Search Results

Search found 6326 results on 254 pages for 'continuous operation'.

Page 235/254 | < Previous Page | 231 232 233 234 235 236 237 238 239 240 241 242  | Next Page >

  • VB6 ADO Command to SQL Server

    - by Emtucifor
    I'm getting an inexplicable error with an ADO command in VB6 run against a SQL Server 2005 database. Here's some code to demonstrate the problem: Sub ADOCommand() Dim Conn As ADODB.Connection Dim Rs As ADODB.Recordset Dim Cmd As ADODB.Command Dim ErrorAlertID As Long Dim ErrorTime As Date Set Conn = New ADODB.Connection Conn.ConnectionString = "Provider=SQLOLEDB.1;Integrated Security=SSPI;Initial Catalog=database;Data Source=server" Conn.CursorLocation = adUseClient Conn.Open Set Rs = New ADODB.Recordset Rs.CursorType = adOpenStatic Rs.LockType = adLockReadOnly Set Cmd = New ADODB.Command With Cmd .Prepared = False .CommandText = "ErrorAlertCollect" .CommandType = adCmdStoredProc .NamedParameters = True .Parameters.Append .CreateParameter("@ErrorAlertID", adInteger, adParamOutput) .Parameters.Append .CreateParameter("@CreateTime", adDate, adParamOutput) Set .ActiveConnection = Conn Rs.Open Cmd ErrorAlertID = .Parameters("@ErrorAlertID").Value ErrorTime = .Parameters("@CreateTime").Value End With Debug.Print Rs.State ' Shows 0 - Closed Debug.Print Rs.RecordCount ' Of course this fails since the recordset is closed End Sub So this code was working not too long ago but now it's failing on the last line with the error: Run-time error '3704': Operation is not allowed when the object is closed Why is it closed? I just opened it and the SP returns rows. I ran a trace and this is what the ADO library is actually submitting to the server: declare @p1 int set @p1=1 declare @p2 datetime set @p2=''2010-04-22 15:31:07:770'' exec ErrorAlertCollect @ErrorAlertID=@p1 output,@CreateTime=@p2 output select @p1, @p2 Running this as a separate batch from my query editor yields: Msg 102, Level 15, State 1, Line 4 Incorrect syntax near '2010'. Of course there's an error. Look at the double single quotes in there. What the heck could be causing that? I tried using adDBDate and adDBTime as data types for the date parameter, and they give the same results. When I make the parameters adParamInputOutput, then I get this: declare @p1 int set @p1=default declare @p2 datetime set @p2=default exec ErrorAlertCollect @ErrorAlertID=@p1 output,@CreateTime=@p2 output select @p1, @p2 Running that as a separate batch yields: Msg 156, Level 15, State 1, Line 2 Incorrect syntax near the keyword 'default'. Msg 156, Level 15, State 1, Line 4 Incorrect syntax near the keyword 'default'. What the heck? SQL Server doesn't support this kind of syntax. You can only use the DEFAULT keyword in the actual SP execution statement. I should note that removing the extra single quotes from the above statement makes the SP run fine. ... Oh my. I just figured it out. I guess it's worth posting anyway.

    Read the article

  • sending email in .NET

    - by VP
    I am getting the following error when I try to send an email in my C# program. I am using Visual Studio 2008 on windows 7. I would paste my code first and then the error: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO; using System.Net; using System.Net.Mail; using System.Net.Mime; using System.Net.Sockets; using System.Web; class email_log_files { private string login_username = "my_gmail_id"; private string login_password = "my_gmail_password"; public void send_email() { string src_address = "[email protected]"; string dest_address = "[email protected]"; try { MailMessage email_msg = new MailMessage(); SmtpClient email_client = new SmtpClient(); email_msg.From = new MailAddress(src_address); email_msg.Sender = new MailAddress(src_address); email_msg.ReplyTo = new MailAddress(src_address); email_msg.To.Add(dest_address); email_msg.Subject = "Test"; email_msg.Body = "Body of the message"; NetworkCredential credentials = new NetworkCredential(login_username, login_password); email_client.Credentials = credentials; email_client.Host = "smtp.gmail.com"; email_client.Port = 465; email_client.EnableSsl = true; email_client.Send(email_msg); Console.WriteLine("Message Sent Successfully!!"); Console.ReadLine(); } catch (Exception ex) { Console.WriteLine(ex.Message.ToString()); Console.WriteLine(ex.InnerException); Console.WriteLine(ex.Source); Console.WriteLine(ex.Data); Console.ReadLine(); } } } And the error message is as follows: The operation has timed out. System System.Collections.ListDictionaryInternal Why is it always timing out? I am sure that I have the correct smtp server address and port number for gmail as I have configured my outlook with the same. Any help or ideas?

    Read the article

  • CakePHP: How can I change this find call to include all records that do not exist in the associated

    - by Stephen
    I have a few tables with the following relationships: Company hasMany Jobs, Employees, and Trucks, Users I've got all my foreign keys set up properly, along with the tables' Models, Controllers, and Views. Originally, the Jobs table had a boolean field called "assigned". The following find operation (from the JobsController) successfully returns all employees, all trucks, and any jobs that are not assigned and fall on a certain day for a single company (without returning users by utilizing the containable behavior): $this->set('resources', $this->Job->Company->find('first', array( 'conditions' => array( 'Company.id' => $company_id ), 'contain' => array( 'Employee', 'Truck', 'Job' => array( 'conditions' => array( 'Job.assigned' => false, 'Job.pickup_date' => date('Y-m-d', strtotime('Today')); ) ) ) ))); Now, since writing this code, I decided to do a lot more with the job assignments. So I've created a new model "Assignment" that belongsTo Truck and belongsTo Job. I've added the hasMany Assignments to both the Truck model and the Jobs Model. I have both foreign keys in the assignments table, along with some other assignment fields. Now, I'm trying to get the same information above, only instead of checking the assigned field from the job table, I want to check the assignments table to ensure that the job does not exist there. I can no longer use the containable behavior if I'm going to use the "joins" feature of the find method due to mysql errors (according to the cookbook). But, the following query returns all jobs, even if they fall on different days. $this->set('resources', $this->Job->Company->find('first', array( 'joins' => array( array( 'table' => 'employees', 'alias' => 'Employee', 'type' => 'LEFT', 'conditions' => array( 'Company.id = Employee.company_id' ) ), array( 'table' => 'trucks', 'alias' => 'Truck', 'type' => 'LEFT', 'conditions' => array( 'Company.id = Truck.company_id' ) ), array( 'table' => 'jobs', 'alias' => 'Job', 'type' => 'LEFT', 'conditions' => array( 'Company.id = Job.company_id' ) ), array( 'table' => 'assignments', 'alias' => 'Assignment', 'type' => 'LEFT', 'conditions' => array( 'Job.id = Assignment.job_id' ) ) ), 'conditions' => array( 'Job.pickup_date' => $day, 'Company.id' => $company_id, 'Assignment.job_id IS NULL' ) )));

