Search Results

Search found 8416 results on 337 pages for 'stop'.

Page 232/337 | < Previous Page | 228 229 230 231 232 233 234 235 236 237 238 239  | Next Page >

• How to handle this "session failed to write file" error in PHP?

  - by alex

  I am using the Kohana 3 framework, and am using the native session driver. For some reason, occasionally the sessions fail to write to their file. Warning: session_start() [function.session-start]: open(/tmp/sess_*****, O_RDWR) failed: Permission denied (13) in /home/site/public_html/system/classes/kohana/session/native.php on line 27 I am pretty sure Kohana has its own in built error handler, but it is not triggered with this error (i.e. it shows up like a normal PHP error, not the Kohana error). Anyone that has ever used Kohana will notice this seems to have bypassed Kohana's error handling (perhaps set with set_error_handler()). Is there anyway to stop this error from appearing without switching from the native session (i.e. file based) driver? Should I just give good practice the boot and append an @ error suppressor to session_start() in the core code of Kohana? Should I relax the error_reporting()? Thanks

  Read the article

• Run C# code after running all javascript codes

  - by Devi

  I am having a form in which a button is there on click of that button i am calling a javascript function in which i am displaying like 3.. 2.. 1 kind of effect then i am returning true. But after showing 3 only return true is getting executed and the form is getting submitted. How to stop form submitting before running the script. Edit: function jsFun() { timerCount(3); //Calling the Timer Function. } var t; function timerCount(cDown) { if (cDown == 0) { clearTimeout(t); return true; } $('#<%= mainContainer.ClientID %>').html(cDown); cDown = cDown - 1; t = setTimeout('timerCount(' + cDown + ')', 1000); } <asp:Button ID="btnStarts" runat="server" Text="Start" OnClientClick="return jsFun();" OnClick="btn_click" />

  Read the article

• How to run a progress-bar through an insert query?

  - by Gold

  I have this insert query: try { Cmd.CommandText = @"INSERT INTO BarcodTbl SELECT * FROM [Text;DATABASE=" + PathI + @"\].[Tmp.txt];"; Cmd.ExecuteNonQuery(); Cmd.Dispose(); } catch (Exception ex) { MessageBox.Show(ex.Message); } I have two questions: How can I run a progress-bar from the beginning to the end of the insert? If there is an error, I got the error exception and the action will stop - the query stops and the BarcodTbl is empty. How I can see the error and allow the query to continue filling the table?

  Read the article

• Detecting metadata-only read requests in windows filesystem

  - by HyLian

  Hello, I'm developing a kind of filesystem driver. All of read requests that windows makes to my filesystem goes by the driver implementation. I would like to distinguish between "normal" read requests and those who want to get only the metadata from the file. ( Windows reads first 4K of the file and then stop reading ). Does Windows mark this metadata reads in some way? It would be very useful in order to treat that two kind of operations in a different way. In a typical CreateFile call, we have AccessMode, ShareMode, CreationDisposition and FlagsAndAttributes parameters ( being DWORD ), i'm not sure if it's possible to extract some clue of the operation requested. Thanks for reading :)

  Read the article

• Find -type d with no subfolders

  - by titatom

  Good morning ! This is a simple one I believe, but I am still a noob :) I am trying to find all folders with a certain name. I am able to do this with the command find /path/to/look/in/ -type d | grep .texturedata The output gives me lots of folders like this : /path/to/look/in/.texturedata/v037/animBMP But I would like it to stop at .texturedata : /path/to/look/in/.texturedata/ I have hundreds of these paths and would like to lock them down by piping the output of grep into chmod 000 I was given a command with the argument -dpe once, but I have no idea what it does and the Internet has not be able to help me determine it's usage Thanks you very much for your help !

  Read the article

• Embedded quicktime video pause on click how to prevent?

  - by Marek

  I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

  Read the article

• Location inheritInChildApplications kill debugger?

  - by chobo2

  Hi I am wondering is this normal when you add this into your web.config <location path="." inheritInChildApplications="false"> </location> The debugger should stop working. Like when I add this to my site and try to run in debug mode it won't activate any of my debug points nor will it lock up Visual studios 2008. I can have it running and still make edits to my C# code. I take the line away and I get the debug mode back and it locks up VS2008.

  Read the article

• emacs debugger: how can I step-out, step-over ?

