Search Results

Search found 8384 results on 336 pages for 'lines'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 232/336 | < Previous Page | 228 229 230 231 232 233 234 235 236 237 238 239  | Next Page >

  • Snort/Barnyard2 Logging

    - by Eric
    I need some help with my Snort/Barnyard2 setup. My goal is to have Snort send unified2 logs to Barnyard2 and then have Barnyard2 send the data to other locations. Here is my currrent setup. OS Scientific Linux 6 Snort Version 2.9.2.3 Barnyard2 Version 2.1.9 Snort command snort -c /etc/snort/snort.conf -i eth2 & Barnyard2 command /usr/local/bin/barnyard2 -c /etc/snort/barnyard2.conf -d /var/log/snort -f snort.log -w /var/log/snort/barnyard.waldo & snort.conf output unified2: filename snort.log, limit 128 barnyard2.conf output alert_syslog: host=127.0.0.1 output database: log, mysql, user=snort dbname=snort password=password host=localhost With this setup, barnyard2 is showing all of the correct information in the database and I'm using BASE to view it on the web GUI. I was hoping to be able to send the full packet data to syslog with barnyard2 but after reading around, it seems that it is impossible to do that. So I then started trying to modify the snort.conf file and add lines like "output alert_full: alert.full". This definitely gave me a lot more information but still not the full packet data like I want. So my question is, is there anyway I can use barnyard2 to send the full packet data of alerts to a human readable file? Since I can't send it directly to syslog, I can create another process to take the data from that file and ship it off to another server. If not, what flags and/or snort.conf configuration would you recommend to get the most data possible but still be able to handle quite a bit of traffic? In the end of it all, these alerts will be shipped to a central server via a SSH tunnel. I'm trying to stay away from databases.

    Read the article

  • fail2ban Error Gentoo

    - by Mark Davidson
    Hi All I've recently setup a new VPS running Gentoo (My first time using the distro so please forgive me is this is a really easy one) and as I've done with other servers installed fail2ban. Setting it up to block the host via iptables, on too many unsuccessful logins with ssh. However I'm getting a strange error that I can't quite solve. When I start fail2ban I get these lines in the error log 2009-11-13 18:02:01,290 fail2ban.jail : INFO Jail 'ssh-iptables' started 2009-11-13 18:02:01,480 fail2ban.actions.action: ERROR iptables -N fail2ban-SSH iptables -A fail2ban-SSH -j RETURN iptables -I INPUT -p tcp --dport ssh -j fail2ban-SSH returned 100 If I try and force a ban these errors show up in the log and the host is not banned 2009-11-13 11:23:26,905 fail2ban.actions: WARNING [ssh-iptables] Ban XXX.XXX.XXX.XXX 2009-11-13 11:23:26,929 fail2ban.actions.action: ERROR iptables -n -L INPUT | grep -q fail2ban-SSH returned 100 2009-11-13 11:23:26,930 fail2ban.actions.action: ERROR Invariant check failed. Trying to restore a sane environment 2009-11-13 11:23:27,007 fail2ban.actions.action: ERROR iptables -N fail2ban-SSH iptables -A fail2ban-SSH -j RETURN iptables -I INPUT -p tcp --dport ssh -j fail2ban-SSH returned 100 2009-11-13 11:23:27,016 fail2ban.actions.action: ERROR iptables -n -L INPUT | grep -q fail2ban-SSH returned 100 2009-11-13 11:23:27,016 fail2ban.actions.action: CRITICAL Unable to restore environment My versions are as follows Linux masked 2.6.18-xen-r12 #2 SMP Wed Mar 4 11:45:03 GMT 2009 x86_64 Intel(R) Xeon(R) CPU E5504 @ 2.00GHz GenuineIntel GNU/Linux net-analyzer/fail2ban-0.8.4 net-firewall/iptables-1.4.3.2 If anyone could shead some light on these errors that would be great, I did wonder if it was a problem with iptables or some kernel modules but I can block an IP if I do. iptables -I INPUT -s 25.55.55.55 -j DROP so makes me think its something a bit more unusual. Thanks a lot in advance

