Search Results

Search found 6651 results on 267 pages for 'description'.

Page 237/267 | < Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >

  • mysql: can't set max_allowed_package to anything grater than 16MB

    - by sas
    I'm not sure if this is the right place to post these kind of questions, if it's not so, please (politely) let me know... :-) I need to save files greater than 16MB on a mysql database from a php site... I've already changed the c:\xampp\mysql\bin\my.cnf and set max_allowed_packet to 16 MB, and everything worked fine then I set it to 32 MB but there´s no way I can handle a file bigger than 16 MB I get the following error: 'MySQL server has gone away' (the same error I had when max_allowed_packet was set to 1MB) there must be some other setting that doesn´t allow me to handle files bigger than 16MB maybe the php client, I guess, but I don't know where to edit it this is the code I'm running when file.txt is smaller than 16.776.192 bytes long, it works fine, but if file.txt has 16.777.216 bytes i get the aforementioned error oh, and the field download.content is a longblob... $file = 'file.txt'; $file_handle = fopen( $file, 'r' ); $content = fread( $file_handle, filesize( $file ) ); fclose( $file_handle ); db_execute( 'truncate table download', true ); $sql = "insert into download( code, title, name, description, original_name, mime_type, size, content, user_insert_id, date_insert, user_update_id, date_update ) values ( 'new file', 'new file', 'sas.jpg', 'new file', '$file', 'mime', " . filesize( $file ) . ", '" . addslashes( $content ) . "', 0, " . db_char_to_sql( now_char(), 'datetime' ) . ", 0, " . db_char_to_sql( now_char(), 'datetime' ) . " )"; db_execute( $sql, true ); (the db_execute funcion just opens the connections and executes the sql stuff) running on windows XP sp2 server version: 5.0.67-community PHP Version 4.4.9 mysql client API version: 3.23.49 using: ApacheFriends XAMPP (Basispaket) version 1.6.8 that comes with + Apache 2.2.9 + MySQL 5.0.67 (Community Server) + PHP 5.2.6 + PHP 4.4.9 + PEAR + phpMyAdmin 2.11.9.2 ... this is part of the content of c:\xampp\mysql\bin\my.cnf # The MySQL server [mysqld] port= 3306 socket= "C:/xampp/mysql/mysql.sock" basedir="C:/xampp/mysql" tmpdir="C:/xampp/tmp" datadir="C:/xampp/mysql/data" skip-locking key_buffer = 16M # max_allowed_packet = 1M max_allowed_packet = 32M table_cache = 128 sort_buffer_size = 512K net_buffer_length = 8K read_buffer_size = 256K read_rnd_buffer_size = 512K myisam_sort_buffer_size = 8M

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • How can I check the content of the arrays? Parsing XML file with ObjectiveC

    - by skiria
    I have 3 classes- video { nameVideo, id, description, user... } topic {nameTopic, topicID, NSMutableArray videos; } category {nameCategory, categoryID, NSMUtableArray topics} And then in my app delegate I defined- NSMutableArray categories; I parse an XML file with this code. I try the arrays hierachy, and i think that i don't add any object on the arrays. How can I check it? What's wrong? (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qualifiedName attributes:(NSDictionary *)attributeDict { if([elementName isEqualToString:@"Videos"]) { //Initialize the array. appDelegate.categories = [[NSMutableArray alloc] init]; } else if ([elementName isEqualToString:@"Category"]) { aCategory = [[Category alloc] init]; aCategory.categoryID = [[attributeDict objectForKey:@"id"] integerValue]; NSLog(@"Reading id category value: %i", aCategory.categoryID); } else if ([elementName isEqualToString:@"Topic"]) { aTopic = [[Topic alloc] init]; aTopic.topicID = [[attributeDict objectForKey:@"id"] integerValue]; NSLog(@"Reading id topic value: %i", aTopic.topicID); } else if ([elementName isEqualToString:@"video"]) { aVideo = [[Video alloc] init]; aVideo.videoID = [[attributeDict objectForKey:@"id"] integerValue]; aVideo.nameTopic = currentNameTopic; aVideo.nameCategory = currentNameCategory; NSLog(@"Reading id video value: %i", aVideo.videoID); } NSLog(@"Processing Element: %@", elementName); } (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string { if(!currentElementValue) currentElementValue = [[NSMutableString alloc] initWithString:string]; else [currentElementValue appendString:string]; NSLog(@"Processing Value: %@", currentElementValue); } (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if([elementName isEqualToString:@"Videos"]) return; if ([elementName isEqualToString:@"Category"]) { [appDelegate.categories addObject:aCategory]; [aCategory release]; aCategory = nil; } if ([elementName isEqualToString:@"Topic"]) { [aCategory.topics addObject:aTopic]; //NSLog(@"contador: %i", [aCategory.topics count]); //NSLog(@"contador: %@", aTopic.nameTopic); [aTopic release]; aTopic = nil; } if ([elementName isEqualToString:@"video"]) { [aTopic.videos addObject:aVideo]; NSLog(@"count number videos: %i", [aTopic.videos count]); -- always 0 NSLog(@"NOM CATEGORIA VIDEO: %@", aVideo.urlVideo); -- OK [aVideo release]; aVideo = nil; } if ([elementName isEqualToString:@"nameCategory"]) { //[aCategory setValue:currentElementValue forKey:elementName]; aCategory.nameCategory = currentElementValue; currentNameCategory = currentElementValue; } if ([elementName isEqualToString:@"nameTopic"]) { aTopic.nameTopic = currentElementValue; currentNameTopic = currentElementValue; } else [aVideo setValue:currentElementValue forKey:elementName]; [currentElementValue release]; currentElementValue = nil; }