    Read the article

  • C++ Virtual Constructor, without clone()

    - by Julien L.
    I want to perform "deep copies" of an STL container of pointers to polymorphic classes. I know about the Prototype design pattern, implemented by means of the Virtual Ctor Idiom, as explained in the C++ FAQ Lite, Item 20.8. It is simple and straightforward: struct ABC // Abstract Base Class { virtual ~ABC() {} virtual ABC * clone() = 0; }; struct D1 : public ABC { virtual D1 * clone() { return new D1( *this ); } // Covariant Return Type }; A deep copy is then: for( i = 0; i < oldVector.size(); ++i ) newVector.push_back( oldVector[i]->clone() ); Drawbacks As Andrei Alexandrescu states it: The clone() implementation must follow the same pattern in all derived classes; in spite of its repetitive structure, there is no reasonable way to automate defining the clone() member function (beyond macros, that is). Moreover, clients of ABC can possibly do something bad. (I mean, nothing prevents clients to do something bad, so, it will happen.) Better design? My question is: is there another way to make an abstract base class clonable without requiring derived classes to write clone-related code? (Helper class? Templates?) Following is my context. Hopefully, it will help understanding my question. I am designing a class hierarchy to perform operations on a class Image: struct ImgOp { virtual ~ImgOp() {} bool run( Image & ) = 0; }; Image operations are user-defined: clients of the class hierarchy will implement their own classes derived from ImgOp: struct CheckImageSize : public ImgOp { std::size_t w, h; bool run( Image &i ) { return w==i.width() && h==i.height(); } }; struct CheckImageResolution; struct RotateImage; ... Multiple operations can be performed sequentially on an image: bool do_operations( std::vector< ImgOp* > v, Image &i ) { std::for_each( v.begin(), v.end(), /* bind2nd(mem_fun(&ImgOp::run), i ...) don't remember syntax */ ); } int main( ... ) { std::vector< ImgOp* > v; v.push_back( new CheckImageSize ); v.push_back( new CheckImageResolution ); v.push_back( new RotateImage ); Image i; do_operations( v, i ); } If there are multiple images, the set can be split and shared over several threads. To ensure "thread-safety", each thread must have its own copy of all operation objects contained in v -- v becomes a prototype to be deep copied in each thread.

    Read the article

  • Problem in databinding a dictionary in ListView combo-box column.

    - by Ashish Ashu
    I have a listview of which itemsource is set to my custom collection, let's say MyCollection. The code below is not full code , it's just a code snippets to explain the problem. class Item : INotifyPropertyChanged { Options _options; public Options OptionProp { get { return _options; } set { _options = value; OnPropertyChanged ("OptionProp");} } string _Name; public string NameProp { get { return _Name; } set { _Name = value; OnPropertyChanged ("NameProp");} } } class Options : Dictionary<string,string> { public Options() { this.Clear(); this.Add("One" , "1" ); this.Add("Two" , "2" ); this.Add("Three" , "3" ); } } MyCollection in my viewModel class viewModel { ObservableCollection<Item> **MyCollection**; KeyValuePair<sting,string> **SelectedOption**; } The listview Item Source is set to my MyCollection. <ListView ItemSource = MyCollectoin> I Listview contains two columns of which I have defined a datatemplats in the listview. First column is a combo-box of which Itemsource is set to Options ( defined above ) Second column is a simple textblock to display Name. Problem 1. I have defined a datatemplate for first column in which I have a combo box , I have set the Itemsource =**MyCollection** and SelectedItem = SelectedOption of the combo-box. User can perform following operations in the listview: Add ( Add the row in the listview ) Move Up ( Move row up in the listview ) Move Down ( Move down the item in the listview ) .Now when I add the row in the listview , the combo-box selected index is always comes to -1 (first column). However the combo box contains options One, Two and Three. Also, I have initialized the SelectedOption to contain the first item, i:e One. problem 2. . Let suppose, I have added a single row in a listview and I have selected Option "one" in the combo box manually. Now when I perform Move Up or Move Down operations the selected index of a combo box is again set to -1. In the Move Up or Move Down operation , I am calling MoveUp and MoveDown methods of the Observable collection. Probelm 3 How to serialize the entire collection in XML. Since I can't serialize the Dictionary and KeyValue Pair. I have to restore the state of the listview.

    Read the article

  • Problem while adding a new value to a hashtable when it is enumerated

    - by karthik
    `hi I am doing a simple synchronous socket programming,in which i employed twothreads one for accepting the client and put the socket object into a collection,other thread will loop through the collection and send message to each client through the socket object. the problem is 1.i connect to clients to the server and start send messages 2.now i want to connect a new client,while doing this i cant update the collection and add a new client to my hashtable.it raises an exception "collection modified .Enumeration operation may not execute" how to add a NEW value without having problems in a hashtable. private void Listen() { try { //lblStatus.Text = "Server Started Listening"; while (true) { Socket ReceiveSock = ServerSock.Accept(); //keys.Clear(); ConnectedClients = new ListViewItem(); ConnectedClients.Text = ReceiveSock.RemoteEndPoint.ToString(); ConnectedClients.SubItems.Add("Connected"); ConnectedList.Items.Add(ConnectedClients); ClientTable.Add(ReceiveSock.RemoteEndPoint.ToString(), ReceiveSock); //foreach (System.Collections.DictionaryEntry de in ClientTable) //{ // keys.Add(de.Key.ToString()); //} //ClientTab.Add( //keys.Add( } //lblStatus.Text = "Client Connected Successfully."; } catch (Exception ex) { MessageBox.Show(ex.Message); } } private void btn_receive_Click(object sender, EventArgs e) { Thread receiveThread = new Thread(new ThreadStart(Receive)); receiveThread.IsBackground = true; receiveThread.Start(); } private void Receive() { while (true) { //lblMsg.Text = ""; byte[] Byt = new byte[2048]; //ReceiveSock.Receive(Byt); lblMsg.Text = Encoding.ASCII.GetString(Byt); } } private void btn_Send_Click(object sender, EventArgs e) { Thread SendThread = new Thread(new ThreadStart(SendMsg)); SendThread.IsBackground = true; SendThread.Start(); } private void btnlist_Click(object sender, EventArgs e) { //Thread ListThread = new Thread(new ThreadStart(Configure)); //ListThread.IsBackground = true; //ListThread.Start(); } private void SendMsg() { while (true) { try { foreach (object SockObj in ClientTable.Keys) { byte[] Tosend = new byte[2048]; Socket s = (Socket)ClientTable[SockObj]; Tosend = Encoding.ASCII.GetBytes("FirstValue&" + GenerateRandom.Next(6, 10).ToString()); s.Send(Tosend); //ReceiveSock.Send(Tosend); Thread.Sleep(300); } } catch (Exception ex) { MessageBox.Show(ex.Message); } } }