    Read the article

  • mod_rewrite: redirect from subdomain to main domain

    - by Bald
    I have two domains - domain.com and forum.domain.com that points to the same directory. I'd like redirect all request from forum.domain.com to domain.com (for example: forum.domain.com/foo to domain.com/forum/foo) without changing address in addres bar (hidden redirect). I wrote something like this and put it into .htaccess file: Options +FollowSymlinks RewriteEngine on RewriteCond %{HTTP_HOST} ^forum\.example\.net$ RewriteRule (.*) http://example.com/forum/$1 [L] RewriteCond %{REQUEST_FILENAME} !-s [NC] RewriteCond %{REQUEST_FILENAME} !-d [NC] RewriteRule ^(.+) index.php/$1 [L] That works only if I add Redirect directive: RewriteRule (.*) http://example.com/forum/$1 [R,L] But it changes previous address in address bar. EDIT: Ok, let's make it simple. I added those two lines at the end of the c:\windows\system32\drivers\etc\hosts on my local computer: 127.0.0.3 foo.net 127.0.0.3 forum.foo.net Now, I created two virtual hosts: <VirtualHost foo.net:80> ServerAdmin [email protected] ServerName foo.net DocumentRoot "C:/usr/src/foo" </VirtualHost> <VirtualHost forum.foo.net:80> ServerAdmin [email protected] ServerName forum.foo.net DocumentRoot "C:/usr/src/foo" </VirtualHost> ..and directory called "foo", where i put two files: .htaccess and index.php. Index.php: <?php echo $_SERVER['PATH_INFO']; ?> .htaccess: Options +FollowSymlinks RewriteEngine on RewriteBase / RewriteCond %{HTTP_HOST} ^forum\.foo\.net$ RewriteCond %{REQUEST_URI} !^/forum/ RewriteCond %{REQUEST_FILENAME} !-s [NC] RewriteCond %{REQUEST_FILENAME} !-d [NC] RewriteRule ^(.+)$ /index.php/forum/$1 [L] RewriteCond %{HTTP_HOST} !^forum\.foo\.net$ RewriteCond %{REQUEST_FILENAME} !-s [NC] RewriteCond %{REQUEST_FILENAME} !-d [NC] RewriteRule ^(.+) index.php/$1 [L] When I type address http://forum.foo.net/test in address bar, it displays /forum/test which is good. http://foo.net/a/b/c shows /a/b/c which is good. But! http://forum.foo.net/ displays empty value (should display /forum).

    Read the article

  • Split Excel worksheet into multiple worksheets based on a column with VBA (Redux)

    - by Ceeder
    I'm rather new to VBA and I've been working with the code generously displayed and explained by Nixda: Split Excel Worksheet... My only challenge is I've been trying desperately to find a way to include the top 3 rows as a title bu it seems to only allow for one. Here's the code have: Dim Titlesheet As Worksheet iCol = 23 '### Define your criteria column strOutputFolder = (Sheets("Operations").Range("D4")) '### <--Define your path of output folder Set ws = ThisWorkbook.ActiveSheet Set rngLast = Columns(iCol).Find("*", Cells(3, iCol), , , xlByColumns, xlPrevious) Set Titlesheet = Sheets("Input") ws.Columns(iCol).AdvancedFilter Action:=xlFilterInPlace, Unique:=True Set rngUnique = Range(Cells(4, iCol), rngLast).SpecialCells(xlCellTypeVisible) If Dir(strOutputFolder, vbDirectory) = vbNullString Then MkDir strOutputFolder For Each strItem In rngUnique If strItem < "" Then Sheets("Input").Select Range("A1:V3").Select Selection.Copy ws.UsedRange.AutoFilter Field:=iCol, Criteria1:=strItem.Value Workbooks.Add Sheets("Sheet1").Select ActiveSheet.PasteSpecial ws.UsedRange.SpecialCells(xlCellTypeVisible).Copy Destination:=[A4] strFilename = strOutputFolder & "\" & strItem ActiveWorkbook.SaveAs Filename:=strFilename, FileFormat:=xlWorkbookNormal ActiveWorkbook.Close savechanges:=False End If Next ws.ShowAllData Is there something I can change to include these lines? Thanks so much, this code provided by Nixda has taught me a great deal!

    Read the article

  • Reloading NAT configuration on a running VMWare Server 2.0.2

    - by Jonathan Clarke
    I have a server running VMWare Server 2.0.2. The host is Debian Lenny. I have 15-20 virtual machines running, all attached to a single NAT network (named vmnet8). I have configured VMWare's NAT (the vmnet-natd daemon) to forward some incoming to ports to one of the VMs, since it hosts some publicly accessible services. I did this via the file /etc/vmware/vmnet8/nat/nat.conf by adding lines like the following: 80 = 192.168.100.100:80 This works great, I can reach the web server on the VM at 192.168.100.100 by connecting to the host's IP address. Sometimes, I need to add port redirections to this NAT configuration. So, I add a line to the configuration file. Now for the question. How do I make the natd process take this new configuration into account? Clearly, restarting the host machine does take it into account, and the newly added port is forwarded. However, this is not an option on this server, so how should one do this without restarting the whole host? Thanks for any ideas!

    Read the article

  • When using procmail with maildir, it returns error with code I found

    - by bradlis7
    I'm not an expert at procmail, but I have this code: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user, sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Thanks for the help.

