Search Results

Search found 19425 results on 777 pages for 'output clause'.

Page 225/777 | < Previous Page | 221 222 223 224 225 226 227 228 229 230 231 232  | Next Page >

  • Environment Variables in C

    - by tpar44
    I know this type of question has been asked a lot but none of the answers seem to help. I set an environment variable through setenv() function call in Ubuntu Linux. However, the program doesn't seem use this environment variables. If I use getenv() it gets the correct value but the output to the program is wrong. However, when I use export BLOCKSIZE=512 in the shell, the output to the program is correct. I am not spawning different processes from the program. Below is only a code snippet of what I am doing, it is not my whole program. Is there any reason for this?

    Read the article

  • Regular expression to truncate a String

    - by user470184
    To truncate a String here is what I'm using : String test1 = "this is test truncation 1.pdf"; String p1 = test1.substring(0, 10) + "..."; System.out.println(p1); The output is 'this is te...' How can I access the file name extension so that output becomes : 'this is te... pdf' I could use substring method to access the last three characters but other file extensions could be 4 chars in length such as .aspx Is there a regular expression I can use so that "this is test truncation 1.pdf" becomes "this is te... pdf"

    Read the article

  • looking for RTF template system with simple DSL

    - by 01
    Is there any framework that fills up rtf document with data? The idea is to make business people/testers change the document in MsWord and than generate reports from that. The problem is with tables, Id need to create some special DSL for handling tables and showing hidding text/page parts. Id rather not do that and use some existing solution. I tried to search for something, but I only found frameworks that can produce rtf output from xml input and i want to use rtf as input and output.

    Read the article

  • Why does my git push hang after successfully pushing?

    - by John
    On a newly set up ssh git repo, whenever I push, I get normal output like this: ? git push Counting objects: 15, done. Delta compression using up to 4 threads. Compressing objects: 100% (9/9), done. Writing objects: 100% (9/9), 989 bytes, done. Total 9 (delta 7), reused 0 (delta 0) It happens very quickly, and the changes are immediately available on the server repo. But the output hangs there for about a minute, and then finishes with: To [email protected]:baz.git c8c391c..1de5e80 branch_name -> branch_name If I control-c before it finishes, everything seems to continue to be normal and healthy, locally and remotely. What is it doing while hanging? Is something configured incorrectly on the server side?

    Read the article

  • t-sql getting leaf nodes

    - by stackoverflowuser
    Based on following table (I have kept spaces between the rows for clarity) Path ----------- \node1\node2\node3 \node1\node2\node3\node5 \node1\node6\node3 \node1\node4\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9 \node1\node4\node3\node9\node10 I want to get all the paths containing leaf node. So for instance, following will be considered leaf nodes for path \node1\node4\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9\node10 The following will be the output: Output --------------------------- \node1\node2\node3\node5 \node1\node6\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9\node10 Pls. suggest. Thanks.

    Read the article

  • How to pass parameters with spaces via cstdlib system

    - by buchtak
    Hi, I have this windows console app which takes a file, do some calculations, and then writes the output to a specified file. The input is specified in "app.exe -input fullfilename" format. I need to call this application from my C++ program, but I have a problem with spaces in paths to files. When I call the app directly from cmd.exe by typing (without specifying output file for clarity) "c:\first path\app.exe" -input "c:\second path\input.file" everything works as expected. But, when I try using cstdlib std::system() function, i.e. std::system(" \"c:\\first path\\app.exe\" -input \"c:\\second path\\input.file\" "); the console prints out that c:\first is not any valid command. It's probably common mistake and has simple solution, but I have been unable to find any. Thx for any help.

    Read the article

  • How to group a period of time into yearly periods ? (split timespan into yearly periods)

    - by user315648
    I have a range of two datetimes: DateTime start = new DateTime(2012,4,1); DateTime end = new DateTime(2016,7,1); And I wish to get all periods GROUPED BY YEAR between this period. Meaning the output has to be: 2012-04-01 - 2012-12-31 2013-01-01 - 2013-12-31 2014-01-01 - 2014-12-31 2015-01-01 - 2015-12-31 2016-01-01 - 2016-07-01 Preferably the output would be in IList<Tuple<DateTime,DateTime>> list. How would you do this ? Is there anyway to do this with LINQ somehow ? Oh and daylight saving time is not absolutely critical, but surely a bonus. Thanks!

    Read the article

  • ruby confusing -- local variable or instance_method ?

    - by boblu
    I have the following program. module C def self.included(base) base.extend(ClassMethods) end module ClassMethods def test_for class_eval <<-DEFINECLASSMETHODS def self.my_method(param_a) puts "SELF is: #{self.inspect}" puts param_a puts "#{param_a}" end DEFINECLASSMETHODS end end end class A include C end class B < A test_for end when I run B.new.my_method("aaa"), I got this error NameError: undefined local variable or method `param_a' for B:Class I am quite confused. I define param_a as a local variable in class method my_method, puts param_a runs good, and will output the "aaa". however, puts "#{param_a}" output that error. why? Can anyone explain this?

    Read the article

  • HTML block nested in PHP if statement - is this considered bad practice?

    - by JYelton
    Consider the following example: <table> <tr> <td>Row One</td> </tr> <?php if ($rowtwo) { ?> <tr> <td>Row Two</td> </tr> <?php } ?> </table> If $rowtwo is true, the second row is output, otherwise it is skipped. The code works as desired, however I am evaluating Netbeans (7 beta) as a PHP IDE (instead of just using a text editor). Netbeans flags the code with an error: Misplaced non-space characters insided [sic] a table. Should I consider an alternate way of writing this code, or is Netbeans incapable of understanding this flow control wrapper for HTML output?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • Firing events in script task

    - by Anonymouslemming
    I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

    Read the article

  • Concatinate integer arrays iteratively

    - by Ojtwist
    I have a methode in2.getImagesOneDim() which gives me an array of integers, to be more precise the pixel values of an image. Now i want to create one big array with all the pixel values of all the images. Therefore I have to call this method several times. Now I would like to concatenate the previous output to the current output until all images are read. In some kind of pseudo code, where the + is a concatination ... : for (int i = 1; i < 25; i++) { ConArray = ConArray + in2.getImagesOneDim("../images/"+i); } How would I do this in java ?