  - by Cheeso

  I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

  Read the article

• How do I "think in AngularJS" if I have a jQuery background?

  - by Mark Rajcok

  How do I “think in AngularJS” if I have a jQuery background? Suppose I'm familiar with developing client-side applications in jQuery, but now I'd like to start using AngularJS. Can you describe the paradigm shift that is necessary? Here are a few questions that might help you frame an answer: How do I architect and design client-side web applications differently? What is the biggest difference? What should I stop doing/using; what should I start doing/using instead? Are there any server-side considerations/restrictions? I'm not looking for a detailed comparison between jQuery and AngularJS.

  Read the article

• What is "with" used for in PHP?

  - by Jason

  I have come across this line in the eloquent ORM library: return with(new static)->newQuery(); I've never seen "with" used before, and cannot find it in the PHP documentation. I'm guessing "with" is a stop-word in most searches, so I am not even getting close. Never having encountered "with" in many years of programming PHP, I feel like I'm missing out. What does it do? I did come across one passing comment regarding the ORM, that mentioned "with" is no longer needed in PHP-5.4, but that was as much as was said.

  Read the article

• When to use a service in Android

  - by Computerish

  Hi everyone, I have a class that fetches data in response to button presses in the main activity. Unfortunately, I keep running into problems because this class is not an Activity or a Service. For example, without a Context I cannot translate a resource id into a string: getString(R.string.example_string); // Doesn't work Should I make this class into a Service and have the main Activity stop the class when it is closed? Should I pass the Context from the Activity into this class like this? MyClass c = new MyClass(this); Or is there some better way to handle this problem? This issue also comes up when I try to send a Toast from this class.

  Read the article

• Next Identity Key LINQ + SQL Server

  - by user569347

  To represent our course tree structure in our Linq Dataclasses we have 2 columns that could potentially be the same as the PK. My problem is that if I want to Insert a new record and populate 2 other columns with the PK that was generated there is no way I can get the next identity and stop conflict with other administrators who might be doing the same insert at the same time. Case: A Leaf node has right_id and left_id = itself (prereq_id) **dbo.pre_req:** prereq_id left_id right_id op_id course_id is_head is_coreq is_enforced parent_course_id and I basically want to do this: pre_req rec = new pre_req { left_id = prereq_id, right_id = prereq_id, op_id = 3, course_id = query.course_id, is_head = true, is_coreq = false, parent_course_id = curCourse.course_id }; db.courses.InsertOnSubmit(rec); try { db.SubmitChanges(); } Any way to solve my dilemma? Thanks!

  Read the article

• Why can't i call Contains method from my array?

  - by xbnevan

  Arrrg!I am running into what i feel is a dumb issue with a simple script i'm writing in powershell. I am invoking a sql command that is calling a stored proc, with the results i put it a array. The results look something like this: Status ProcessStartTime ProcessEndTime ------ ---------------- -------------- Expired May 22 2010 8:31PM May 22 2010 8:32PM What i'm trying to do is if($s.Contains("Expired")) , report failed. Simple...? :( Problem i'm running into is it looks like Contains method is not being loaded as i get an error like this: Method invocation failed because [System.Object[]] doesn't contain a method named 'Contains'. At line:1 char:12 + $s.Contains <<<< ("Expired") + CategoryInfo : InvalidOperation: (Contains:String) [], RuntimeException + FullyQualifiedErrorId : MethodNotFound So, what can i do to stop powershell from unrolling it to string? Actual ps script below - $s = @(Invoke-Sqlcmd -Query "USE DB GO exec Monitor_TEST_ps 'EXPORT_RUN',NULL,20 " ` -ServerInstance "testdb002\testdb_002") if ($s.Contains("Expired")) { Write-Host "Expired found, FAIL." } else { Write-Host "Not found, OK." }

  Read the article

• (conditional) Multiple Event Handlers C#

  - by gjk

  A portion of my program requires a "flag" retrieval, that is I am fetching a value that is either True or False, and based on this return value two things could follow. 1) The flag is true, aka "go ahead", and I retrieve data from a database. 2) The flag is false, and I want to prevent the data from being retrieved. Now, this check has to be performed before any function that would call upon the database in question. I decided to implement this check in the form of an event handler attached to GUI objects that would trigger this data inquiry. This check event handler is called first upon necessary events, and my question is: How do I stop subsequent event handlers from firing if the FIRST event handler (my flag checker) comes up FALSE? Thanks