    Read the article

  • Apache HTTPD - Segmentation fault when loading mod_jk module

    - by hansengel
    I just set up mod_jk with my Apache httpd 2.0.52 installation, but now when I try to start Apache, it has a segmentation fault. I've checked that I am using the mod_jk compiled for 2.0.x.. built against the same version I have, in fact. I've also verified that the path I'm giving to LoadModule is correct, and the permissions and the ownership of the file are the same as the rest of the modules'. When I remove the "LoadModule" command for mod_jk from my httpd.conf, there is no segmentation fault. Nothing shows in Apache's error logs. I have tried restarting the server with this module using both service httpd restart and httpd. These are the last few lines returned of strace httpd -X: gettimeofday({1292100295, 434487}, NULL) = 0 socket(PF_INET6, SOCK_STREAM, IPPROTO_IP) = -1 EAFNOSUPPORT (Address family not supported by protocol) socket(PF_NETLINK, SOCK_RAW, 0) = 3 bind(3, {sa_family=AF_NETLINK, pid=0, groups=00000000}, 12) = 0 getsockname(3, {sa_family=AF_NETLINK, pid=22378, groups=00000000}, [12]) = 0 time(NULL) = 1292100295 sendto(3, "\24\0\0\0\26\0\1\3\307\342\3M\0\0\0\0\0\305\333\267", 20, 0, {sa_family=AF_NETLINK, pid=0, groups=00000000}, 12) = 20 recvmsg(3, {msg_name(12)={sa_family=AF_NETLINK, pid=0, groups=00000000}, msg_iov(1)=[{"<\0\0\0\24\0\2\0\307\342\3MjW\0\0\2\10\200\376\1\0\0\0"..., 4096}], msg_controllen=0, msg_flags=0}, 0) = 664 recvmsg(3, {msg_name(12)={sa_family=AF_NETLINK, pid=0, groups=00000000}, msg_iov(1)=[{"\24\0\0\0\3\0\2\0\307\342\3MjW\0\0\0\0\0\0\1\0\0\0\10\0"..., 4096}], msg_controllen=0, msg_flags=0}, 0) = 20 close(3) = 0 socket(PF_INET, SOCK_STREAM, IPPROTO_IP) = 3 --- SIGSEGV (Segmentation fault) @ 0 (0) --- +++ killed by SIGSEGV +++ Process 22378 detached Has anyone had a similar problem using Apache 2.0.52 with mod_jk? I might try downloading and building the source for the Apache server and mod_jk myself if there isn't a discovered fix for this.

    Read the article

  • Starfield Wildcard SSL Certificate Not Trusted in All Browsers

    - by Austen Cameron
    I am at a loss as to what else I might try in order to debug this issue with a Starfield Wildcard SSL Certificate. The problem is that in certain browsers (Safari or the most-updated chrome you can get for OS X 10.5.8 for example) the certificate comes up as untrusted, even on the root domain. My server setup / background info: General LAMP setup - CentOS 6.3 - on a Godaddy VPS Starfield Technologies Wildcard SSL certificate Installed using the instructions from godaddy's support pages ssl.conf lines are basically as follows: SSLCertificateFile /path/to/cert/mysite.com.cert SSLCertificateKeyFile /path/to/cert/mysite.key SSLCertificateChainFile /path/to/cert/sf_bundle.crt Everything seemingly worked fine until the other night when I noticed the problem in OS X, I assume it's more browser version related, but have only been able to replicate it on that particular machine. What I have tried: Updating sf_bundle.crt from godaddy's cert repository and Starfield's repository versions Following This ServerFault answer from Jim Phares - changing the ChainFile line to sf_intermediate.crt from Starfield's repository Using http://www.sslshopper.com/ssl-checker.html on my url It says the domain is correctly listed on the certificate but comes up with an error that reads The certificate is not trusted in all web browsers. You may need to install an Intermediate/chain certificate to link it to a trusted root certificate. What might I try next to remedy the untrusted certificate issue? Let me know if there is any other information needed that might help debugging this issue. Thanks in advance!

    Read the article

  • Windows 2003 DNS or IIS6 Problem?

    - by Mario
    Weird DNS problem... We have an intranet located internally on a windows 2003 / iis6 server - DNS handled internally on another windows 2003 server. The intranet, amongst other functions, hosts a ecommerce store I wrote that sells nike apparel embroidered with our company logo. Up until recently, it would send an email to payroll and the cost would be deducted from the employees paycheck. lets say this store is located at http://mydomain.com (only available internally) Now, we've been told by the accountants that we can no longer auto deduct from payroll and the employee needs to pay with a credit card or cash. So i went to thawte.com and ordered an SSL cert to be on the safe side (even though the CC gateway is secure) and they told me i need to drop the .com from the domain name Not wanting to mess with a system thats perfectly functional, i created another DNS entry that just points to mydomain (no .com) and left the old one in there. so they would go to http://mydomain On my Mac (OS X 10.6) i can hit either one just fine On Windows XP / Windows XP Embedded or Windows 7 (the vast majority of the pc's on our network) http://mydomain - returns nothing http://mydomain.com still works https://mydomain.com works but says the cert is invalid (as it should, it was issued to mydomain - not mydomain.com) my question is: why does it work on my Mac and not on a Windows PC (i get dhcp and dns just like any other pc on the network) and will removing the .com one from the DNS server resolve this? I've done all the usual attempts - ipconfig /flushdns, ipconfig /renew and release even going so far as to stop and restart DNS client on my Windows 7 box; rebooting and shutting down - adding a regedit entry something along the lines of SecureResponses and rebooting nothing works... I think its the .com and the not conflicting in DNS but i'm not sure - and why not on OS X We're closed on sunday and i'm going to remote in and see what happens if i remove the .com from DNS but any other ideas? -Mario

    Read the article

  • Issues with creating USB bootable Mountain Lion

    - by Sidd
    I am trying to set up a triple boot Windows 8, Mountain Lion, and Ubuntu. I am stuck though. I have got Windows 8 on a partition, and I am trying to get Mountain Lion on there at this point. I installed a VMware with a Snow Leopard 10.6.2 image on the Windows 8 platform. I used the disk utility in this program in order to get Mountain Lion on there. This is what i did specifically: I got the installesd.dmg. I 'mounted' that file or whatever you call it, and out came something along the lines of "Install Mountain Lion OS x" (something like that - it was like a submenu under the installesd.dmg in the disk utility). I got my PNY 8 gb Attache Flash Drive and went to the Erase tab of disk utility. I erased it using the Mac OS Extended (Journaled) setting and called it "Mac". I went to the Restore tab, dragged "Mac" into destination, and dragged "Install Mountain Lion OS x" to the source. Everything seemed to go well, but it didn't. When trying to boot from the flash drive (and yes, I set the BIOS correctly), it skipped it, and loaded Windows 8 normally as if nothing was plugged in. When I try looking at the flash drive in windows 8, it comes up as a 200 mb capacity drive labeled "EFI" with nothing in it (remember, it was 8gb in the beginning). I downloaded Plop Boot Manager, but it did not recognize a USB being plugged in. Does anyone know how I could fix this?

    Read the article

  • Menu tab completion for recent history in zsh

    - by dat5h
    I am interested in a potential zle widget for zsh. Is there a way to build a widget that mimics the kill-completion selectable menu? Essentially I want to be able to press , tab in vi-command-mode, or maybe !-tab-completion at the shell and get a list of recent history (or related history compared what is already entered at the commandline) that allows me to scroll through it and possibly select a relevant function to call or compare similar calls. Looking through the manual I stumbled onto a similar widget that I have mapped like so: # tab completion history menu (vicmd) autoload -z history-beginning-search-menu zle -N history-beginning-search-menu-space-end history-beginning-search-menu bindkey -M vicmd "\t" history-beginning-search-menu-space-end # emacs binding could be "\e\t"? (I wouldn't know) Therefore, if I enter vicmd and hit tab when I enter something like "grep", then I get a list of all grep calls in history. It also asks me for the list-number and it will perform the numbered item in history. If I enter a space and then try this, it lists ALL of my history history. This is fairly close to what I want, but there are some problems. For example, 1) it prints the entire list of relevant history and does not check the number of lines of the screen so it could easily blow up the space on the terminal; 2) when I type in numbers for selecting an item in history it does not show me the numbers I type, so I may make a mistake and have to start over again; 3) I would love to be able to hook in appearance tweaks. I was wondering if there exists more updated version of this widget or if there is any way to look at the source for kill-completion or history-beginning-search-menu to see if I could think of a way to do it.

    Read the article

  • Can't successfully run Sharepoint Foundation 2010 first time configuration

    - by Robert Koritnik
    I'm trying to run the non-GUI version of configuration wizard using power shell because I would like to set config and admin database names. GUI wizard doesn't give you all possible options for configuration (but even though it doesn't do it either). I run this command: New-SPConfigurationDatabase -DatabaseName "Sharepoint2010Config" -DatabaseServer "developer.mydomain.pri" -AdministrationContentDatabaseName "Sharepoint2010Admin" -DatabaseCredentials (Get-Credential) -Passphrase (ConvertTo-SecureString "%h4r3p0int" -AsPlainText -Force) Of course all these are in the same line. I've broken them down into separate lines to make it easier to read. When I run this command I get this error: New-SPConfigurationDatabase : Cannot connect to database master at SQL server a t developer.mydomain.pri. The database might not exist, or the current user does not have permission to connect to it. At line:1 char:28 + New-SPConfigurationDatabase <<<< -DatabaseName "Sharepoint2010Config" -Datab aseServer "developer.mydomain.pri" -AdministrationContentDatabaseName "Sharepoint 2010Admin" -DatabaseCredentials (Get-Credential) -Passphrase (ConvertTo-SecureS tring "%h4r3p0int" -AsPlainText -Force) + CategoryInfo : InvalidData: (Microsoft.Share...urationDatabase: SPCmdletNewSPConfigurationDatabase) [New-SPConfigurationDatabase], SPExcep tion + FullyQualifiedErrorId : Microsoft.SharePoint.PowerShell.SPCmdletNewSPCon figurationDatabase I created two domain accounts and haven't added them to any group: SPF_DATABASE - database account SPF_ADMIN - farm account I'm running powershell console as domain administrator. I've tried to run SQL Management studio as domain admin and created a dummy database and it worked without a problem. I'm running: Windows 7 x64 on the machine where Sharepoint Foundation 2010 should be installed and also has preinstalled SQL Server 2008 R2 database Windows Server 2008 R2 Server Core is my domain controller that just serves domain features and nothing else I've installed Sharepoint according to MS guides http://msdn.microsoft.com/en-us/library/ee554869%28office.14%29.aspx installing all additional patches that are related to my configuration. Any ideas what should I do to make it work?

    Read the article

  • SSH garbling characters in vim/nano on remote server

    - by geerlingguy
    ... and it's driving me insane. Basically (this has been happening over the past couple months), I log into a few different CentOS servers (one Linode, another VPS, and a shared host to which I have shell access), running 5.5, 5.7, and 6, from my Mac running OS X Lion, using Terminal. Basically: $ ssh [email protected] [remote-host] $ nano somefile.txt Once I start editing the file, if I use the arrow keys to move around the cursor, or start deleting, then typing again, the cursor jumps around a bit, and if I save the file and reopen it, it's obvious that the cursor was, in fact, jumping all over the place on a line for no apparent reason. I end up getting things like "This is a neof text." When I had typed in (to the cursor-crazy editor) "This is a line of text." It's a big problem when it comes to editing configuration files, because I often have to edit one line, save and close, then reopen just to make sure that line is right... then edit another line... and it's getting quite annoying. I found Linode Lish Shell Vim and Nano rendering troubles: lines not appearing / cursor positions wrong, but I don't know if that relates much, since that's specifically referring to lish.