    Read the article

  • MooTools event listener disappears after element.innerHTML is changed

    - by acoder
    Hi everyone, I am trying to achieve this task using MooTools. Description: I attached an event listener to "myButton" link. A click on this link initiates an AJAX request and updates "myDiv" content based on the response text. During this request a POST variable is being sent to "button.php", but it's not used at the moment.. (i wish to use it later) OK, as a result, "myDiv" gets exactly the same link with the same ID (myButton) + a random number, so that we could see that each click generates a new number. The problem: After the first click on "myButton", "myDiv" updates correctly, showing a random number. When I click "myButton" for the second time (this time in newly updated div), the div does not refresh anymore. Please note that I need "myButton" to be inside "myDiv", and "myDiv" must be updated (refreshed) after each click without having to refresh the entire page. Can somebody show me how to achieve this task based on this simplified code example? index.html <html> <head> <script type="text/javascript" src="mootools-1.2.4-core-nc.js"></script> <script> window.addEvent('domready', function() { $('myButton').addEvent('click', function(e) { e.stop(); var myRequest = new Request({ method: 'post', url: 'button.php', data: { action : 'test' }, onRequest: function() { $('myDiv').innerHTML = '<img src="images/loading.gif" />'; }, onComplete: function(response) { $('myDiv').innerHTML = response; } }); myRequest.send(); $('myButton').removeEvent('click'); }); }); </script> </head> <body> <div id="myDiv"> <a id="myButton" href="#">Button</a> </div> </body> </html> button.php <a id="myButton" href="#">Button</a> clicked <?php echo rand(1,100); ?>

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • [Reloaded] Error while sorting filtered data from a GridView