    Read the article

  • My rewrite rule is not working

    - by DijkeMark
    I need to make a rewrite rule for a page, but it does not work. I do have mod_rewrite for apache enabled This is my .htacces file: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^gameofthrones/(full|house|characters)\.(all|Stark|Lannister)\.(html|xml|json)$ index.php?output=$3&house=$2&info=$1 </IfModule> But when I enter this url: localhost/school/str-webservices/eindopdracht/index.php?output=html&house=all&info=full It stays that way, but it should be something like: localhost/school/str-webservices/eindopdracht/gameofthrones/full/all/html What am I doing wrong? Thanks in advance, Mark

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • Most efficient method of generating PNG as HTTP response

    - by awj
    I've built an ASP.NET page whose output stream is a dynamically-generated PNG image containing only text on a transparent background. The text is based upon database IDs contained in the querystring. There will be a limited number of variations. Which one of the following would be the most efficient means of returning the image to the client? Store each variation upon the first generation, and thenceforth retrieve this from the drive. Simply generate the image each time. Cache the output response based upon the querystring.

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • Mysql query problem

    - by Lost_in_code
    Below is a sample table: fruits +-------+---------+ | id | type | +-------+---------+ | 1 | apple | | 2 | orange | | 3 | banana | | 4 | apple | | 5 | apple | | 6 | apple | | 7 | orange | | 8 | apple | | 9 | apple | | 10 | banana | +-------+---------+ Following are the two queries of interest: SELECT * FROM fruits WHERE type='apple' LIMIT 2; SELECT COUNT(*) AS total FROM fruits WHERE type='apple'; // output 6 I want to combine these two queries so that the results looks like this: +-------+---------+---------+ | id | type | total | +-------+---------+---------+ | 1 | apple | 6 | | 4 | apple | 6 | +-------+---------+---------+ The output has to be limited to 2 records but it should also contain the total number of records of the type apple. How can this be done with 1 query?

    Read the article

  • CakePHP Form Helper - Show error class, but not error message

    - by Jeremy Penrod
    I'm attempting to customize the error output on the CakePHP 2.0 form helper. Currently, the form renders error messages below the input and applies an 'error' class to the input's label. I have found that I can either disable error reporting altogether for an input, or output the error class and message. I would like the error class to be applied to the label of the offending inputs WITHOUT any message below. How do you turn off the error message outputting for a form, BUT still apply error classes to offending labels?

    Read the article

  • Linux How to print all the files with the same prefix after searching for them?

    - by Alyx
    I need to search through a directory which contains many sub directories, each which contain files. The files read as follows question1234_01, where 1234 are random digits and the suffix _01 is the number of messages that contain the prefix, meaning they are apart of the same continuing thread. find . -name 'quest*' | cut -d_ -f1 | awk '{print $1}' | uniq -c | sort -n example output: 1 quest1234 10 quest1523 This searches for all the files then sorts them in order. What I want to do is print all the files which end up having the most occurrences, in my example the one with 10 matches. So it should only output quest1523_01 - 11

    Read the article

  • Detecting when a process has finished (but not exited)

    - by Egwor
    I have a program that's run in unix (that I have no control over) that when finished prints 'Completed successfully' but does not exit. I want to automatically detect when the process finishes (by checking the output of the command), so that I can kill the process and so that I can proceed do other activities. The complexity comes because I want to be able to run multiples of these scripts concurrently. (One activity I need to do requires the script to be called with various inputs, but each time the script runs it takes a while to return, and so I want to do them in parallel) Has anyone done something similar to this? I could redirect the stderr and stdout output of the command to a temporary file which has a random file name, then tail the file and pipe to grep for the end conditions (I.e. the certain log lines). The problem is, surely tail -f would keep running, and so it would never exit. Should I poll? If so, what's the best approach?

    Read the article

  • Increment number in string

    - by iform
    Hi, I am stumped... I am trying to get the following output until a certain condition is met. test_1.jpg test_2.jpg .. test_50.jpg The solution (if you could remotely call it that) that I have is fileCount = 0 while (os.path.exists(dstPath)): fileCount += 1 parts = os.path.splitext(dstPath) dstPath = "%s_%d%s" % (parts[0], fileCount, parts[1]) however...this produces the following output. test_1.jpg test_1_2.jpg test_1_2_3.jpg .....etc The Question: How do I get change the number in its current place (without appending numbers to the end)? Ps. I'm using this for a file renaming tool.

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • PHP exec problem with s3-put

    - by schneck
    Hi there, I use the s3-bash-project to upload data to an S3-Bucket. My command looks like this: /mypath/s3_bash/s3-put -v -k '123456789' -s '/mypath/secret' -T '/mypath/upload/myuploadfile' '/my.bucket/mykeyname' I can run the command from the command line (Mac OS X), and it works well. Now I want to execute it from a PHP-Script: exec($command, $output); but in output, the "s3-put"-command only returns the command's help text. I log the command, and it works if I c&p it from the log the the command line, so there not a problem. It seems that PHP does not pass all the parameters to the command line, although I run escapeshellarg() over all the parameters. I'm using a local XAMPP-Test environment, safe_mode is off. Any ideas?

    Read the article

< Previous Page | 221 222 223 224 225 226 227 228 229 230 231 232  | Next Page >