    Read the article

  • How to parse an XML string in TDI

    - by ongle
    I am new to TDI. I have a TDI assembly line that calls a web service (ibmdi.InvokeSoapWS) which returns the result as a string in the work attribute 'xmlString'. I then have an AttributeMap that attempts to parse the xml and extract a value (the node it seeks is a few nodes deep). var parser = system.getParser('ibmdi.SOAP'); var xmlString = work.getString('xmlString'); var entity = parser.parseRequest(xmlString); task.dump(entity); The trouble is, the parsed object does not contain an accurate representation of the XML. It contains only two attributes, the first is correctly the first node following the soap body (e.g., ns0:SomeNodeReply), the second being a node inside the first (e.g., ns0:DetailCount). And as far as I can determine, both attributes are just strings so I cannot recurse into the object graph. Below is a sample soap reply: <?xml version="1.0" encoding="utf-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/"> <SOAP-ENV:Body> <ns0:SomeNodeReply xmlns:ns0="http://xmlns.example.com/unique/default/namespace/1136581686664"> <ns0:Status> <ns0:StatusCD>000</ns0:StatusCD> <ns0:StatusDesc /> </ns0:Status> <ns0:DetailCount>1</ns0:DetailCount> <ns0:SomeDetail> <ns0:CodeA>Foo</ns0:CodeA> <ns0:CodeB>Bar</ns0:CodeB> </ns0:SomeDetail> </ns0:SomeNodeReply> </SOAP-ENV:Body> </SOAP-ENV:Envelope> And below is a sample dump of the parsed string: 19:03:23 CTGDIS003I *** Start dumping Entry 19:03:23 Operation: generic 19:03:23 Entry attributes: 19:03:23 SOAP_CALL (replace): 'ns0:SomeNodeReply' 19:03:23 ns0:DetailCount(replace): '1' 19:03:23 CTGDIS004I *** Finished dumping Entry All I really need to do is be able to parse out a value that may or may not be there, depending on the value of another node (e.g., DetailCount == 1, get CodeA otherwise return empty string). I am open to changing anything about how this works if I can extract the data into the work Entry.

    Read the article

  • Setting up a "to-many" relationship value dependency for a transient Core Data attribute

    - by Greg Combs
    I've got a relatively complicated Core Data relationship structure and I'm trying to figure out how to set up value dependencies (or observations) across various to-many relationships. Let me start out with some basic info. I've got a classroom with students, assignments, and grades (students X assignments). For simplicity's sake, we don't really have to focus much on the assignments yet. StudentObj <--->> ScoreObj <<---> AssignmentObj Each ScoreObj has a to-one relation with the StudentObj and the AssignmentObj. ScoreObj has real attributes for the numerical grade, the turnInDate, and notes. AssignmentObj.scores is the set of Score objects for that assignment (N = all students). AssignmentObj has real attributes for name, dueDate, curveFunction, gradeWeight, and maxPoints. StudentObj.scores is the set of Score objects for that student (N = all assignments). StudentObj also has real attributes like name, studentID, email, etc. StudentObj has a transient (calculated, not stored) attribute called gradeTotal. This last item, gradeTotal, is the real pickle. it calculates the student's overall semester grade using the scores (ScoreObj) from all their assignments, their associated assignment gradeWeights, curves, and maxPoints, and various other things. This gradeTotal value is displayed in a table column, along with all the students and their individual assignment grades. Determining the value of gradeTotal is a relatively expensive operation, particularly with a large class, therefore I want to run it only when necessary. For simplicity's sake, I'm not storing that gradeTotal value in the core data model. I don't mind caching it somewhere, but I'm having a bitch of a time determining where and how to best update that cache. I need to run that calculation for each student whenever any value changes that affects their gradeTotal. If this were a simple to-one relationship, I know I could use something like keyPathsForValuesAffectingGradeTotal ... but it's more like a many-to-one-to-many relationship. Does anyone know of an elegant (and KVC correct) solution? I guess I could tear through all those score and assignment objects and tell them to register their students as observers. But this seems like a blunt force approach.

    Read the article

  • How to replace all id attributes of a child collection of complex types using jQuery in ASP.net MVC

    - by TJB
    Here's my situation: I'm writing an ASP.net MVC 1 website and I have a create/edit form that uses the default model binding to parse the form into a strongly typed complex object. The object I'm posting has a child collection of another complex type and the way I format my id's for the model binder is as follows: <div class="childContainer" > <!-- There's one of these for each property for each child collection item --> <%= Html.TextBox("ChildCollectionName[0].ChildPropertyName", /* blah blah */ ) %> <%= Html.TextBox("ChildCollectionName[0].OtherChildPropertyName", /* blah blah */ ) %> <!-- ... --> </div> This gets rendered as <div class="childContainer" > <input id="ChildCollectionName[0]_ChildPropertyName" ... /> <input id="ChildCollectionName[0]_OtherChildPropertyName" ... /> ... </div> <div class="childContainer" > <input id="ChildCollectionName[1]_ChildPropertyName" ... /> <input id="ChildCollectionName[1]_OtherChildPropertyName" ... /> ... </div> For each entry in the chlid collection. This collection is dynamically created in the form using jQuery, so entries can be added, removed etc. and whenever there's an operation on the collection I need to update the indexes so that it's bound correctly on the server side. What's the best way to replace all the html input id's when I'm updating the index within the child e.g. replace all [*] -- [N] where N is the correct index. using jQuery / JavaScript ? I have something coded now, but its buggy and I think there is a simpler solution. Also, if you have an easier way to identify the child collection I'll take any advice on that as well. Thanx!