    - by Bogdan M
    Hello guys, I have an error I cannot solve, on a ASP.NET website. One of its pages - Countries.aspx, has the following controls: a CheckBox called "CheckBoxNAME": < asp:CheckBox ID="CheckBoxNAME" runat="server" Text="Name" /> a TextBox called "TextBoxName": < asp:TextBox ID="TextBoxNAME" runat="server" Width="100%" Wrap="False"> < /asp:TextBox> a SQLDataSource called "SqlDataSourceCOUNTRIES", that selects all records from a Table with 3 columns - ID (Number, PK), NAME (Varchar2(1000)), and POPULATION (Number) called COUNTRIES < asp:SqlDataSource ID="SqlDataSourceCOUNTRIES" runat="server" ConnectionString="< %$ ConnectionStrings:myDB %> " ProviderName="< %$ ConnectionStrings:myDB.ProviderName %> " SelectCommand="SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES ORDER BY COUNTRIES.NAME, COUNTRIES.ID"> < /asp:SqlDataSource> a GridView called GridViewCOUNTRIES: < asp:GridView ID="GridViewCOUNTRIES" runat="server" AllowPaging="True" AllowSorting="True" AutoGenerateColumns="False" DataSourceID="SqlDataSourceCOUNTRIES" DataKeyNames="ID" DataMember="DefaultView"> < Columns> < asp:CommandField ShowSelectButton="True" /> < asp:BoundField DataField="ID" HeaderText="Id" SortExpression="ID" /> < asp:BoundField DataField="NAME" HeaderText="Name" SortExpression="NAME" /> < asp:BoundField DataField="POPULATION" HeaderText="Population" SortExpression="POPULATION" /> < /Columns> < /asp:GridView> a Button called ButtonFilter: < asp:Button ID="ButtonFilter" runat="server" Text="Filter" onclick="ButtonFilter_Click"/> This is the onclick event: protected void ButtonFilter_Click(object sender, EventArgs e) { Response.Redirect("Countries.aspx?" + (this.CheckBoxNAME.Checked ? string.Format("NAME={0}", this.TextBoxNAME.Text) : string.Empty)); } Also, this is the main onload event of the page: protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack == false) { if (Request.QueryString.Count != 0) { Dictionary parameters = new Dictionary(); string commandTextFormat = string.Empty; if (Request.QueryString["NAME"] != null) { if (commandTextFormat != string.Empty && commandTextFormat.EndsWith("AND") == false) { commandTextFormat += "AND"; } commandTextFormat += " (UPPER(COUNTRIES.NAME) LIKE '%' || :NAME || '%') "; parameters.Add("NAME", Request.QueryString["NAME"].ToString()); } this.SqlDataSourceCOUNTRIES.SelectCommand = string.Format("SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES WHERE {0} ORDER BY COUNTRIES.NAME, COUNTRIES.ID", commandTextFormat); foreach (KeyValuePair parameter in parameters) { this.SqlDataSourceCOUNTRIES.SelectParameters.Add(parameter.Key, parameter.Value.ToUpper()); } } } } Basicly, the page displays in the GridViewCOUNTRIES all the records of table COUNTRIES. The scenario is the following: - the user checks the CheckBox; - the user types a value in the TextBox (let's say "ch"); - the user presses the Button; - the page loads displaying only the records that match the filter criteria (in this case, all the countries that have names containing "Ch"); - the user clicks on the header of the column called "Name" in order to sort the data in the GridView Then, I get the following error: ORA-01036: illegal variable name/number. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.OracleClient.OracleException: ORA-01036: illegal variable name/number Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Any help is greatly appreciated, tnks. PS: I'm using ASP.NET 3.5, under Visual Studio 2008, with an OracleXE database.

    Read the article

  • Instance Failure in asp.net

    - by user85511
    I have a web application that is working perfectly in my system. However, when I copied it to another system, I couldn't login to the application. There is an error: Server Error in '/' Application. -------------------------------------------------------------------------------- Instance failure. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.InvalidOperationException: Instance failure. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [InvalidOperationException: Instance failure.] System.Data.SqlClient.TdsParser.Connect(ServerInfo serverInfo, SqlInternalConnectionTds connHandler, Boolean ignoreSniOpenTimeout, Int64 timerExpire, Boolean encrypt, Boolean trustServerCert, Boolean integratedSecurity, SqlConnection owningObject) +4858423 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, Int64 timerExpire, SqlConnection owningObject) +90 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(String host, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, Int64 timerStart) +257 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +221 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +189 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +4859187 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +31 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +433 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +66 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +499 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +65 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +117 System.Data.SqlClient.SqlConnection.Open() +122 System.Web.DataAccess.SqlConnectionHolder.Open(HttpContext context, Boolean revertImpersonate) +87 System.Web.DataAccess.SqlConnectionHelper.GetConnection(String connectionString, Boolean revertImpersonation) +221 System.Web.Security.SqlMembershipProvider.GetPasswordWithFormat(String username, Boolean updateLastLoginActivityDate, Int32& status, String& password, Int32& passwordFormat, String& passwordSalt, Int32& failedPasswordAttemptCount, Int32& failedPasswordAnswerAttemptCount, Boolean& isApproved, DateTime& lastLoginDate, DateTime& lastActivityDate) +815 System.Web.Security.SqlMembershipProvider.CheckPassword(String username, String password, Boolean updateLastLoginActivityDate, Boolean failIfNotApproved, String& salt, Int32& passwordFormat) +105 System.Web.Security.SqlMembershipProvider.CheckPassword(String username, String password, Boolean updateLastLoginActivityDate, Boolean failIfNotApproved) +42 System.Web.Security.SqlMembershipProvider.ValidateUser(String username, String password) +78 System.Web.UI.WebControls.Login.AuthenticateUsingMembershipProvider(AuthenticateEventArgs e) +60 System.Web.UI.WebControls.Login.OnAuthenticate(AuthenticateEventArgs e) +119 System.Web.UI.WebControls.Login.AttemptLogin() +115 System.Web.UI.WebControls.Login.OnBubbleEvent(Object source, EventArgs e) +101 System.Web.UI.Control.RaiseBubbleEvent(Object source, EventArgs args) +37 System.Web.UI.WebControls.Button.OnCommand(CommandEventArgs e) +118 System.Web.UI.WebControls.Button.RaisePostBackEvent(String eventArgument) +166 System.Web.UI.WebControls.Button.System.Web.UI.IPostBackEventHandler.RaisePostBackEvent(String eventArgument) +10 System.Web.UI.Page.RaisePostBackEvent(IPostBackEventHandler sourceControl, String eventArgument) +13 System.Web.UI.Page.RaisePostBackEvent(NameValueCollection postData) +36 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1565 -------------------------------------------------------------------------------- Version Information: Microsoft .NET Framework Version:2.0.50727.3053; ASP.NET Version:2.0.50727.3053 What could be the reason for such an error? How could I solve this?