    Read the article

  • How to list rpm packages/subpackages sorted by total size

    - by smci
    Looking for an easy way to postprocess rpm -q output so it reports the total size of all subpackages matching a regexp, e.g. see the aspell* example below. (Short of scripting it with Python/PERL/awk, which is the next step) (Motivation: I'm trying to remove a few Gb of unnecessary packages from a CentOS install, so I'm trying to track down things that are a) large b) unnecessary and c) not dependencies of anything useful like gnome. Ultimately I want to pipe the ouput through sort -n to what the space hogs are, before doing rpm -e) My reporting command looks like [1]: cat unwanted | xargs rpm -q --qf '%9.{size} %{name}\n' > unwanted.size and here's just one example where I'd like to see rpm's total for all aspell* subpackages: root# rpm -q --qf '%9.{size} %{name}\n' `rpm -qa | grep aspell` 1040974 aspell 16417158 aspell-es 4862676 aspell-sv 4334067 aspell-en 23329116 aspell-fr 13075210 aspell-de 39342410 aspell-it 8655094 aspell-ca 62267635 aspell-cs 16714477 aspell-da 17579484 aspell-el 10625591 aspell-no 60719347 aspell-pl 12907088 aspell-pt 8007946 aspell-nl 9425163 aspell-cy Three extra nice-to-have things: list the dependencies/depending packages of each group (so I can figure out the uninstall order) Also, if you could group them by package group, that would be totally neat. Human-readable size units like 'M'/'G' (like ls -h does). Can be done with regexp and rounding on the size field. Footnote: I'm surprised up2date and yum don't add this sort of intelligence. Ideally you would want to see a tree of group-package-subpackage, with rolled-up sizes. Footnote 2: I see yum erase aspell* does actually produce this summary - but not in a query command. [1] where unwanted.txt is a textfile of unnecessary packages obtained by diffing the output of: yum list installed | sed -e 's/\..*//g' > installed.txt diff --suppress-common-lines centos4_minimal.txt installed.txt | grep '>' and centos4_minimal.txt came from the Google doc given by that helpful blogger.

    Read the article

  • Apache 2.2, worker mpm, mod_fcgid and PHP: Can't apply process slot

    - by mopoke
    We're having an issue on an apache server where every 15 to 20 minutes it stops serving PHP requests entirely. On occasions it will return a 503 error, other times it will recover enough to serve the page but only after a delay of a minute or more. Static content is still served during that time. In the log file, there's errors reported along the lines of: [Wed Sep 28 10:45:39 2011] [warn] mod_fcgid: can't apply process slot for /xxx/ajaxfolder/ajax_features.php [Wed Sep 28 10:45:41 2011] [warn] mod_fcgid: can't apply process slot for /xxx/statics/poll/index.php [Wed Sep 28 10:45:45 2011] [warn] mod_fcgid: can't apply process slot for /xxx/index.php [Wed Sep 28 10:45:45 2011] [warn] mod_fcgid: can't apply process slot for /xxx/index.php There is RAM free and, indeed, it seems that more php processes get spawned. /server-status shows lots of threads in the "W" state as well as some FastCGI processes in "Exiting(communication error)" state. I rebuilt mod_fcgid from source as the packaged version was quite old. It's using current stable version (2.3.6) of mod_fcgid. FCGI config: FcgidBusyScanInterval 30 FcgidBusyTimeout 60 FcgidIdleScanInterval 30 FcgidIdleTimeout 45 FcgidIOTimeout 60 FcgidConnectTimeout 20 FcgidMaxProcesses 100 FcgidMaxRequestsPerProcess 500 FcgidOutputBufferSize 1048576 System info: Linux xxx.com 2.6.28-11-server #42-Ubuntu SMP Fri Apr 17 02:45:36 UTC 2009 x86_64 GNU/Linux DISTRIB_ID=Ubuntu DISTRIB_RELEASE=9.04 DISTRIB_CODENAME=jaunty DISTRIB_DESCRIPTION="Ubuntu 9.04" Apache info: Server version: Apache/2.2.11 (Ubuntu) Server built: Aug 16 2010 17:45:55 Server's Module Magic Number: 20051115:21 Server loaded: APR 1.2.12, APR-Util 1.2.12 Compiled using: APR 1.2.12, APR-Util 1.2.12 Architecture: 64-bit Server MPM: Worker threaded: yes (fixed thread count) forked: yes (variable process count) Server compiled with.... -D APACHE_MPM_DIR="server/mpm/worker" -D APR_HAS_SENDFILE -D APR_HAS_MMAP -D APR_HAVE_IPV6 (IPv4-mapped addresses enabled) -D APR_USE_SYSVSEM_SERIALIZE -D APR_USE_PTHREAD_SERIALIZE -D SINGLE_LISTEN_UNSERIALIZED_ACCEPT -D APR_HAS_OTHER_CHILD -D AP_HAVE_RELIABLE_PIPED_LOGS -D DYNAMIC_MODULE_LIMIT=128 -D HTTPD_ROOT="" -D SUEXEC_BIN="/usr/lib/apache2/suexec" -D DEFAULT_PIDLOG="/var/run/apache2.pid" -D DEFAULT_SCOREBOARD="logs/apache_runtime_status" -D DEFAULT_ERRORLOG="logs/error_log" -D AP_TYPES_CONFIG_FILE="/etc/apache2/mime.types" -D SERVER_CONFIG_FILE="/etc/apache2/apache2.conf" Apache modules loaded: alias.load auth_basic.load authn_file.load authz_default.load authz_groupfile.load authz_host.load authz_user.load autoindex.load cgi.load deflate.load dir.load env.load expires.load fcgid.load headers.load include.load mime.load negotiation.load rewrite.load setenvif.load ssl.load status.load suexec.load PHP info: PHP 5.2.6-3ubuntu4.6 with Suhosin-Patch 0.9.6.2 (cli) (built: Sep 16 2010 19:51:25) Copyright (c) 1997-2008 The PHP Group Zend Engine v2.2.0, Copyright (c) 1998-2008 Zend Technologies

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Ati X1600 driver problem on Mac

    - by Mulot
    Hi all, I currently own a 06' Macbook pro 1.1, and since some months I have recurrent problems of displays bug or artifacts. I searched quickly around to see that a lot of other users on Mac (iMac or Macbook pro) also have the same problem due to a problem for the X1600 video card. Apparently it's due to overheating problem, in my case even without warming a lot I have very bad display bugs such as colorful pixel lines, or glitches, and freeze and crash, all of this on Tiger, Leopard and Snow Leopard. I found this interesting article here talking about this problem and trying to gather people so that Apple take the serious GPU problem in consideration. In one of the comments, an user said he removed all bundle named with "radeon" and then he had no more problems under Leopard, and seems ot work fine well too on Snow Leopard. I did the same thing, I removed the bundles of the driver, restart, and no more problems, but not more 3D acceleration, which is not an acceptable solution. For those interested, here is the list of files to be deleted to stop having this problem. /System/Library/Extensions/ATIRadeonX1000.kext /System/Library/Extensions/ATIRadeonX1000GA.plugin /System/Library/Extensions/ATIRadeonX1000GLDriver.bundle /System/Library/Extensions/ATIRadeonX1000VADriver.bundle /System/Library/Extensions/ATIRadeonX2000.kext /System/Library/Extensions/ATIRadeonX2000GA.plugin /System/Library/Extensions/ATIRadeonX2000GLDriver.bundle /System/Library/Extensions/ATIRadeonX2000VADriver.bundle I would like to know if there is a way to fix this using other drivers if that's possible or by creating a group to force Apple to make a replacement program in place. Edit : How to locate those files on your hard drive if you are not under Snow Tiger : sudo find / -iname "*radeon*"

    Read the article

  • Juniper router dropping pings to external interface

    - by Alexander Garden
    My organization has a Juniper SSG20-WLAN that routes our traffic to the outside world. We've been having intermittent problems with our internet connection so I wrote up a Python script to ping the internal interface of the router, the external interface, a couple of our internal servers, the ISP router our router talks to, their upstream provider, and Google and Yahoo for good measure. It does that about every minute. What I have found is that when our internet goes out, our Juniper router ceases responding to pings on the external interface. Everything past that is, of course, unreachable. The internal interface and our internal servers continue to echo back without interruption. None of the counters indicate dropped packets of any type. They all look normal. The logs complain about VIP servers being unavailable but otherwise nothing indicative of network issues. My questions are these: Does this exonerate our ISP? Or, contrawise, might a problem with the connection be causing the external interface to go down? Is there somewhere else in the SSG20, beside the system log and counters, that might help me track down info on the problem? UPDATE: Turned out that one of the switches between my monitoring box and the router was a router itself, and occasionally diverting from the gateway to itself. Kudos to those who made suggestions along those lines. Not really sure which answer to mark as accepted, as it was really stuff in the comments that turned out to be right. Thanks for the suggestions.

    Read the article

  • Apache > 2.2.22 rewrite rule not working?