    Read the article

  • Missing parameter error after running MySql query

    - by annelie
    Hello, I'm completely new to MySql and haven't used SqlDataSource with UpdateParameters before, so I'm probably missing something very obvious. When trying to update a record, the update does happen but then throws an error saying "'id' parameter is missing at the statement". So the query works and the database gets updated as it should, but an error is thrown afterwards. These are the update parameters: <UpdateParameters> <asp:Parameter Name="business_name" Type="string" Size="256" /> <asp:Parameter Name="addr_line_1" Type="string" Size="256" /> <asp:Parameter Name="addr_line_2" Type="string" Size="256" /> <asp:Parameter Name="addr_line_3" Type="string" Size="256" /> <asp:Parameter Name="postcode" Type="string" Size="32" /> <asp:Parameter Name="county" Type="string" Size="128" /> <asp:Parameter Name="town_city" Type="string" Size="256" /> <asp:Parameter Name="tl_url" Type="string" Size="256" /> <asp:Parameter Name="customer_id" Type="string" Size="16" /> <asp:Parameter Name="region_id" Type="Int16" /> <asp:Parameter Name="description" Type="string" Size="1024" /> <asp:Parameter Name="approval_status" Type="string" Size="1" /> <asp:Parameter Name="tl_user_name" Type="string" Size="256" /> <asp:Parameter Name="phone" Type="string" Size="50" /> <asp:Parameter Name="uploaders_own" Type="Int16" /> </UpdateParameters> Here's the update statement: UPDATE myTable SET business_name = ?, addr_line_1 = ?, addr_line_2 = ?, addr_line_3 = ?, postcode = ?, county = ?, town_city = ?, tl_url = ?, customer_id = ?, region_id = ?, description = ?, approval_status = ?, tl_user_name = ?, phone = ?, uploaders_own = ? WHERE id = " + id Here's the stack trace: [InvalidOperationException: 'id' parameter is missing at the statement] CoreLab.MySql.r.a() +775 CoreLab.MySql.r.a(Int32& A_0, ArrayList& A_1) +448 CoreLab.MySql.x.e() +398 CoreLab.MySql.x.o() +89 CoreLab.MySql.MySqlCommand.a(CommandBehavior A_0, IDisposable A_1, Int32 A_2, Int32 A_3) +1306 CoreLab.Common.DbCommandBase.ExecuteDbDataReader(CommandBehavior behavior) +310 System.Data.Common.DbCommand.ExecuteReader() +12 CoreLab.Common.DbCommandBase.ExecuteNonQuery() +64 System.Web.UI.WebControls.SqlDataSourceView.ExecuteDbCommand(DbCommand command, DataSourceOperation operation) +386 System.Web.UI.WebControls.SqlDataSourceView.ExecuteUpdate(IDictionary keys, IDictionary values, IDictionary oldValues) +325 System.Web.UI.DataSourceView.Update(IDictionary keys, IDictionary values, IDictionary oldValues, DataSourceViewOperationCallback callback) +92 System.Web.UI.WebControls.DetailsView.HandleUpdate(String commandArg, Boolean causesValidation) +837 System.Web.UI.WebControls.DetailsView.HandleEvent(EventArgs e, Boolean causesValidation, String validationGroup) +509 System.Web.UI.WebControls.DetailsView.OnBubbleEvent(Object source, EventArgs e) +95 System.Web.UI.Control.RaiseBubbleEvent(Object source, EventArgs args) +37 System.Web.UI.WebControls.DetailsViewRow.OnBubbleEvent(Object source, EventArgs e) +113 System.Web.UI.Control.RaiseBubbleEvent(Object source, EventArgs args) +37 System.Web.UI.WebControls.LinkButton.OnCommand(CommandEventArgs e) +118 System.Web.UI.WebControls.LinkButton.RaisePostBackEvent(String eventArgument) +135 System.Web.UI.WebControls.LinkButton.System.Web.UI.IPostBackEventHandler.RaisePostBackEvent(String eventArgument) +10 System.Web.UI.Page.RaisePostBackEvent(IPostBackEventHandler sourceControl, String eventArgument) +13 System.Web.UI.Page.RaisePostBackEvent(NameValueCollection postData) +175 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1565 Does anyone know what I'm doing wrong? Thanks, Annelie

    Read the article

  • Parallel programming in C#

    - by Alxandr
    I'm interested in learning about parallel programming in C#.NET (not like everything there is to know, but the basics and maybe some good-practices), therefore I've decided to reprogram an old program of mine which is called ImageSyncer. ImageSyncer is a really simple program, all it does is to scan trough a folder and find all files ending with .jpg, then it calculates the new position of the files based on the date they were taken (parsing of xif-data, or whatever it's called). After a location has been generated the program checks for any existing files at that location, and if one exist it looks at the last write-time of both the file to copy, and the file "in its way". If those are equal the file is skipped. If not a md5 checksum of both files is created and matched. If there is no match the file to be copied is given a new location to be copied to (for instance, if it was to be copied to "C:\test.jpg" it's copied to "C:\test(1).jpg" instead). The result of this operation is populated into a queue of a struct-type that contains two strings, the original file and the position to copy it to. Then that queue is iterated over untill it is empty and the files are copied. In other words there are 4 operations: 1. Scan directory for jpegs 2. Parse files for xif and generate copy-location 3. Check for file existence and if needed generate new path 4. Copy files And so I want to rewrite this program to make it paralell and be able to perform several of the operations at the same time, and I was wondering what the best way to achieve that would be. I've came up with two different models I can think of, but neither one of them might be any good at all. The first one is to parallelize the 4 steps of the old program, so that when step one is to be executed it's done on several threads, and when the entire of step 1 is finished step 2 is began. The other one (which I find more interesting because I have no idea of how to do that) is to create a sort of worker and consumer model, so when a thread is finished with step 1 another one takes over and performs step 2 at that object (or something like that). But as said, I don't know if any of these are any good solutions. Also, I don't know much about parallel programming at all. I know how to make a thread, and how to make it perform a function taking in an object as its only parameter, and I've also used the BackgroundWorker-class on one occasion, but I'm not that familiar with any of them. Any input would be appreciated.

