Search Results

Search found 30555 results on 1223 pages for 'closed source'.

Page 230/1223 | < Previous Page | 226 227 228 229 230 231 232 233 234 235 236 237  | Next Page >

  • android httpurlconnection [closed]

    - by user620451
    hi im new android developer i am trying to login to my asterisk server passing my username and password it works good but when i am trying to request anther url to the server after login i get access denied and i now the problem because the login connection has disconnected so i want a way to request to urls the first one is login to the server and the second is to do something else after login please help and thx anyway this is a part of my code i want to request this 2 url url1="http://192.168.1.7:8088/rawman?action=login&username=admin&secret=admin" url2="http://192.168.1.5:8088/rawman?action=updateconfig&reload=yes&srcfilename=users.conf&dstfilename=users.conf&Action-000000=newcat&Cat-000000=6001&Var-000000=&Value-000000=" public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); tv1 = (TextView) this.findViewById(R.id.display); ed1 = (EditText) this.findViewById(R.id.editText); bt1 = (Button) this.findViewById(R.id.submit); bt1.setOnClickListener(new OnClickListener() { public void onClick(View view) { { try{ ServerRequest(url1); ServerRequest(url2); } catch(Exception e) { Log.v("Exception", "Exception:"+e.getMessage()); } } } }); } public String ServerRequest(String serverString) throws MalformedURLException, IOException { String newFeed=serverString; StringBuilder response = new StringBuilder(); Log.v("server","server url:"+newFeed); URL url = new URL(newFeed); HttpURLConnection httpconn = (HttpURLConnection) url.openConnection(); if(httpconn.getResponseCode()==HttpURLConnection.HTTP_OK) { BufferedReader input = new BufferedReader( new InputStreamReader(httpconn.getInputStream()), 8192); String strLine = null; while ((strLine = input.readLine()) != null) { response.append(strLine); } input.close(); } tv1.settext(response); return response.toString(); }

    Read the article

  • Looping on a closed range

    - by AProgrammer
    How would you fix this code? template <typename T> void closed_range(T begin, T end) { for (T i = begin; i <= end; ++i) { // do something } } T is constrained to be an integer type, can be the wider of such types and can be signed or unsigned begin can be numeric_limits<T>::min() end can be numeric_limits<T>::max() (in which case ++i will overflow in the above code) I've several ways, but none I really like.

    Read the article

  • Open closed prinicple, problem

    - by Marcus
    Hi, I'm trying to apply OCP to a code snippet I have that in it's current state is really smelly, but I feel I'm not getting all the way to the end. Current code: public abstract class SomeObject {} public class SpecificObject1 : SomeObject {} public class SpecificObject2 : SomeObject {} // Smelly code public class Model { public void Store(SomeObject someObject) { if (someObject is SpecificObject1) {} else if (someObject is SpecificObject2) {} } } That is really ugly, my new approach looks like this: // No so smelly code public class Model { public void Store(SomeObject someObject) { throw new Expception("Not allowed!"); } public void Store(SpecificObject1 someObject) {} public void Store(SpecificObject2 someObject) {} } When a new SomeObject type comes along I must implement how that specific object is stored, this will break OCP cause I need to alter the Model-class. To move the store logic to SomeObject also feels wrong cause then I will violate SRP (?), becuase in this case the SomeObject is almost like a DTO, it's resposibility it not how to know to store itself. If a new implementation to SomeObject comes along who's store implementation is missing I will get a runtime error due to exception in Store method in Model class, it also feels like a code smell. This is because calling code will in the form of IEnumerable<SomeObject> sequence; I will not know the specific types of the sequence objects. I can't seem to grasp the OCP-concept. Anyone has any concrete examples or links that is a bit more than just some Car/Fruit example?