  Read the article

• Facing problem in configuring Reporting Server

  - by idrees99

  Hi all, I am using Sql server 2005 express edition and i want to Install and configure Reporting server on my local machine.Now i have installed the reporting server but the issue is that i am unable to configure it properly.when ever i go to start the reporting services it gives me the following message: THE SQL SERVER REPORTING SERVICE(SQLEXPRESS)service on Local computer started and then stopped. Some services stop automatically if they have no work to do, for example, the performance Logs and Alerts service. I am using WindowsXp Professional. plz help me out as i have just started using sql server and i dont have any idea.

  Read the article

• Artificial Intelligence - What to put in, or leave out, and what can be inferred?

  - by D Scott

  I was having a discussion with a coworker (while we were programming) about AI. We were talking about emotions/feelings and if you should choose to leave any out. I asked him, "Would you leave out racism or hate?" and if you did leave those out, what, if any, other emotions might lead to the AI learning the left out emotions or feelings. Should you PROGRAM in measures to stop the AI from learning those feelings? If you teach Love, does it need to know hurt? Or would it learn hurt? If it then knew Hurt would it connect it with Dislike, Hurt and Dislike could that then lead to some other non-programmed emotion? Such as hate? All while tele-commuting from home.

  Read the article

• Is It possible to change dynamically delay on a Scheduled Poller in Camel via JMX?

  - by sebbrousse

  I would like to set/change the delay of a File consumer at runtime through JMX. I am able to change the value of the property but it doesn't seem to be taken into account until I restart the consumer. Example with the camel-archetype-java and its basic file example: Run It Change the delay of the File Consumer by calling the setDelay Operation with the JConsole Delay property of the Consumer is changed but logs show it continues to poll at 500ms by default Stop/Start the consumer New value of delay is used by the consumer Do I need anothers steps or active any configuration to make it work at runtime?

  Read the article

• Identify machine (relatively) uniquely using unc path

  - by Gareth

  Using C#, and given that the user enters in a unc path. Is there a way to verify that 2 months down the line, when I'm writing a file to the unc path, that it is the same machine as when he entered it? i.e. I'm writing some sensitive information to the path, and want to stop someone from putting another machine on the network with the same name / share etc and grabbing the output. Or if the software is running on a laptop and the user plugs it into another network, and there just happens to be a machine with the same name / share... Any ideas, other than using the IP address (and verifying that its the same?). I don't necessarily have any rights on the remote machine other than write access to the unc share. Yes, I'm probably being paranoid, but would like to know if anything is possible...

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Flash Builder 'building' html files...

  - by Frank

  I'm using Flash Builder 3 to edit my Flex app, but I noticed that every time I make a change on the .html files (index.template.html for example), even if it's not in the IDE but with another program, Flash Builder rebuilds the whole project. Is there anyway to stop this? Why would it need to rebuild the workspace everytime a html file changes? If it was too long it wouldn't bother me, but it takes a lot of time (more than 1 minute) every time. For your information the html file is 95 lines of 'code'. Thanks

  Read the article

• SQL: Interrupting a query

  - by NoozNooz42

  I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

  Read the article

• working with files on "start without debugging"

  - by user1472066

  I'm programming in C, and I have the following problem: I use fopen and try to read from a csv file, that is currently storred in the folder of the exe file of the program. the program works fine in debug mode and release mode, but when I try to run the program in "start without debugging" on visual studio 2008 express edition, the program stops working and windows is showing a message: "*.exe has stopped working. a program caused the program to stop working correctly. windows will close the program and notify you if a solution is available". I've tried running the program on several computers, and it's the same. another information I can give you is that if I enter the full path of the file (C:....file.csv) - then is works just fine, without any problem. I know I didn't write any code, but I hope someone will have an idea why this can happend. thanks is advance.

  Read the article

• Using php to create a password system with chinese characters

  - by WillDonohoe

  Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

  Read the article

• how to deal with async calls in Ajax 4.0(using jquery?)

  - by dexter

  in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

  Read the article

• Basic iphone timer example

  - by Rob

  Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

  Read the article

< Previous Page | 228 229 230 231 232 233 234 235 236 237 238 239  | Next Page >