    Read the article

  • Using drawAtPoint with my CIImage not doing anything on screen

    - by Adam
    Stuck again. :( I have the following code crammed into a procedure invoked when I click on a button on my application main window. I'm just trying to tweak a CIIMage and then display the results. At this point I'm not even worried about exactly where / how to display it. I'm just trying to slam it up on the window to make sure my Transform worked. This code seems to work down through the drawAtPoint message. But I never see anything on the screen. What's wrong? Thanks. Also, as far as displaying it in a particular location on the window ... is the best technique to put a frame of some sort on the window, then get the coordinates of that frame and "draw into" that rectangle? Or use a specific control from IB? Or what? Thanks again. // earlier I initialize a NSImage from JPG file on disk. // then create NSBitmapImageRep from the NSImage. This all works fine. // then ... CIImage * inputCIimage = [[CIImage alloc] initWithBitmapImageRep:inputBitmap]; if (inputCIimage == Nil) NSLog(@"could not create CI Image"); else { NSLog (@"CI Image created. working on transform"); CIFilter *transform = [CIFilter filterWithName:@"CIAffineTransform"]; [transform setDefaults]; [transform setValue:inputCIimage forKey:@"inputImage"]; NSAffineTransform *affineTransform = [NSAffineTransform transform]; [affineTransform rotateByDegrees:3]; [transform setValue:affineTransform forKey:@"inputTransform"]; CIImage * myResult = [transform valueForKey:@"outputImage"]; if (myResult == Nil) NSLog(@"Transformation failed"); else { NSLog(@"Created transformation successfully ... now render it"); [myResult drawAtPoint: NSMakePoint ( 0,0 ) fromRect: NSMakeRect ( 0,0,128,128 ) operation: NSCompositeSourceOver fraction: 1.0]; //100% opaque [inputCIimage release]; } }

    Read the article

  • Memory issues - Living vs. overall -> app is killed

    - by D33
    I'm trying to check my applications memory issues in Instruments. When I load the application I play some sounds and show some animations in UIImageViews. To save some memory I load the sounds only when I need it and when I stop playing it I free it from the memory. problem 1: My application is using about 5.5MB of Living memory. BUT The Overall section is growing after start to 20MB and then it's slowly growing (about 100kB/sec). But responsible Library is OpenAL (OAL::Buffer), dyld (_dyld_start)-I am not sure what this really is, and some other stuff like ft_mem_qrealloc, CGFontStrikeSetValue, … problem 2: When the overall section breaks about 30MB, application crashes (is killed). According to the facts I already read about overall memory, it means then my all allocations and deallocation is about 30MB. But I don't really see the problem. When I need some sound for example I load it to the memory and when I don't need it anymore I release it. But that means when I load 1MB sound, this operation increase overall memory usage with 2MB. Am I right? And when I load 10 sounds my app crashes just because the fact my overall is too high even living is still low??? I am very confused about it. Could someone please help me clear it up? (I am on iOS 5 and using ARC) SOME CODE: creating the sound OpenAL: MYOpenALSound *sound = [[MyOpenALSound alloc] initWithSoundFile:filename willRepeat:NO]; if(!sound) return; [soundDictionary addObject:sound]; playing: [sound play]; dispatch_after(dispatch_time(DISPATCH_TIME_NOW, ((sound.duration * sound.pitch) + 0.1) * NSEC_PER_SEC), dispatch_get_current_queue(), ^{ [soundDictionary removeObjectForKey:[NSNumber numberWithInt:soundID]]; }); } creating the sound with AVAudioPlayer: [musics replaceObjectAtIndex:ID_MUSIC_MAP withObject:[[Music alloc] initWithFilename:@"mapMusic.mp3" andWillRepeat:YES]]; pom = [musics objectAtIndex:musicID]; [pom playMusic]; and stop and free it: [musics replaceObjectAtIndex:ID_MUSIC_MAP withObject:[NSNull null]]; AND IMAGE ANIMATIONS: I load images from big PNG file (this is realated also to my other topic : Memory warning - UIImageView and its animations) I have few UIImageViews and by time I'm setting animation arrays to play Animations... UIImage *source = [[UIImage alloc] initWithCGImage:[[UIImage imageNamed:@"imageSource.png"] CGImage]]; cutRect = CGRectMake(0*dimForImg.width,1*dimForImg.height,dimForImg.width,dimForImg.height); image1 = [[UIImage alloc] initWithCGImage:CGImageCreateWithImageInRect([source CGImage], cutRect)]; cutRect = CGRectMake(1*dimForImg.width,1*dimForImg.height,dimForImg.width,dimForImg.height); ... image12 = [[UIImage alloc] initWithCGImage:CGImageCreateWithImageInRect([source CGImage], cutRect)]; NSArray *images = [[NSArray alloc] initWithObjects:image1, image2, image3, image4, image5, image6, image7, image8, image9, image10, image11, image12, image12, image12, nil]; and this array I just use simply like : myUIImageView.animationImages = images, ... duration -> startAnimating

    Read the article

  • Java Best Practice for type resolution at runtime.

    - by Brian
    I'm trying to define a class (or set of classes which implement the same interface) that will behave as a loosely typed object (like JavaScript). They can hold any sort of data and operations on them depend on the underlying type. I have it working in three different ways but none seem ideal. These test versions only allow strings and integers and the only operation is add. Adding integers results in the sum of the integer values, adding strings concatenates the strings and adding an integer to a string converts the integer to a string and concatenates it with the string. The final version will have more types (Doubles, Arrays, JavaScript-like objects where new properties can be added dynamically) and more operations. Way 1: public interface DynObject1 { @Override public String toString(); public DynObject1 add(DynObject1 d); public DynObject1 addTo(DynInteger1 d); public DynObject1 addTo(DynString1 d); } public class DynInteger1 implements DynObject1 { private int value; public DynInteger1(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject1 add(DynObject1 d) { return d.addTo(this); } public DynObject1 addTo(DynInteger1 d) { return new DynInteger1(d.value + value); } public DynObject1 addTo(DynString1 d) { return new DynString1(d.toString()+Integer.toString(value)); } } ...and similar for DynString1 Way 2: public interface DynObject2 { @Override public String toString(); public DynObject2 add(DynObject2 d); } public class DynInteger2 implements DynObject2 { private int value; public DynInteger2(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject2 add(DynObject2 d) { Class c = d.getClass(); if(c==DynInteger2.class) { return new DynInteger2(value + ((DynInteger2)d).value); } else { return new DynString2(toString() + d.toString()); } } } ...and similar for DynString2 Way 3: public class DynObject3 { private enum ObjectType { Integer, String }; Object value; ObjectType type; public DynObject3(Integer v) { value = v; type = ObjectType.Integer; } public DynObject3(String v) { value = v; type = ObjectType.String; } @Override public String toString() { return value.toString(); } public DynObject3 add(DynObject3 d) { if(type==ObjectType.Integer && d.type==ObjectType.Integer) { return new DynObject3(Integer.valueOf(((Integer)value).intValue()+((Integer)value).intValue())); } else { return new DynObject3(value.toString()+d.value.toString()); } } } With the if-else logic I could use value.getClass()==Integer.class instead of storing the type but with more types I'd change this to use a switch statement and Java doesn't allow switch to use Classes. Anyway... My question is what is the best way to go about something thike this?