    Read the article

  • Why does WebSharingAppDemo-CEProviderEndToEnd sample still need a client db connection after scope c

    - by Don
    I'm researching a way to build an n-tierd sync solution. From the WebSharingAppDemo-CEProviderEndToEnd sample it seems almost feasable however for some reason, the app will only sync if the client has a live SQL db connection. Can some one explain what I'm missing and how to sync without exposing SQL to the internet? The problem I'm experiencing is that when I provide a Relational sync provider that has an open SQL connection from the client, then it works fine but when I provide a Relational sync provider that has a closed but configured connection string, as in the example, I get an error from the WCF stating that the server did not receive the batch file. So what am I doing wrong? SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(); builder.DataSource = hostName; builder.IntegratedSecurity = true; builder.InitialCatalog = "mydbname"; builder.ConnectTimeout = 1; provider.Connection = new SqlConnection(builder.ToString()); // provider.Connection.Open(); **** un-commenting this causes the code to work** //create anew scope description and add the appropriate tables to this scope DbSyncScopeDescription scopeDesc = new DbSyncScopeDescription(SyncUtils.ScopeName); //class to be used to provision the scope defined above SqlSyncScopeProvisioning serverConfig = new SqlSyncScopeProvisioning(); .... The error I get occurs in this part of the WCF code: public SyncSessionStatistics ApplyChanges(ConflictResolutionPolicy resolutionPolicy, ChangeBatch sourceChanges, object changeData) { Log("ProcessChangeBatch: {0}", this.peerProvider.Connection.ConnectionString); DbSyncContext dataRetriever = changeData as DbSyncContext; if (dataRetriever != null && dataRetriever.IsDataBatched) { string remotePeerId = dataRetriever.MadeWithKnowledge.ReplicaId.ToString(); //Data is batched. The client should have uploaded this file to us prior to calling ApplyChanges. //So look for it. //The Id would be the DbSyncContext.BatchFileName which is just the batch file name without the complete path string localBatchFileName = null; if (!this.batchIdToFileMapper.TryGetValue(dataRetriever.BatchFileName, out localBatchFileName)) { //Service has not received this file. Throw exception throw new FaultException<WebSyncFaultException>(new WebSyncFaultException("No batch file uploaded for id " + dataRetriever.BatchFileName, null)); } dataRetriever.BatchFileName = localBatchFileName; } Any ideas?

    Read the article

  • Is a many-to-many relationship with extra fields the right tool for my job?