    Read the article

  • What are the features of C#5.0 [closed]

    - by Newbie
    Well I know that there is C#4.0 in dotnet framework 2010. But recently I came across somewhere (possibly in StackOverflow, may be in some answers of Mr. John Skeet) that there is something as C# 5.0(may be in beta). If anyone knows it, could you please highlight about that. Thanks

    Read the article

  • Why isn't this company contacting me? [closed]

    - by Alan
    I had a phone screen the other day with a company that I really want to work for. It went pretty well, based on cues from the HR person, such as "Next step we're going to send you a programming test," and "Well, before I get ahead of myself, do you want to continue the interviewing process." and "We'll send out the test later this afternoon. It doesn't sound like you'll have trouble with it, but I want to be honest we do have a high failure rate on it." The questions asked weren't technical, just going down my resume, and talking about the work I've done, and how it relates to the position. Nothing I couldn't talk through. This was last Thursday. It's now Tuesday, and haven't received the test yet. I sent a follow up email yesterday to the lady who interviewed me, but haven't gotten a response. Anyone had a similar experience? Am I reading too much into this? Or was I off the mark by thinking I had moved on to the next step in the interview process. Since this is a company I really want to work for, I'm driving myself insane enumerating all the various what-if scenarios.

    Read the article

  • [MacOS] Visio-like design software? [closed]

    - by OverTheRainbow
    Hello It's a software-related question but not development-related :-/ A friend of mine is looking for an equivalent on Macintosh to Visio or SmarDraw to draw plans for home improvements. I don't know anything about Macintosh, so would appreciate any feedback on good softwares for this type of applications. Thank you.

    Read the article

  • PC reboots spontaenously: debugging tips [closed]

    - by aaron
    I swapped my core 2 duo for a quad core recently, and generally things run fine, but every now and then my computer just restarts. I don't even get a blue screen (Vista 32). Core temp isn't a problem. My thinking is that my power supply is inadequate, but I haven't been able to test that (one idea was to under clock the cpu to see if that helped, but going up in speed was the only simple thing to do in the BIOS) Two cases where I semi-consistanly get problems: - Borderlands windowed after some period of time (and some other games, but Borderlands does it pretty regularly) - watching a video (e.g. quicktime/vlc) and having another video running Another thought is non-cpu heat? Maybe the graphics card? Any thoughts on how to track this down appreciated. Thanks!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • find a duplicate entry in an array in constant space and O(n) time [closed]

    - by Anubhav Agarwal
    Possible Duplicate: Algorithm to find a duplicate entry in constant space and O(n) time Given an array of N integer such that only one integer is repeated. Find the repeated integer in O(n) time and constant space. There is no range for the value of integers or the value of N For example given an array of 6 integers as 23 45 67 87 23 47. The answer is 23 (I hope this covers ambiguous and vague part) I searched on the net but was unable to find any such question in which range of integers was not fixed. Also here is an example that answers a similar question to mine but here he created a hash table with the highest integer value in C++.But the cpp does not allow such to create an array with 2^64 element(on a 64-bit computer).

    Read the article

  • The use of getters and setters for different programming languages [closed]

    - by leonhart88
    So I know there are a lot of questions on getters and setters in general, but I couldn't find something exactly like my question. I was wondering if people change the use of get/set depending on different languages. I started learning with C++ and was taught to use getters and setters. This is what I understand: In C++ (and Java?), a variable can either be public or private, but we cannot have a mix. For example, I can't have a read-only variable that can still be changed inside the class. It's either all public (can read and change it), or all private (can't read and can only change inside the class). Because of this (and possibly other reasons), we use getters and setters. In MATLAB, I can control the "setaccess" and "getaccess" properties of variables, so that I can make things read-only (can directly access the property, but can't overwrite it). In this case, I don't feel like I need a getter because I can just do class.property. Also, in Python it is considered "Pythonic" to not use getters/setters and to only put things into properties if needed. I don't really understand why its OK to have all public variables in Python, because that's opposite of what I learned when I started with C++. I'm just curious what other people's thoughts are on this. Would you use getters and setters for all languages? Would you only use it for C++/Java and do direct access in MATLAB and Python (which is what I am currently doing)? Is the second option considered bad? For my purposes, I am only referring to simple getters and setters (just return/set the value and do not do anything else). Thanks!

    Read the article

  • apt-get commands pausing at 'Waiting for headers' [closed]

    - by Matt
    I have a VM running Ubuntu Server 9.10 running a basic web server setup. Whenever I run an apt function it will pause for around 1 minute at 'Waiting for headers...'. It will eventually clear through and continue as normal but it is a bit of an annoyance. Everything else on the server seems to run fine. Any ideas?