    Read the article

  • Resize AIR app window while dragging

    - by matt lohkamp
    So I've noticed Windows 7 has a disturbing tendency to prevent you from dragging the title bar of windows off the top of the screen. If you try - in this case, using an air app with a draggable area at the bottom of the window, allowing you to push the top of the window up past the screen - it just kicks the window back down far enough that the title bar is at the top of what it considers the 'visible area.' One solution would be to resize the app window as it moves, so that the title bar is always where windows wants it. How would you resize the window while you're dragging it, though? Would you do it like this? dragHitArea.addEventListener(MouseEvent.MOUSE_DOWN, function(e:MouseEvent):void{ stage.nativeWindow.height += 50; stage.nativeWindow.startMove(); stage.nativeWindow.height -= 50; }); see what's going on there? When I click, I'm doing startMove(), which is hooking into the OS' function for dragging a window around. I'm also increasing and decreasing the height of the window by 50 pixels - which should give me no net increase, right? Wrong - the first '.height +=' gets executed, but the '.height -=' after the .startMove() never runs. Why? update - If you're curious, I'm programming an air widget with fly-out menus which expand rightwards and upwards - and since those element can only be displayed within the boundaries of the application window itself (even though the window is set to be chromeless and transparent) I have to expand the application's borders to include the area that the menu 'pops up' into. In the extreme case, with the widget positioned bottom left, and the menus expanded completely across to the right side and top edge of the screen, the application area could very well cover the entire desktop. The problem is, when it's expanded like this, if the user drags it up and to the right, it causes the 'title bar' area of the application window to move above the top edge of the desktop area, where it would normally be unreachable; and Windows automatically re-positions the window back below that edge once the .startMove() operation is completed. So what I want to do is continually resize the height of the application so that the visual effect will be the same for the user, but for the benefit of the operating system the window's title bar will never be above that top boundary of the desktop area.

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Problem in suspending 2 threads at the same time in MFC!

    - by kiddo
    I am learning about threading and multithreading..so i just created a small application in which i will update the progressbar and a static text using threading.I vl get two inputs from the user, start and end values for how long the loop should rotate.I have 2threads in my application. Thread1- to update the progressbar(according to the loop) the static text which will show the count(loop count). Thread2 - to update the another static text which will just diplay a name Basically if the user clicks start, the progressbar steps up and at the same time filecount and the name are displayed parallely. There's is another operation where if the user clicks pause it(thread) has to suspend until the user clicks resume. The problem is,the above will not work(will not suspend and resume) for both thread..but works for a singlw thread. Please check the code to get an idea and reply me what can done! on button click start void CThreadingEx3Dlg::OnBnClickedStart() { m_ProgressBar.SetRange(start,end); myThread1 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction1,this); myThread2 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction2,this); } thread1 UINT MyThreadFunction1(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int intvalue =pthis->start;intvalue<=pthis->end; ++intvalue) { pthis->SendMessage(WM_MY_THREAD_MESSAGE1,intvalue); } return 0; } thread1 function LRESULT CThreadingEx3Dlg::OnThreadMessage1(WPARAM wparam,LPARAM lparam) { int nProgress= (int)wparam; m_ProgressBar.SetPos(nProgress); CString strStatus; strStatus.Format(L"Thread1:Processing item: %d", nProgress); m_Static.SetWindowText(strStatus); Sleep(100); return 0; } thread2 UINT MyThreadFunction2(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int i =pthis->start;i<=pthis->end;i++) { pthis->SendMessage(WM_MY_THREAD_MESSAGE2,i); } return 0; } thread2 function LRESULT CThreadingEx3Dlg::OnThreadMessage2(WPARAM wparam,LPARAM lparam) { m_Static1.GetDlgItem(IDC_STATIC6); m_Static1.SetWindowTextW(L"Thread2 Running"); Sleep(100); m_Static1.SetWindowTextW(L""); Sleep(100); return TRUE; } void CThreadingEx3Dlg::OnBnClickedPause() { // TODO: Add your control notification handler code here if(!m_Track) { m_Track = TRUE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Resume"); myThread1->SuspendThread(); WaitForSingleObject(myThread1->m_hThread,INFINITE); myThread2->SuspendThread(); m_Static.SetWindowTextW(L"Paused.."); } else { m_Track = FALSE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Pause"); myThread1->ResumeThread(); myThread2->ResumeThread(); /*myEventHandler.SetEvent(); WaitForSingleObject(myThread1->m_hThread,INFINITE);*/ } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • using AsyncTask class for parallel operationand displaying a progress bar

    - by Kumar
    I am displaying a progress bar using Async task class and simulatneously in parallel operation , i want to retrieve a string array from a function of another class that takes some time to return the string array. The problem is that when i place the function call in doing backgroung function of AsyncTask class , it gives an error in Doing Background and gives the message as cant change the UI in doing Background .. Therefore , i placed the function call in post Execute method of Asynctask class . It doesnot give an error but after the progress bar has reached 100% , then the screen goes black and takes some time to start the new activity. How can i display the progress bar and make the function call simultaneously.??plz help , m in distress here is the code package com.integrated.mpr; import android.app.Activity; import android.app.ProgressDialog; import android.content.Intent; import android.os.AsyncTask; import android.os.Bundle; import android.os.Handler; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class Progess extends Activity implements OnClickListener{ static String[] display = new String[Choose.n]; Button bprogress; @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.progress); bprogress = (Button) findViewById(R.id.bProgress); bprogress.setOnClickListener(this); } @Override public void onClick(View v) { // TODO Auto-generated method stub switch(v.getId()){ case R.id.bProgress: String x ="abc"; new loadSomeStuff().execute(x); break; } } public class loadSomeStuff extends AsyncTask<String , Integer , String>{ ProgressDialog dialog; protected void onPreExecute(){ dialog = new ProgressDialog(Progess.this); dialog.setProgressStyle(ProgressDialog.STYLE_HORIZONTAL); dialog.setMax(100); dialog.show(); } @Override protected String doInBackground(String... arg0) { // TODO Auto-generated method stub for(int i = 0 ;i<40;i++){ publishProgress(5); try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } dialog.dismiss(); String y ="abc"; return y; } protected void onProgressUpdate(Integer...progress){ dialog.incrementProgressBy(progress[0]); } protected void onPostExecute(String result){ display = new Logic().finaldata(); Intent openList = new Intent("com.integrated.mpr.SENSITIVELIST"); startActivity(openList); } } }

    Read the article

  • C++ Beginner - 'friend' functions and << operator overloading: What is the proper way to overload an

    - by Francisco P.
    Hello, everyone! In a project I'm working on, I have a Score class, defined below in score.h. I am trying to overload it so, when a << operation is performed on it, _points + " " + _name is returned. Here's what I tried to do: ostream & Score::operator<< (ostream & os, Score right) { os << right.getPoints() << " " << right.scoreGetName(); return os; } Here are the errors returned: 1>c:\users\francisco\documents\feup\1a2s\prog\projecto3\projecto3\score.h(30) : error C2804: binary 'operator <<' has too many parameters (This error appears 4 times, actually) I managed to get it working by declaring the overload as a friend function: friend ostream & operator<< (ostream & os, Score right); And removing the Score:: from the function declaration in score.cpp (effectively not declaring it as a member). Why does this work, yet the code describe above doesn't? Thanks for your time! Below is the full score.h /////////////////////////////////////////////////////////// // Score.h // Implementation of the Class Score // Created on: 10-Mai-2010 11:43:56 // Original author: Francisco /////////////////////////////////////////////////////////// #ifndef SCORE_H_ #define SCORE_H_ #include <string> #include <iostream> #include <iostream> using std::string; using std::ostream; class Score { public: Score(string name); Score(); virtual ~Score(); void addPoints(int n); string scoreGetName() const; int getPoints() const; void scoreSetName(string name); bool operator>(const Score right) const; ostream & operator<< (ostream & os, Score right); private: string _name; int _points; }; #endif

    Read the article

  • Invalid Cross-Thread Operations from BackgroundWorker2_RunWorkerCompleted in C#

    - by Jim Fell
    Hello. I'm getting an error that does not make sense. Cross-thread operation not valid: Control 'buttonOpenFile' accessed from a thread other than the thread it was created on. In my application, the UI thread fires off backgroundWorker1, which when almost complete fires off backgroundWorker2 and waits for it to complete. backgroundWorker1 waits for backgroundWorker2 to complete, before it completes. AutoResetEvent variables are used to flag when each of the workers complete. In backgroundWorker2_RunWorkerComplete a function is called that resets the form controls. It is in this ResetFormControls() function where the exception is thrown. I thought it was safe to modify form controls in the RunWorkerCompleted function. Both background workers are instantiated from the UI thread. Here is a greatly summarized version of what I am doing: AutoResetEvent evtProgrammingComplete_c = new AutoResetEvent(false); AutoResetEvent evtResetComplete_c = new AutoResetEvent(false); private void ResetFormControls() { toolStripProgressBar1.Enabled = false; toolStripProgressBar1.RightToLeftLayout = false; toolStripProgressBar1.Value = 0; buttonInit.Enabled = true; buttonOpenFile.Enabled = true; // Error occurs here. buttonProgram.Enabled = true; buttonAbort.Enabled = false; buttonReset.Enabled = true; checkBoxPeripheryModule.Enabled = true; checkBoxVerbose.Enabled = true; comboBoxComPort.Enabled = true; groupBoxToolSettings.Enabled = true; groupBoxNodeSettings.Enabled = true; } private void buttonProgram_Click(object sender, EventArgs e) { while (backgroundWorkerProgram.IsBusy) backgroundWorkerProgram.CancelAsync(); backgroundWorkerProgram.RunWorkerAsync(); } private void backgroundWorkerProgram_DoWork(object sender, DoWorkEventArgs e) { // Does a bunch of stuff... if (tProgramStat_c == eProgramStat_t.DONE) { tProgramStat_c = eProgramStat_t.RESETTING; while (backgroundWorkerReset.IsBusy) backgroundWorkerReset.CancelAsync(); backgroundWorkerReset.RunWorkerAsync(); evtResetComplete_c.WaitOne(LONG_ACK_WAIT * 2); if (tResetStat_c == eResetStat_t.COMPLETED) tProgramStat_c = eProgramStat_t.DONE; } } private void backgroundWorkerProgram_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { // Updates form to report complete. No problems here. evtProgrammingComplete_c.Set(); backgroundWorkerProgram.Dispose(); } private void backgroundWorkerReset_DoWork(object sender, DoWorkEventArgs e) { // Does a bunch of stuff... if (tResetStat_c == eResetStat_t.COMPLETED) if (tProgramStat_c == eProgramStat_t.RESETTING) evtProgrammingComplete_c.WaitOne(); } private void backgroundWorkerReset_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { CloseAllComms(); ResetFormControls(); evtResetComplete_c.Set(); backgroundWorkerReset.Dispose(); } Any thoughts or suggestions you may have would be appreciated. I am using Microsoft Visual C# 2008 Express Edition. Thanks.

    Read the article

  • Is there a way to keep track of the ordering of items in a dictionary?

    - by Corpsekicker
    I have a Dictionary<Guid, ElementViewModel>. (ElementViewModel is our own complex type.) I add items to the dictionary with a stock standard items.Add(Guid.NewGuid, new ElementViewModel() { /*setters go here*/ });, At a later stage I remove some or all of these items. A simplistic view of my ElementViewModel is this: class ElementViewModel { Guid Id { get; set; } string Name { get; set; } int SequenceNo { get; set; } } It may be significant to mention that the SequenceNos are compacted within the collection after adding, in case other operations like moving and copying took place. {1, 5, 6} - {1, 2, 3} A simplistic view of my remove operation is: public void RemoveElementViewModel(IEnumerable<ElementViewModel> elementsToDelete) { foreach (var elementViewModel in elementsToDelete) items.Remove(elementViewModel.Id); CompactSequenceNumbers(); } I will illustrate the problem with an example: I add 3 items to the dictionary: var newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 1, Name = "Element 1" }); newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 2, Name = "Element 2" }); newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 3, Name = "Element 3" }); I remove 2 items RemoveElementViewModel(new List<ElementViewModel> { item2, item3 }); //imagine I had them cached somewhere. Now I want to add 2 other items: newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 2, Name = "Element 2, Part 2" }); newGuid = Guid.NewGuid(); items.Add(newGuid, new MineLayoutElementViewModel { Id = newGuid, SequenceNo = 3, Name = "Element 3, Part 2" }); On evaluation of the dictionary at this point, I expected the order of items to be "Element 1", "Element 2, Part 2", "Element 3, Part 2" but it is actually in the following order: "Element 1", "Element 3, Part 2", "Element 2, Part 2" I rely on the order of these items to be a certain way. Why is it not as expected and what can I do about it?

    Read the article

  • Why is this statement treated as a string instead of its result?

    - by reve_etrange
    I am trying to perform some composition-based filtering on a large collection of strings (protein sequences). I wrote a group of three subroutines in order to take care of it, but I'm running into trouble in two ways - one minor, one major. The minor trouble is that when I use List::MoreUtils 'pairwise' I get warnings about using $a and $b only once and them being uninitialized. But I believe I'm calling this method properly (based on CPAN's entry for it and some examples from the web). The major trouble is an error "Can't use string ("17/32") as HASH ref while "strict refs" in use..." It seems like this can only happen if the foreach loop in &comp is giving the hash values as a string instead of evaluating the division operation. I'm sure I've made a rookie mistake, but can't find the answer on the web. The first time I even looked at perl code was last Wednesday... use List::Util; use List::MoreUtils; my @alphabet = ( 'A', 'R', 'N', 'D', 'C', 'Q', 'E', 'G', 'H', 'I', 'L', 'K', 'M', 'F', 'P', 'S', 'T', 'W', 'Y', 'V' ); my $gapchr = '-'; # Takes a sequence and returns letter = occurrence count pairs as hash. sub getcounts { my %counts = (); foreach my $chr (@alphabet) { $counts{$chr} = ( $[0] =~ tr/$chr/$chr/ ); } $counts{'gap'} = ( $[0] =~ tr/$gapchr/$gapchr/ ); return %counts; } # Takes a sequence and returns letter = fractional composition pairs as a hash. sub comp { my %comp = getcounts( $[0] ); foreach my $chr (@alphabet) { $comp{$chr} = $comp{$chr} / ( length( $[0] ) - $comp{'gap'} ); } return %comp; } # Takes two sequences and returns a measure of the composition difference between them, as a scalar. # Originally all on one line but it was unreadable. sub dcomp { my @dcomp = pairwise { $a - $b } @{ values( %{ comp( $[0] ) } ) }, @{ values( %{ comp( $[1] ) } ) }; @dcomp = apply { $_ ** 2 } @dcomp; my $dcomp = sqrt( sum( 0, @dcomp ) ) / 20; return $dcomp; } Much appreciation for any answers or advice!

    Read the article

  • SQL Server - Get Inserted Record Identity Value when Using a View's Instead Of Trigger

    - by CuppM
    For several tables that have identity fields, we are implementing a Row Level Security scheme using Views and Instead Of triggers on those views. Here is a simplified example structure: -- Table CREATE TABLE tblItem ( ItemId int identity(1,1) primary key, Name varchar(20) ) go -- View CREATE VIEW vwItem AS SELECT * FROM tblItem -- RLS Filtering Condition go -- Instead Of Insert Trigger CREATE TRIGGER IO_vwItem_Insert ON vwItem INSTEAD OF INSERT AS BEGIN -- RLS Security Checks on inserted Table -- Insert Records Into Table INSERT INTO tblItem (Name) SELECT Name FROM inserted; END go If I want to insert a record and get its identity, before implementing the RLS Instead Of trigger, I used: DECLARE @ItemId int; INSERT INTO tblItem (Name) VALUES ('MyName'); SELECT @ItemId = SCOPE_IDENTITY(); With the trigger, SCOPE_IDENTITY() no longer works - it returns NULL. I've seen suggestions for using the OUTPUT clause to get the identity back, but I can't seem to get it to work the way I need it to. If I put the OUTPUT clause on the view insert, nothing is ever entered into it. -- Nothing is added to @ItemIds DECLARE @ItemIds TABLE (ItemId int); INSERT INTO vwItem (Name) OUTPUT INSERTED.ItemId INTO @ItemIds VALUES ('MyName'); If I put the OUTPUT clause in the trigger on the INSERT statement, the trigger returns the table (I can view it from SQL Management Studio). I can't seem to capture it in the calling code; either by using an OUTPUT clause on that call or using a SELECT * FROM (). -- Modified Instead Of Insert Trigger w/ Output CREATE TRIGGER IO_vwItem_Insert ON vwItem INSTEAD OF INSERT AS BEGIN -- RLS Security Checks on inserted Table -- Insert Records Into Table INSERT INTO tblItem (Name) OUTPUT INSERTED.ItemId SELECT Name FROM inserted; END go -- Calling Code INSERT INTO vwItem (Name) VALUES ('MyName'); The only thing I can think of is to use the IDENT_CURRENT() function. Since that doesn't operate in the current scope, there's an issue of concurrent users inserting at the same time and messing it up. If the entire operation is wrapped in a transaction, would that prevent the concurrency issue? BEGIN TRANSACTION DECLARE @ItemId int; INSERT INTO tblItem (Name) VALUES ('MyName'); SELECT @ItemId = IDENT_CURRENT('tblItem'); COMMIT TRANSACTION Does anyone have any suggestions on how to do this better? I know people out there who will read this and say "Triggers are EVIL, don't use them!" While I appreciate your convictions, please don't offer that "suggestion".

    Read the article

  • Conceptual inheritance implementation

    - by TheSENDER
    Hi there, I'm writing a spatial data structure and I have a doubt about what's the best NODE implementation. According to my design I have an abstract node entity and three classes which inherit from it: EMPTYNODE, FULLNODE, INTERNALNODE. The first one has no particular data. The second one has 1 reference to a generic element. The third one has 2 references to other nodes. I have found several ways to implement this situation (that I have already coded) but I can't decide what's the best. The first solution that I have found is to use a single class Node that potentially performs all the operation in this way: private static class Node { private Elem elem = null; private Node left = null, right = null; public Elem getElem() { assert isFull(); return elem; } public boolean isEmpty() { return elem == null && left == null; } public boolean isFull() { return elem != null; } public boolean isInternal() { return elem == null && left != null; } } The second solution is to write an explicit division by classes where every class offers only its methods. Obviously in this way we are obliged to perform several casts to the node objects. private static abstract class Node { public abstract boolean isEmpty(); public abstract boolean isFull(); public abstract boolean isInternal(); } private static class FullNode extends Node{ private ITriangle elem; @Override public boolean isEmpty() { return false; } @Override public final boolean isFull() { return true; } @Override public final boolean isInternal() { return false; } public Elem getElem() { return elem; } } The third one solution is to use the inheritance allowing every classes to offer all the methods, but the object type should by check by "isEmpty()" and similar methods. In case of wrong call we'll throw an exception. private static abstract class Node { public abstract boolean isEmpty(); public abstract boolean isFull(); public abstract boolean isInternal(); public abstract Elem getElem(); } private static class Empty extends Node{ @Override public boolean isEmpty() { return true; } @Override public final boolean isFull() { return false; } @Override public final boolean isInternal() { return false; } @Override public Elem getElem() { throw new AssertionError(); } } What do you think about these three solutions? Which one would you use? Any other ideas? Thanks for your help. Every idea will be appreciated.

    Read the article

< Previous Page | 231 232 233 234 235 236 237 238 239 240 241 242  | Next Page >