    - by whichhand
    Previously had a go at asking a more specific version of this question, but had trouble articulating what my question was. On reflection that made me doubt if my chosen solution was correct for the problem, so this time I will explain the problem and ask if a) I am on the right track and b) if there is a way around my current brick wall. I am currently building a web interface to enable an existing database to be interrogated by (a small number of) users. Sticking with the analogy from the docs, I have models that look something like this: class Musician(models.Model): first_name = models.CharField(max_length=50) last_name = models.CharField(max_length=50) dob = models.DateField() class Album(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) class Instrument(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) Where I have one central table (Musician) and several tables of associated data that are related by either ForeignKey or OneToOneFields. Users interact with the database by creating filtering criteria to select a subset of Musicians based on data the data on the main or related tables. Likewise, the users can then select what piece of data is used to rank results that are presented to them. The results are then viewed initially as a 2 dimensional table with a single row per Musician with selected data fields (or aggregates) in each column. To give you some idea of scale, the database has ~5,000 Musicians with around 20 fields of related data. Up to here is fine and I have a working implementation. However, it is important that I have the ability for a given user to upload there own annotation data sets (more than one) and then filter and order on these in the same way they can with the existing data. The way I had tried to do this was to add the models: class UserDataSets(models.Model): user = models.ForeignKey(User) name = models.CharField(max_length=100) description = models.CharField(max_length=64) results = models.ManyToManyField(Musician, through='UserData') class UserData(models.Model): artist = models.ForeignKey(Musician) dataset = models.ForeignKey(UserDataSets) score = models.IntegerField() class Meta: unique_together = (("artist", "dataset"),) I have a simple upload mechanism enabling users to upload a data set file that consists of 1 to 1 relationship between a Musician and their "score". Within a given user dataset each artist will be unique, but different datasets are independent from each other and will often contain entries for the same musician. This worked fine for displaying the data, starting from a given artist I can do something like this: artist = Musician.objects.get(pk=1) dataset = UserDataSets.objects.get(pk=5) print artist.userdata_set.get(dataset=dataset.pk) However, this approach fell over when I came to implement the filtering and ordering of query set of musicians based on the data contained in a single user data set. For example, I could easily order the query set based on all of the data in the UserData table like this: artists = Musician.objects.all().order_by(userdata__score) But that does not help me order by the results of a given single user dataset. Likewise I need to be able to filter the query set based on the "scores" from different user data sets (eg find all musicians with a score 5 in dataset1 and < 2 in dataset2). Is there a way of doing this, or am I going about the whole thing wrong?

    Read the article

  • Settings designer file complains when protecting configuration for connectionStrings in App.Config i

    - by Joe
    Hi, I am trying to encrypt Configuration Information Using Protected Configuration in Visual Studio 2010. I have the following info speicifed in the App.Config file: <connectionStrings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </connectionStrings> <appSettings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </appSettings> However, when I then go to the Settings area of the Projects Properties to view the settings in the Designer, I get prompted with the following error "An error occured while reading the App.config file. The file might be corrupted or contain invalid XML." I understand that my changes are causing the error, however, is there anyway I can bypass that the information is not read into at design view? (Of course the best way would be to make the tags be recognized by the designer, is there any way to do this?) I tried adding <connectionStrings configProtectionProvider="TheProviderName" xmlns="http://schemas.microsoft.com/.NetConfiguration/v2.0"> to connectionStrings as well as to the appSettings, but with no luck, the intellisense is bypassed in the config file, but the designer still complains. I would be satisfied if the designer would not complain about this "error", which is not actually an error because Microsoft states here that it should work. ASP.NET 2.0 provides a new feature, called protected configuration, that enables you to encrypt sensitive information in a configuration file. Although primarily designed for ASP.NET, protected configuration can also be used to encrypt configuration file sections in Windows applications. For a detailed description of the new protected configuration capabilities, see Encrypting Configuration Information Using Protected Configuration. And yes, it does work to encrypt it and to decrypt it and use it, it is just very annoying and frustrating that the designer complains about it. Anyone who knows which xsd file that is used (if used) to verify the contents of the App.config file in the design view? Any help appreciated.

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Downloading large file with php

    - by Alessandro
    Hi, I have to write a php script to download potentially large files. The file I'm reporting here works fine most of the times. However, if the client's connection is slow the request ends (with status code 200) in the middle of the downloading, but not always at the very same point, and not at the very same time. I tried to overwrite some php.ini variables (see the first statements) but the problem remains. I don't know if it's relevant but my hosting server is SiteGround, and for simple static file requests, the download works fine also with slow connections. I've found Forced downloading large file with php but I didn't understand mario's answer. I'm new to web programming. So here's my code. <?php ini_set('memory_limit','16M'); ini_set('post_max_size', '30M'); set_time_limit(0); include ('../private/database_connection.php'); $downloadFolder = '../download/'; $fileName = $_POST['file']; $filePath = $downloadFolder . $fileName; if($fileName == NULL) { exit; } ob_start(); session_start(); if(!isset($_SESSION['Username'])) { // or redirect to login (remembering this download request) $_SESSION['previousPage'] = 'download.php?file=' . $fileName; header("Location: login.php"); exit; } if (file_exists($filePath)) { header('Content-Description: File Transfer'); header('Content-Type: application/octet-stream'); //header('Content-Disposition: attachment; filename='.$fileName); header("Content-Disposition: attachment; filename=\"$fileName\""); header('Content-Transfer-Encoding: binary'); header('Expires: 0'); header('Cache-Control: must-revalidate, post-check=0, pre-check=0'); //header('Pragma: public'); header('Content-Length: ' . filesize($filePath)); ob_clean(); flush(); // download // 1 // readfile($filePath); // 2 $file = @fopen($filePath,"rb"); if ($file) { while(!feof($file)) { print(fread($file, 1024*8)); flush(); if (connection_status()!=0) { @fclose($file); die(); } } @fclose($file); } exit; } else { header('HTTP/1.1 404 File not found'); exit; } ?>

