when attempting to load this many objects? The $.preLoadImages function is take from here: http://binarykitten.me.uk/dev/jq-plugins/107-jquery-image-preloader-plus-callbacks.html Here's how I'm implementing it: $(document).ready(function() { setTimeout("preload()", 5000); }); function preload() { var images = ['image1.jpg', ... 'image1000.jpg']; $.preLoadImages(images, function() { alert('done'); }); } 1000 images is a lot. Am I asking too much?

    Read the article

  • Is it practical to program with your feet?

    - by bmm
    Has anyone tried using foot pedals in addition to the traditional keyboard and mouse combo to improve your effectiveness in the editor? Any actual experiences out there? Does it work, or is it just for carpal tunnel relief? I found one blog entry from a programmer who actually tried it: So now I can type using my feet for most of the modifier keys. I am using the pedals as I type this. I am still getting used to them, but the burning in my left wrist has definitely reduced. I think I can also type a little faster, but I am too lazy to do the speed tests with and without the pedals to verify this. On the negative side: Working out where to put your feet when you aren’t typing can be a little awkward. The pedals tend to move around the carpet, despite being metal and quite heavy. Some small spikes might have helped. Although the travel on the pedals is small, they are surprisingly stiff. Another programmer's experience: Anybody with hand pain must get foot pedals, since they can remove a tremendous load from your hands. I have two foot pedals, and use one for the SHIFT key, and the other for the CONTROL key. (I still type META by hand.) I have found that in the process of using the Emacs text editor to compose computer programs, I tend to use the SHIFT, CONTROL and META keys constantly, and it is easy to remove most of this load from one's hands. Some foot switch products: Savant Elite Triple Foot Switch FragPedal Bilbo Step On It!

    Read the article

  • Why do people say that Ruby is slow?

    - by stephen murdoch
    I like Ruby on Rails and I use it for all my web development projects. A few years ago there was a lot of talk about Rails being a memory hog and about how it didn't scale very well but these suggestions were put to bed by Gregg Pollack here. Lately though, I've been hearing people saying that Ruby itself is slow. Why is Ruby considered slow? I do not find Ruby to be slow but then again, I'm just using it to make simple CRUD apps and company blogs. What sort of projects would I need to be doing before I find Ruby becoming slow? Or is this slowness just something that affects all programming languages? What are your options as a Ruby programmer if you want to deal with this "slowness"? Which version of Ruby would best suit an application like Stack Overflow where speed is critical and traffic is intense? The questions are subjective, and I realise that architectural setup (EC2 vs standalone servers etc) makes a big difference but I'd like to hear what people think about Ruby being slow. Finally, I can't find much news on Ruby 2.0 - I take it we're a good few years away from that then?

    Read the article

< Previous Page | 220 221 222 223 224 225 226 227 228 229 230 231  | Next Page >