    - by EBAH
    since yesterday I'm trying to figure out how to fix the following: running phpipam (http://www.phpipam.net/) with WAMP (Windows environment). The problem I am facing is related with RewriteRule functionality, so forget phpipam for a moment and concentrate on few lines of code. Here is the directory structure of my test website that emulate the first steps phpipam does (you can download http://goo.gl/ksvuGc): C:\wamp\www\rewrite-tst\ C:\wamp\www\rewrite-tst\.htaccess C:\wamp\www\rewrite-tst\index.php C:\wamp\www\rewrite-tst\install C:\wamp\www\rewrite-tst\install\index.php It seems that the following rewrite rule in .htaccess doesn't work: C:\wamp\www\rewrite-tst\.htaccess # install RewriteRule ^install$ install/ [R] RewriteRule ^install/$ index.php?page=install When opening C:\wamp\www\rewrite-tst\index.php the first step check the URL for "install" argument. Since the URL is: http://localhost/rewrite-tst no arguments are supplied and the browser is redirected to: header("Location: /rewrite-tst/install/") At this point the browser opens the page: C:\wamp\www\rewrite-tst\install\index.php >> http://localhost/rewrite-tst/install Apache, thanks to C:\wamp\www\rewrite-tst.htaccess should intercept this URL and redirect to: http://localhost/rewrite-tst/index.php?page=install Here are my tries: Win Apache 2.2.22: works Win Apache 2.4.4: KO Win Apache 2.4.6: KO In the attached zip file you can also find two traces from apache RewriteLog which I can't understand very well. Why Apache 2.4 doesn't work on Windows? Is it possible that there's a bug on Windows version of Apache (2.4.4 and 2.4.6) or am I wrong someway? Thanks for your help!!! Evan -- UPDATE 12 oct 2013 Now I'm really confused! Working on Linux, Kubuntu 13.04. Linux Apache 2.2.22: works Linux Apache 2.4.6: KO I guess there's something wrong in my rules at this point, or some change happened from Apache 2.2 to 2.4 ...

    Read the article

  • How can I automatically restart Apache and Varnish if can't fetch a file?

    - by Tyler
    I need to restart Apache and Varnish and email some logs when the script can't fetch robots.txt but I am getting an error ./healthcheck: 43 [[: not found My server is Ubuntu 12.04 64-bit #!/bin/sh # Check if can fetch robots.txt if not then restart Apache and Varnish # Send last few lines of logs with date via email PATH=/bin:/usr/bin THEDIR=/tmp/web-server-health [email protected] mkdir -p $THEDIR if ( wget --timeout=30 -q -P $THEDIR http://website.com/robots.txt ) then # we are up touch ~/.apache-was-up else # down! but if it was down already, don't keep spamming if [[ -f ~/.apache-was-up ]] then # write a nice e-mail echo -n "Web server down at " > $THEDIR/mail date >> $THEDIR/mail echo >> $THEDIR/mail echo "Apache Log:" >> $THEDIR/mail tail -n 30 /var/log/apache2/error.log >> $THEDIR/mail echo >> $THEDIR/mail echo "AUTH Log:" >> $THEDIR/mail tail -n 30 /var/log/auth.log >> $THEDIR/mail echo >> $THEDIR/mail # kick apache echo "Now kicking apache..." >> $THEDIR/mail /etc/init.d/varnish stop >> $THEDIR/mail 2>&1 killall -9 varnishd >> $THEDIR/mail 2>&1 /etc/init.d/varnish start >> $THEDIR/mail 2>&1 /etc/init.d/apache2 stop >> $THEDIR/mail 2>&1 killall -9 apache2 >> $THEDIR/mail 2>&1 /etc/init.d/apache2 start >> $THEDIR/mail 2>&1 # prepare the mail echo >> $THEDIR/mail echo "Good luck troubleshooting!" >> $THEDIR/mail # send the mail sendemail -o message-content-type=html -f [email protected] -t $EMAIL -u ALARM -m < $THEDIR/mail rm ~/.apache-was-up fi fi rm -rf $THEDIR

    Read the article

  • Setting up dnsmasq for a local network

    - by WishCow
    Me, and a small group of developers have just moved to a new office, and I'd like to set up dnsmasq on our development server, so when we deploy web apps there, we don't have to edit our own hosts files. We have a router at 192.168.3.1 which we don't have access to. I figured I'd install a DNS server on the development box, and we all record it's IP as a secondary DNS server. Unfortunately I'm strugling to make this work. The name of the devel server is devbox, it's IP is 192.168.3.99, and it's running the latest Ubuntu Server (Karmic) My computer is running Ubuntu Desktop (Karmic) What I'd like to achieve Let's say I have three websites, website1, website2, website3, running on the development box. I'd like to access them by the urls: http://website1.devbox http://website2.devbox http://website3.devbox So I have configured Apache on the devel box, installed dnsmasq, and put the following lines into it's hosts file: 192.168.3.99 website1.devbox 192.168.3.99 website2.devbox 192.168.3.99 website3.devbox and edited my own resolv.conf file to include the devel box as a nameserver: nameserver 192.168.3.99 It's working fine, I can access the sites. The problem is that it doesn't scale well. I'd like all the domains ending with .devbox forwarded to the development box, and this is what I'm struggling with. I have tried putting 192.168.3.99 devbox into the hosts file, and editing the line in dnsmasq.conf: # Add local-only domains here, queries in these domains are answered # from /etc/hosts or DHCP only. local=/devbox/ But I cannot get it working. If I try any url that is not explicitly present in the development box's hosts file, the dns lookup fails. Is the local directive for something else? Am I looking at the wrong place?

    Read the article

  • Setting up dnsmasq for a local network

    - by WishCow
    Me, and a small group of developers have just moved to a new office, and I'd like to set up dnsmasq on our development server, so when we deploy web apps there, we don't have to edit our own hosts files. We have a router at 192.168.3.1 which we don't have access to. I figured I'd install a DNS server on the development box, and we all record it's IP as a secondary DNS server. Unfortunately I'm strugling to make this work. The name of the devel server is devbox, it's IP is 192.168.3.99, and it's running the latest Ubuntu Server (Karmic) My computer is running Ubuntu Desktop (Karmic) What I'd like to achieve Let's say I have three websites, website1, website2, website3, running on the development box. I'd like to access them by the urls: http://website1.devbox http://website2.devbox http://website3.devbox So I have configured Apache on the devel box, installed dnsmasq, and put the following lines into it's hosts file: 192.168.3.99 website1.devbox 192.168.3.99 website2.devbox 192.168.3.99 website3.devbox and edited my own resolv.conf file to include the devel box as a nameserver: nameserver 192.168.3.99 It's working fine, I can access the sites. The problem is that it doesn't scale well. I'd like all the domains ending with .devbox forwarded to the development box, and this is what I'm struggling with. I have tried putting 192.168.3.99 devbox into the hosts file, and editing the line in dnsmasq.conf: # Add local-only domains here, queries in these domains are answered # from /etc/hosts or DHCP only. local=/devbox/ But I cannot get it working. If I try any url that is not explicitly present in the development box's hosts file, the dns lookup fails. Is the local directive for something else? Am I looking at the wrong place?

    Read the article

  • How do I stop MSYS from transforming my compiler options?

    - by Carl Norum
    Is there a way to stop MSYS/MinGW from transforming what it thinks are paths on my command lines? I have a project that's using nmake & Microsoft Visual Studio 2003 (yeecccch). I have the build system all ported and ready to go for GNU make (and tested with Cygwin). Something weird is happening to my compiler flags when I try to compile in an MSYS environment, though. Here's a simplified example: $ cl /nologo Microsoft (R) 32-bit C/C++ Optimizing Compiler Version 13.10.6030 for 80x86 Copyright (C) Microsoft Corporation. All rights reserved. /out:nologo.exe C:/msys/1.0/nologo LINK : fatal error LNK1181: cannot open input file 'C:/msys/1.0/nologo.obj' As you can see, MSYS is transforming the /nologo compiler switch into a windows path, and then sending that to the compiler. I really don't want this to happen - in fact I'd be happy if MSYS never transformed any paths - my build system had to take care of all that when I first ported to Cygwin. Is there a way to make that happen? It does work to change the command to $ cl -nologo Which produces the expected results, but this build system is very large and very painful to update. I really don't want to have to go in and change every use of a / for a flag to a -. In particular, there may be tools that don't support the use of the - at all, and then I'll really be stuck. Thanks for any suggestions!

    Read the article

  • NIS: which mechanism hides shadow.byname for unpriviledged users?

    - by Mark Salzer
    On some Linux box (SLES 11.1) which is a NIS client I can do as root: ypcat shadow.byname and get output, i.e. some lines with the encrypted passwords, amongst other information. On the same Linux box, if I run the same command as unpriviledged user, I get No such map shadow.byname. Reason: No such map in server's domain Now I am surprised. My good old knowlege says that shadow passwords in NIS are absurd because there is no access control or authentication in the protocol and thus every (unpriviledged) user can access the shadow map and thereby obtain the encrypted passwords. Obviously we have a different picture here. Unfortunately I don't have access to the NIS server to figure out what is happening. My only guess is that the NIS master gives the map only to clients conection from a priviledged port (1024), but this is only an uneducated guess. What mechanisms are there in current NIS implementations to lead to a behavior like the above? How "secure" are they? Can the be circumvented easily? Or are shadow passwords in NIS as secure as the good old shadow files?

    Read the article

  • Replacing latex with unicode symbols

    - by Elazar Leibovich
    Often, during a conversation or an email, or at a forum, I would like to type some math, but I don't need full equation support. Unicode symbols should suffice. What I need is an easy way to type math related unicode symbols. Since I already know latex, it makes sense to use the latex symbol mnemonics to type the math symbols. What I currently did is to write an AutoHotKey script which automatically replaces \latexSymbol with the corresponding unicode symbol, using the "hotstrings" AutoHotKey feautres. However, the AutoHotKey hotstrings proved unstable for many strings. Having a couple of tens lines would cause AHK to fail recognizing the strings from time to time. Any other solution? (No, Alt+unicode number isn't convenient enough) Attached is my AHK script. The PutUni function is taken from here. ::\infty:: PutUni("e2889e") return ::\sum:: PutUni("e28891") return ::\int:: PutUni("e288ab") return ::\pm:: PutUni("c2b1") return ::\alpha:: PutUni("c991") return ::\beta:: PutUni("c992") return ::\phi:: PutUni("c9b8") return ::\delta:: PutUni("ceb4") return ::\pi:: PutUni("cf80") return ::\omega:: PutUni("cf89") return ::\in:: PutUni("e28888") return ::\notin:: PutUni("e28889") return ::\iff:: PutUni("e28794") return ::\leq:: PutUni("e289a4") return ::\geq:: PutUni("e289a5") return ::\sqrt:: PutUni("e2889a") return ::\neq:: PutUni("e289a0") return ::\subset:: PutUni("e28a82") return ::\nsubset:: PutUni("e28a84") return ::\nsubseteq:: PutUni("e28a88") return ::\subseteq:: PutUni("e28a86") return ::\prod:: PutUni("e2888f") return ::\N:: PutUni("e28495") return

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 228 229 230 231 232 233 234 235 236 237 238 239  | Next Page >