    Read the article

  • objective C convert NSString to unsigned

    - by user1501354
    I have changed my question. I want to convert an NSString to an unsigned int. Why? Because I want to do parallel payment in PayPal. Below I have given my coding in which I want to convert the NSString to an unsigned int. My query is: //optional, set shippingEnabled to TRUE if you want to display shipping //options to the user, default: TRUE [PayPal getPayPalInst].shippingEnabled = TRUE; //optional, set dynamicAmountUpdateEnabled to TRUE if you want to compute //shipping and tax based on the user's address choice, default: FALSE [PayPal getPayPalInst].dynamicAmountUpdateEnabled = TRUE; //optional, choose who pays the fee, default: FEEPAYER_EACHRECEIVER [PayPal getPayPalInst].feePayer = FEEPAYER_EACHRECEIVER; //for a payment with multiple recipients, use a PayPalAdvancedPayment object PayPalAdvancedPayment *payment = [[PayPalAdvancedPayment alloc] init]; payment.paymentCurrency = @"USD"; // A payment note applied to all recipients. payment.memo = @"A Note applied to all recipients"; //receiverPaymentDetails is a list of PPReceiverPaymentDetails objects payment.receiverPaymentDetails = [NSMutableArray array]; NSArray *emailArray = [NSArray arrayWithObjects:@"[email protected]",@"[email protected]", nil]; for (int i = 1; i <= 2; i++) { PayPalReceiverPaymentDetails *details = [[PayPalReceiverPaymentDetails alloc] init]; // Customize the payment notes for one of the three recipient. if (i == 2) { details.description = [NSString stringWithFormat:@"Component %d", i]; } details.recipient = [NSString stringWithFormat:@"%@",[emailArray objectAtIndex:i-1]]; unsigned order; if (i==1) { order = [[feeArray objectAtIndex:0] unsignedIntValue]; } if (i==2) { order = [[amountArray objectAtIndex:0] unsignedIntValue]; } //subtotal of all items for this recipient, without tax and shipping details.subTotal = [NSDecimalNumber decimalNumberWithMantissa:order exponent:-4 isNegative:FALSE]; //invoiceData is a PayPalInvoiceData object which contains tax, shipping, and a list of PayPalInvoiceItem objects details.invoiceData = [[PayPalInvoiceData alloc] init]; //invoiceItems is a list of PayPalInvoiceItem objects //NOTE: sum of totalPrice for all items must equal details.subTotal //NOTE: example only shows a single item, but you can have more than one details.invoiceData.invoiceItems = [NSMutableArray array]; PayPalInvoiceItem *item = [[PayPalInvoiceItem alloc] init]; item.totalPrice = details.subTotal; [details.invoiceData.invoiceItems addObject:item]; [payment.receiverPaymentDetails addObject:details]; } [[PayPal getPayPalInst] advancedCheckoutWithPayment:payment]; Can anybody tell me how to do this conversion? Thanks and regards in advance.

    Read the article

  • Multiple word Auttosuggest using Lucene.Net

    - by eric
    I am currently working on an search application which uses Lucene.Net to index the data from the database to Index file. I have a product catalog which has Name, short and long description, sku and other fields. The data is stored in Index using StandardAnalyzer. I am trying to add auto suggestion for a text field and using TermEnum to get all the keyword terms and its score from the Index. But the terms returned are of single term. For example, if I type for co, the suggestion returned are costume, count, collection, cowboy, combination etc. But I want the suggestion to return phrases. For exmaple, if I search for co, the suggestions should be cowboy costume, costume for adults, combination locks etc. The following is the code used to get the suggestions: public string[] GetKeywords(string strSearchExp) { IndexReader rd = IndexReader.Open(mIndexLoc); TermEnum tenum = rd.Terms(new Term("Name", strSearchExp)); string[] strResult = new string[10]; int i = 0; Dictionary<string, double> KeywordList = new Dictionary<string, double>(); do { //terms = tenum.Term(); if (tenum.Term() != null) { //strResult[i] = terms.text.ToString(); KeywordList.Add(tenum.Term().text.ToString(), tenum.DocFreq()); } } while (tenum.Next() && tenum.Term().text.StartsWith(strSearchExp) && tenum.Term().text.Length > 1); var sortedDict = (from entry in KeywordList orderby entry.Value descending select entry); foreach (KeyValuePair<string, double> data in sortedDict) { if (data.Key.Length > 1) { strResult[i] = data.Key; i++; } if (i >= 10) //Exit the for Loop if the count exceeds 10 break; } tenum.Close(); rd.Close(); return strResult; } Can anyone please give me directions to achive this? Thanks for looking into this.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