    Read the article

  • Forced closed only when put alphabetical string in edit text

    - by Abdullah Al Mubarok
    So, I make a checker if an id is in the database or not, the id is in numerical string, the type in database is char(6) though. So this is my code public class input extends Activity{ /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.input); final EditText edittext = (EditText)findViewById(R.id.editText1); Button button = (Button)findViewById(R.id.button1); button.setOnClickListener(new OnClickListener(){ @Override public void onClick(View arg0) { // TODO Auto-generated method stub String nopel = edittext.getText().toString(); if(nopel.length() == 0){ Toast.makeText(getApplicationContext(), "error", Toast.LENGTH_SHORT).show(); }else{ List<NameValuePair> pairs = new ArrayList<NameValuePair>(); pairs.add(new BasicNameValuePair("nopel", nopel)); JSON json_dp = new JSON(); JSONObject jobj_dp = json_dp.getJSON("http://10.0.2.2/KP/pdam/nopel.php", pairs); try { if(jobj_dp.getInt("row") == 0){ Toast.makeText(getApplicationContext(), "error", Toast.LENGTH_SHORT).show(); }else{ String snopel = jobj_dp.getString("nopel"); String snama = jobj_dp.getString("nama"); String salamat = jobj_dp.getString("alamat"); String sgolongan = jobj_dp.getString("golongan"); Intent i = new Intent(input.this, list.class); i.putExtra("nopel", snopel); i.putExtra("nama", snama); i.putExtra("alamat", salamat); i.putExtra("golongan", sgolongan); startActivity(i); } } catch (JSONException e) { // TODO Auto-generated catch block e.printStackTrace(); } } } }); } } the first check is to check if an input is null, it's going right for now, the second check is to check if an id in the database, and it's the problem. When I try some id in numerical value like "0001" or "02013" it's fine, and can run. but when I just got to put "abushd" it forced close. anyone know why I got this?

    Read the article

  • Are you using C++0x today? [closed]

    - by Roger Pate
    This is a question in two parts, the first is the most important and concerns now: Are you following the design and evolution of C++0x? What blogs, newsgroups, committee papers, and other resources do you follow? Even where you're not using any new features, how have they affected your current choices? What new features are you using now, either in production or otherwise? The second part is a follow-up, concerning the new standard once it is final: Do you expect to use it immediately? What are you doing to prepare for C++0x, other than as listed for the previous questions? Obviously, compiler support must be there, but there's still co-workers, ancillary tools, and other factors to consider. What will most affect your adoption? Edit: The original really was too argumentative; however, I'm still interested in the underlying question, so I've tried to clean it up and hopefully make it acceptable. This seems a much better avenue than duplicating—even though some answers responded to the argumentative tone, they still apply to the extent that they addressed the questions, and all answers are community property to be cleaned up as appropriate, too.

    Read the article

  • An existing connection was forcibly closed by the remote host

    - by Alexander
    I am about to give up debugging SMTP servers to send email... My code is the following private void SendMail() { SmtpClient mailClient = new SmtpClient("smtp.mail.yahoo.com", 465); mailClient.EnableSsl = true; MailMessage message = new MailMessage(); message.To.Add("[email protected]"); message.Subject = "i wish it would work"; MailAddress fromAddress = new MailAddress(Email.Text, Name.Text); message.From = fromAddress; mailClient.Send(message); }

    Read the article

  • Reason for not properly closed socket?

    - by gc
    Here is what I am trying to do: The server sends message to connected clients when new messages are available. The client, on the other hand, when connected, tries to send a message to the server using send() and then receive message using recv(), right after that, the client calls close() to close the connection. Sometimes, after the client finishes, the server tries to receive message from client will result in a 104 - "connection reset by peer" error. When this happens, Wireshark reveals that the last two segments sent by the client is: 1. an ACK acknowledging the receipt of the message sent by the server 2. a RST/ACK No FIN is sent by the client. Why is this happening and how can I close the socket "properly" at the client?

    Read the article

  • Why is the 'this' keyword not a reference type in C++ [closed]

    - by Dave Tapley
    Possible Duplicates: Why ‘this’ is a pointer and not a reference? SAFE Pointer to a pointer (well reference to a reference) in C# The this keyword in C++ gets a pointer to the object I currently am. My question is why is the type of this a pointer type and not a reference type. Are there any conditions under which the this keyword would be NULL? My immediate thought would be in a static function, but Visual C++ at least is smart enough to spot this and report static member functions do not have 'this' pointers. Is this in the standard?

    Read the article

< Previous Page | 226 227 228 229 230 231 232 233 234 235 236 237  | Next Page >