  • Managing several custom content types from one module(drupal)

    - by Andrew
    Is it possible to declare and manage several custom content types inside one module? I'm creating a site that needs four custom content types and I'd like to manage them from one module instead of creating module for every content type. After some testing, I found out that it seems impossible. Because, unless hook_form and content type share the same name of module, drupal doesn't call hook_form. Here's how I'd like to do - function mycontent_node_info(){ return array( 'mycontent1' => array( 'name' => t('....'), 'module' => 'mycontent', 'description' => t('...), 'has_title' => TRUE, 'title_label' => t('Title'), 'has_body' => TRUE, 'body_label' => t('content body'), ), 'mycontent2' => array( ....... ), 'mycontent3' => array( ...... ), 'mycontent4' => array( ...... ), ); } function mycontent1_form(&$node){ $form['control1'] = array( '#type' => 'select', '#options' => array( '0' => t('selection 1'), '1' => t('selection 2'), ), '#attributes' => array('id'=>'control1'), ); $form['control2'] = array( '#type' => 'select', '#options' => array( '0' => t('1'), '1' => t('2'), '2' => t('3'), '3' => t('4'), ), '#attributes' => array('id'=>'control2'), ); return $form; } function mycontent2_form(&$node){ .... } function mycontent3_form(&$node){ .... } function mycontent4_form(&$node){ .... } Am I doing something wrong here or is not possible and there's no alternative other than creating module for every content types. I appreciate much your help.

    Read the article

  • Asp.net - Invalid postback or callback argument. Event validation is enabled using '<pages enableEv

    - by Jangwenyi
    I am getting the following error when I post back a page from the client-side. I have javascript code that modifies an asp:listbox on the client side. How do we fix this? Error details below: Server Error in '/XXX' Application. -------------------------------------------------------------------------------- Invalid postback or callback argument. Event validation is enabled using <pages enableEventValidation="true"/> in configuration or <%@ Page EnableEventValidation="true" %> in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.ArgumentException: Invalid postback or callback argument. Event validation is enabled using <pages enableEventValidation="true"/> in configuration or <%@ Page EnableEventValidation="true" %> in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [ArgumentException: Invalid postback or callback argument. Event validation is enabled using <pages enableEventValidation="true"/> in configuration or <%@ Page EnableEventValidation="true" %> in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation.] System.Web.UI.ClientScriptManager.ValidateEvent(String uniqueId, String argument) +2132728 System.Web.UI.Control.ValidateEvent(String uniqueID, String eventArgument) +108 System.Web.UI.WebControls.ListBox.LoadPostData(String postDataKey, NameValueCollection postCollection) +274 System.Web.UI.WebControls.ListBox.System.Web.UI.IPostBackDataHandler.LoadPostData(String postDataKey, NameValueCollection postCollection) +11 System.Web.UI.Page.ProcessPostData(NameValueCollection postData, Boolean fBeforeLoad) +353 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1194 -------------------------------------------------------------------------------- Version Information: Microsoft .NET Framework Version:2.0.50727.1433; ASP.NET Version:2.0.50727.1433

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • ZF-Autoloader not working in UnitTests on Ubuntu

    - by Sam
    i got a problem regarding Unit-testing a Zend-Framework application under Ubuntu 12.04. The project-structure is a default zend application whereas the models are defined as the following ./application ./models ./DbTable ./ProjectStatus.php (Application_Model_DbTable_ProjectStatus) ./Mappers ./ProjectStatus.php (Application_Model_Mapper_ProjectStatus) ./ProjectStatus.php (Application_Model_ProjectStatus) The Problem here is with the Zend-specific autoloading. The naming convention here appears that the folder Mappers loads all classes with _Mapper but not _Mappers. This is some internal Zend behavior which is fine so far. On my windows machine the phpunit runs without any Problems, trying to initiate all those classes. On my Ubuntu machine however with jenkins running on it, phpunit fails to find the appropriate classes giving me the following error Fatal error: Class 'Application_Model_Mapper_ProjectStatus' not found in /var/lib/jenkins/jobs/PAM/workspace/tests/application/models/Mapper/ProjectStatusTest.php on line 39 The error appears to really be that the Zend-Autoloader doesn't load from the ubuntu machine, but i can't figure out how or why this works. The question remains of why this is. I think i've double checked every point of contact with the zend autoloading stuff, but i just can't figure this out. I'll paste the - from my point of view relevant snippets - and hope someone of you has any insight to this. Jenkins Snippet for PHPUnit <target name="phpunit" description="Run unit tests with PHPUnit"> <exec executable="phpunit" failonerror="true"> <arg line="--configuration '${basedir}/tests/phpunit.xml' --coverage-clover '${basedir}/build/logs/clover.xml' --coverage-html '${basedir}/build/coverage/.' --log-junit '${basedir}/build/logs/junit.xml'" /> </exec> </target> ./tests/phpunit.xml <phpunit bootstrap="./bootstrap.php"> ... this shouldn't be of relevance ... </phpunit> ./tests/bootstrap.php <?php // Define path to application directory defined('APPLICATION_PATH') || define('APPLICATION_PATH', realpath(dirname(__FILE__) . '/../application')); // Define application environment defined('APPLICATION_ENV') || define('APPLICATION_ENV', (getenv('APPLICATION_ENV') ? getenv('APPLICATION_ENV') : 'testing')); // Ensure library/ is on include_path set_include_path(implode(PATH_SEPARATOR, array( realpath(APPLICATION_PATH . '/../library'), get_include_path(), ))); require_once 'Zend/Loader/Autoloader.php'; Zend_Loader_Autoloader::getInstance(); Any help will be appreciated.

    Read the article

  • Speed up a web service for auto complete and avoid too many method calls.

    - by jphenow
    So I've got my jquery autocomplete 'working,' but its a little fidgety since I call the webservice method each time a keydown() fires so I get lots of methods hanging and sometimes to get the "auto" to work I have to type it out and backspace a bit because i'm assuming it got its return value a little slow. I've limited the query results to 8 to mininmize time. Is there anything i can do to make this a little snappier? This thing seems near useless if I don't get it a little more responsive. javascript $("#clientAutoNames").keydown(function () { $.ajax({ type: "POST", url: "WebService.asmx/LoadData", data: "{'input':" + JSON.stringify($("#clientAutoNames").val()) + "}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (data) { if (data.d != null) { var serviceScript = data.d; } $("#autoNames").html(serviceScript); $('#clientAutoNames').autocomplete({ minLength: 2, source: autoNames, delay: 100, focus: function (event, ui) { $('#project').val(ui.item.label); return false; }, select: function (event, ui) { $('#clientAutoNames').val(ui.item.label); $('#projectid').val(ui.item.value); $('#project-description').html(ui.item.desc); pkey = $('#project-id').val; return false; } }) .data("autocomplete")._renderItem = function (ul, item) { return $("<li></li>") .data("item.autocomplete", item) .append("<a>" + item.label + "<br>" + item.desc + "</a>") .appendTo(ul); } } }); }); WebService.asmx <WebMethod()> _ Public Function LoadData(ByVal input As String) As String Dim result As String = "<script>var autoNames = [" Dim sqlOut As Data.SqlClient.SqlDataReader Dim connstring As String = *Datasource* Dim strSql As String = "SELECT TOP 2 * FROM v_Clients WHERE (SearchName Like '" + input + "%') ORDER BY SearchName" Dim cnn As Data.SqlClient.SqlConnection = New Data.SqlClient.SqlConnection(connstring) Dim cmd As Data.SqlClient.SqlCommand = New Data.SqlClient.SqlCommand(strSql, cnn) cnn.Open() sqlOut = cmd.ExecuteReader() Dim c As Integer = 0 While sqlOut.Read() result = result + "{" result = result + "value: '" + sqlOut("ContactID").ToString() + "'," result = result + "label: '" + sqlOut("SearchName").ToString() + "'," 'result = result + "desc: '" + title + " from " + company + "'," result = result + "}," End While result = result + "];</script>" sqlOut.Close() cnn.Close() Return result End Function I'm sure I'm just going about this slightly wrong or not doing a better balance of calls or something. Greatly appreciated!

    Read the article

< Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >