Search Results

Search found 39614 results on 1585 pages for 'value chain planning'.

Page 24/1585 | < Previous Page | 20 21 22 23 24 25 26 27 28 29 30 31  | Next Page >

• Oracle Leader in Transportation Management

  - by John Murphy

  Oracle Named a Leader in the Transportation Management Systems Market by Leading Analyst Firm Redwood Shores, Calif. – October 15, 2012 News Facts Gartner, Inc. has placed Oracle Transportation Management in the Leaders Quadrant of its 2012 report, “Magic Quadrant for Transportation Management Systems (TMS).” (1) Gartner Magic Quadrants position vendors within a particular market segment based on their completeness of vision and ability to execute on that vision. According to the report, “Multiple subcomponents make up a comprehensive TMS across planning (for example, load consolidation, routing, mode selection and carrier selection) and execution (for example, tendering loads to carriers, shipment track and trace, and freight audit and payment).” Built on modern, flexible, Internet based architecture, Oracle Transportation Management is a global transportation and logistics operations system that allows companies to minimize cost, optimize service levels, support sustainability initiatives, and create flexible business process automation within their transportation and logistics networks. With a share of 26% of worldwide software revenue for 2011, Oracle is also number one in TMS vendor share according to Gartner’s report, “Market Trends: A Golden Opportunity in the Transportation Management System Market, 2012 – 2016.” (2) Supporting Quote “Shippers and logistics service providers face increasingly complex challenges as they try to reduce costs, secure capacity and improve overall freight efficiency,” said Derek Gittoes, vice president, logistics product strategy, Oracle. “We believe our high standing in both Gartner reports is a reflection of Oracle’s commitment to addressing these challenges by delivering the industry’s broadest and deepest transportation management platform. With a flexible and modern platform, we are able to support customers with both basic transportation needs, as well as those with highly complex logistics requirements.” Supporting Resources Magic Quadrant for Transportation Management Systems Market Trends: A Golden Opportunity in the Transportation Management System Market, 2012 – 2016 Oracle Transportation Management (1) Gartner, Inc., “Magic Quadrant for Transportation Management Systems,” by C. Dwight Klappich, August 23, 2012 (2) Gartner, Inc., “Market Trends: A Golden Opportunity in the Transportation Management System Market, 2012 – 2016,” by Chad Eschinger and C. Dwight Klappich, September 24, 2012. About Oracle Applications Over 65,000 customers worldwide rely on Oracle's complete, open and integrated enterprise applications to achieve superior results. Oracle provides a secure path for customers to benefit from the latest technology advances that improve the customer software experience and drive better business performance. Oracle Applications Unlimited is Oracle's commitment to customer choice through continuous investment and innovation in current applications offerings. Oracle's next-generation Fusion Applications build upon that commitment, and are designed to work with and evolve Oracle's Applications Unlimited offerings. Oracle's lifetime support policy helps ensure customers will continue to have a choice in upgrade paths, based on their enterprise needs. For more information on the latest Oracle Applications releases go towww.oracle.com/applications About Oracle Oracle engineers hardware and software to work together in the cloud and in your data center. For more information about Oracle (NASDAQ:ORCL), visit www.oracle.com. Trademarks Oracle and Java are registered trademarks of Oracle and/or its affiliates. Other names may be trademarks of their respective owners. ###   Karen [email protected] Simon JonesBlanc & [email protected]

  Read the article

• Planning to create PDF files in Ruby on Rails

  - by deau

  Hi there, A Ruby on Rails app will have access to a number of images and fonts. The images are components of a visual layout which will be stored separately as a set of rules. The rules specify document dimensions along with which images are used and where. The app needs to take these rules, fetch the images, and generate a PDF that is ready for local printing or emailing. The fonts will also be important. The user needs to customize the layout by inputting text which will be included in the PDF. The PDF must therefore also contain the desired font so that the document renders identically across different machines. Each PDF may have many pages. Each page may have different dimensions but this is not essential. Either way, the ability to manipulate the dimensions and margins given by the PDF is essential. The only thing that needs to be regularly changed is the text. If this is takes too much development then the app can store the layouts in 3rd party PDFs and edit the textual content directly. Eventually though, this will prove too restrictive on the apps intended functionality so I would prefer the app to generate the PDF's itself. I have never worked with PDFs before and, for the most part, I've never had to output anything to the user outside their monitor. A printed medium could require a very different approach to get the best results. If anyone has any advice on how to model the PDF format this it would be really appreciated. The technical aspects of printing such as bleed, resolution and colour have already been factored in to the layouts and images. I am aware that PDF is a proprietary file format and I want to use free or open source software. I have seen a number of Ruby libraries for generating PDF files but because I am new on this scene I have no way to reliably compare them and too little time to implement and test them all. I also have the option of using C to handle this feature and if this is process intensive then that might be preferred. What should I be thinking about and how should I be planning to implement this?

  Read the article

• Drop Down list null value not working for selected text c#?

  - by Tamara JQ

  Hi guys, Basically I have a drop down list which is populated with text and values depending on a selected index of a radio button list. The code is as follows: protected void RBLGender_SelectedIndexChanged(object sender, EventArgs e) { DDLTrous.Items.Clear(); DDLShoes.Items.Clear(); if (RBLGender.SelectedValue.Equals("Male")) { String[] MaleTrouserText = {"[N/A]", "28\"", "30\"", "32\"", "34\"", "36\"", "38\"", "40\"", "42\"", "44\"", "48\""}; String[] MaleTrouserValue = { null, "28\"", "30\"", "32\"", "34\"", "36\"", "38\"", "40\"", "42\"", "44\"", "48\"" }; String[] MaleShoeText = { "[N/A]", "38M", "39M", "40M", "41M", "42M", "43M", "44M", "45M", "46M", "47M" }; String[] MaleShoeValue = { null, "38M", "39M", "40M", "41M", "42M", "43M", "44M", "45M", "46M", "47M" }; for (int i = 0; i < MaleTrouserText.Length; i++) { ListItem MaleList = new ListItem(MaleTrouserText[i], MaleTrouserValue[i]); DDLTrous.Items.Add(MaleList); } for (int i = 0; i < MaleShoeText.Length; i++) { ListItem MaleShoeList = new ListItem(MaleShoeText[i], MaleShoeValue[i]); DDLShoes.Items.Add(MaleShoeList); } } else if (RBLGender.SelectedValue.Equals("Female"))` When the text '[N/A]' is selected I want the value NULL to be inserted into the database. At present when '[N/A]' is selected the value entered into the database is [N/A] does anyone know why? Thanks in advance.

  Read the article

• Copy a multi-dimentional array by Value (not by reference) in PHP.

  - by Simon R

  Language: PHP I have a form which asks users for their educational details, course details and technical details. When the form is submitted the page goes to a different page to run processes on the information and save parts to a database. HOWEVER(!) I then need to return the page back to the original page, where having access to the original post information is needed. I thought it would be simple to copy (by value) the multi-dimensional (md) $_POST array to $_SESSION['post'] session_start(); $_SESSION['post'] = $_POST; However this only appears to place the top level of the array into $_SESSION['post'] not doing anything with the children/sub-arrays. An abbreviated form of the md $_POST array is as follows: Array ( [formid] = 2 [edu] = Array ( ['id'] = Array ( [1] = new_1 [2] = new_2 ) ['nameOfInstitution'] = Array ( [1] = 1 [2] = 2 ) ['qualification'] = Array ( [1] = blah [2] = blah ) ['grade'] = Array ( [1] = blah [2] = blah ) ) [vID] = 61 [Submit] = Save and Continue ) If I echo $_SESSION['post']['formid'] it writes "2", and if I echo $_SESSION['post']['edu'] it returns "Array". If I check that edu is an array (is_array($_SESSION['post']['edu])) it returns true. If I echo $_SESSION['post']['edu']['id'] it returns array, but when checked (is_array($_SESSION['post']['edu]['id'])) it returns false and I cannot echo out any of the elements. How do I successfully copy (by value, not by reference) the whole array (including its children) to an new array?

  Read the article

• iPhone OS: Why is my managedModelObject not complying with Key Value Coding?

  - by nickthedude

  Ok so I'm trying to build this stat tracker for my app and I have built a data model object called statTracker that keeps track of all the stuff I want it to. I can set and retrieve values using the selectors, but if I try and use KVC (ie setValue: forKey: ) everything goes bad and says my StatTracker class is not KVC compliant: valueForUndefinedKey:]: the entity StatTracker is not key value coding-compliant for the key "timesLauched".' 2010-05-18 15:55:08.573 here's the code that is triggering it: NSArray *statTrackerArray = [[NSArray alloc] init]; statTrackerArray = [[CoreDataSingleton sharedCoreDataSingleton] getStatTracker]; NSNumber *number1 = [[NSNumber alloc] init]; number1 = [NSNumber numberWithInt:(1 + [[(StatTracker *)[statTrackerArray objectAtIndex:0] valueForKey:@"timesLauched"] intValue])]; [(StatTracker *)[statTrackerArray objectAtIndex:0] setValue:number1 forKey:@"timesLaunched" ]; NSError *error; if (![[[CoreDataSingleton sharedCoreDataSingleton] managedObjectContext] save:&error]) { NSLog(@"error writing to db"); } Not sure if this is enough code for you folks let me know what you need if you do need more. This would be so sweet if I could use KVC because I could then abstract all this stat tracking stuff into a single method call with a string argument for the value in question. At least that is what I hope to accomplish here. I'm actually now understanding the power of KVC but now I'm just trying to figure out how to make it work. Thanks! Nick

  Read the article

• What single software development tool do you think holds the most value?

  - by Phobis

  Every day I realize how much I love Visual Studio for .NET development.... but, I believe that Resharper, may hold a value that surpasses Visual Studio's (I am using VS 2005 for WPF/WCF development). I decided it would be great to compile a list of the most valuable tools for software development. These can be applications/plug-ins anything that you think holds GREAT value. Also, please explain the benefits of the tool that you are posting. Resharper: Intergrated Unit testing "Camel Hump" code auto completion Find "usings" (inverse of "Go to Deceleration") Code formating and member rearranging Assembly and namespace inclusion (based on your code) Check for common optimizations and possible bugs in code and suggests/rewrites the code for you (things like null checking, redundant delegate creation, inverting if statements, etc...); Tells you when code and be more generic (may suggest things like "use this interface instead" if your code never refers to something specific on an object) Helps you see code that is not being used and will clean any unused members. File structure view helps you jump around the regions of your file (this is really awesome and clean). Class searching (you can use things like camel humps) Asks you which partial file to open once you find a class. It also has it's own plugin support, so you can do things like FxCop, documentation and relfector (all free). This thing has so much I don't think I hit 10% of it yet :) [When I get time, I will try to add more... feel free to help me out]

  Read the article

• How to "chain" modal dialogs in YUI 2 ?

  - by giulio

  I have a modal dialog box presented in Yahoo UI. The user selects a value from dialog "A", and then I want to present another modal dialog box to collect some more data in dialog "B". I have been using the YAHOO.widget.Dialog successfully. The problem seems to be that you can't initiate dialog window "B" from the handler function of dialog "A". So, how can you programmatically launch a second dialog window after the user hits the "OK" button on the first ? (I had tried to create an additional Listener for a field that is updated in dialog "A" to trigger dialog "B" but this doesn't work either.) Thanks..

  Read the article

• Animation issue caused by C# parameters passed by reference rather than value, but where?

  - by Jordan Roher

  I'm having trouble with sprite animation in XNA that appears to be caused by a struct passed as a reference value. But I'm not using the ref keyword anywhere. I am, admittedly, a C# noob, so there may be some shallow bonehead error in here, but I can't see it. I'm creating 10 ants or bees and animating them as they move across the screen. I have an array of animation structs, and each time I create an ant or bee, I send it the animation array value it requires (just [0] or [1] at this time). Deep inside the animation struct is a timer that is used to change frames. The ant/bee class stores the animation struct as a private variable. What I'm seeing is that each ant or bee uses the same animation struct, the one I thought I was passing in and copying by value. So during Update(), when I advance the animation timer for each ant/bee, the next ant/bee has its animation timer advanced by that small amount. If there's 1 ant on screen, it animates properly. 2 ants, it runs twice as fast, and so on. Obviously, not what I want. Here's an abridged version of the code. How is BerryPicking's ActorAnimationGroupData[] getting shared between the BerryCreatures? class BerryPicking { private ActorAnimationGroupData[] animations; private BerryCreature[] creatures; private Dictionary<string, Texture2D> creatureTextures; private const int maxCreatures = 5; public BerryPickingExample() { this.creatures = new BerryCreature[maxCreatures]; this.creatureTextures = new Dictionary<string, Texture2D>(); } public void LoadContent() { // Returns data from an XML file Reader reader = new Reader(); animations = reader.LoadAnimations(); CreateCreatures(); } // This is called from another function I'm not including because it's not relevant to the problem. // In it, I remove any creature that passes outside the viewport by setting its creatures[] spot to null. // Hence the if(creatures[i] == null) test is used to recreate "dead" creatures. Inelegant, I know. private void CreateCreatures() { for (int i = 0; i < creatures.Length; i++) { if (creatures[i] == null) { // In reality, the name selection is randomized creatures[i] = new BerryCreature("ant"); // Load content and texture (which I create elsewhere) creatures[i].LoadContent( FindAnimation(creatures[i].Name), creatureTextures[creatures[i].Name]); } } } private ActorAnimationGroupData FindAnimation(string animationName) { int yourAnimation = -1; for (int i = 0; i < animations.Length; i++) { if (animations[i].name == animationName) { yourAnimation = i; break; } } return animations[yourAnimation]; } public void Update(GameTime gameTime) { for (int i = 0; i < creatures.Length; i++) { creatures[i].Update(gameTime); } } } class Reader { public ActorAnimationGroupData[] LoadAnimations() { ActorAnimationGroupData[] animationGroup; XmlReader file = new XmlTextReader(filename); // Do loading... // Then later file.Close(); return animationGroup; } } class BerryCreature { private ActorAnimation animation; private string name; public BerryCreature(string name) { this.name = name; } public void LoadContent(ActorAnimationGroupData animationData, Texture2D sprite) { animation = new ActorAnimation(animationData); animation.LoadContent(sprite); } public void Update(GameTime gameTime) { animation.Update(gameTime); } } class ActorAnimation { private ActorAnimationGroupData animation; public ActorAnimation(ActorAnimationGroupData animation) { this.animation = animation; } public void LoadContent(Texture2D sprite) { this.sprite = sprite; } public void Update(GameTime gameTime) { animation.Update(gameTime); } } struct ActorAnimationGroupData { // There are lots of other members of this struct, but the timer is the only one I'm worried about. // TimerData is another struct private TimerData timer; public ActorAnimationGroupData() { timer = new TimerData(2); } public void Update(GameTime gameTime) { timer.Update(gameTime); } } struct TimerData { public float currentTime; public float maxTime; public TimerData(float maxTime) { this.currentTime = 0; this.maxTime = maxTime; } public void Update(GameTime gameTime) { currentTime += (float)gameTime.ElapsedGameTime.TotalSeconds; if (currentTime >= maxTime) { currentTime = maxTime; } } }

  Read the article

• Call functions in an event/function chain?

  - by acidzombie24

  I have 3 functions. They can be called in any order (later they may need specific order). The return value of one function should be the first param of the next. How do i do this? what i am thinking is something like the below. Whats the best way to do this? string void fn(string sz, data d, eventhdl nextFunc) { //do stuff if(nextFunc == null) return ret; else return nextFunc(ret, d, nextFunc.Next); }

  Read the article

• How to find 3rd max value of a column using MAX function in sql server?

  - by Pandiya Chendur

  Yesterday i had a question in an interview which i thought i could find answers here in SO... How to find 3rd max value of a column using MAX function in sql server? Consider the column to be Wages 20000 15000 10000 45000 50000

  Read the article

• What is the value of NULL in SQL Server ?

  - by Anish

  Hi, I know NULL is not zero... nor it is empty string. But then what is the value of NULL... which the system keeps, to identify it?

  Read the article

• Does Ruby have a special stack for returning a value?

  - by prosseek

  The following Ruby code def a(b,c) b+c end is the same as follows with Python def a(b,c): return b+c It looks like that ruby has the special stack that stores the final evaluation result and returns the value when a function is called. If so, what's the name of the stack, and how can I get that stack? If not, how does the Ruby code work without returning something?

  Read the article

• Is there a C++ cross platform key/value API or library for C++?

  - by Tim

  We want to persist some user settings int he GUI part of our code. I used to do Win32 programming exclusively and the typical way this was done was with registry settings. I assume that this should be done with configuration files, but was wondering if there was a library or cross platform wrapper that made key/value pair persistence very easy.

  Read the article

• how to get last option value of a dropdownlist using c#?

  - by Ayyappan.Anbalagan

  consider my dropdownlist has, o select 1 hot 2 cold 3 warm i want to get warm (ie)get last option value of a dropdownlist using c#?

  Read the article

• Will my shared variables loose value? (asp.net vb)

  - by Phil

  I have a class includes.vb that holds some variables (sharing them with other pages) like: Public Shared pageid As Integer = 0 I then have a function that does some work with these variables returning them with values; Return pageid When I step through the code, the variables have values (while stepping through the function), but when they are returned to the page, they come back null. Do they loose value everytime a page is loaded? Can you suggest an alternative method? Thanks a lot.

  Read the article

• Does Ruby have a special stack for return value?

  - by prosseek

  The following Ruby code def a(b,c) b+c end is the same as follows with Python def a(b,c): return b+c It looks like that ruby has the special stack that stores the final evaluation result and returns the value when a function is called. If so, what's the name of the stack, and how can I get that stack? If not, how does the Ruby code work without returning something?

  Read the article

• Is there a way to get the end value of an animation in jQuery?

  - by George Edison

  I have a script that animates an element as follows: var item_height = $('#item').height(); $('#item').height(0); $('#item').animate({ height: item_height }); Now suppose the animation needs to be stopped before it is complete: $('#item').stop(); How can I get the end value of the animation? (The total height of the element when the animation would have been complete)

  Read the article

• Change css property in chain - JavaScript

  - by SilverDeveloper

  I'm using MooTools 1.4.5 and I want to change cursor before calling function that takes some time and after finished same function set cursor to default. I was not successful. After that I made simple example to change background color via plain JavaScript (no jQuery or MooTools plugin) and again I was not successful. Here is my code. <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div> </div> </form> </body> <script type="text/javascript"> <!-- document.body.style.background = 'red'; setTimeout(function () { }, 1250); document.body.style.background = 'yellow'; //--> </script> </html> First at all I set background color to red, and after delay to yellow. I assumed that the background color will bi set to red and after delay to yellow. It doesn't work. When page is loaded background color is yellow (last line). If I insert alert function in a middle of lines where sets background color everything works fine (background color is red, click to message box, background color is yellow). Why it works so? Only last changing style is affected. I need something like that to change pointer before calling function that takes 10 seconds and setting cursor to default value after function is done.

  Read the article

• Problems in Binary Search Tree

  - by user2782324

  This is my first ever trial at implementing the BST, and I am unable to get it done. Please help The problem is that When I delete the node if the node is in the right subtree from the root or if its a right child in the left subtree, then it works fine. But if the node is in the left subtree from root and its any left child, then it does not get deleted. Can someone show me what mistake am I doing?? the markedNode here gets allocated to the parent node of the node to be deleted. the minValueNode here gets allocated to a node whose left value child is the smallest value and it will be used to replace the value to be deleted. package DataStructures; class Node { int value; Node rightNode; Node leftNode; } class BST { Node rootOfTree = null; public void insertintoBST(int value) { Node markedNode = rootOfTree; if (rootOfTree == null) { Node newNode = new Node(); newNode.value = value; rootOfTree = newNode; newNode.rightNode = null; newNode.leftNode = null; } else { while (true) { if (value >= markedNode.value) { if (markedNode.rightNode != null) { markedNode = markedNode.rightNode; } else { Node newNode = new Node(); newNode.value = value; markedNode.rightNode = newNode; newNode.rightNode = null; newNode.leftNode = null; break; } } if (value < markedNode.value) { if (markedNode.leftNode != null) { markedNode = markedNode.leftNode; } else { Node newNode = new Node(); newNode.value = value; markedNode.leftNode = newNode; newNode.rightNode = null; newNode.leftNode = null; break; } } } } } public void searchBST(int value) { Node markedNode = rootOfTree; if (rootOfTree == null) { System.out.println("Element Not Found"); } else { while (true) { if (value > markedNode.value) { if (markedNode.rightNode != null) { markedNode = markedNode.rightNode; } else { System.out.println("Element Not Found"); break; } } if (value < markedNode.value) { if (markedNode.leftNode != null) { markedNode = markedNode.leftNode; } else { System.out.println("Element Not Found"); break; } } if (value == markedNode.value) { System.out.println("Element Found"); break; } } } } public void deleteFromBST(int value) { Node markedNode = rootOfTree; Node minValueNode = null; if (rootOfTree == null) { System.out.println("Element Not Found"); return; } if (rootOfTree.value == value) { if (rootOfTree.leftNode == null && rootOfTree.rightNode == null) { rootOfTree = null; return; } else if (rootOfTree.leftNode == null ^ rootOfTree.rightNode == null) { if (rootOfTree.rightNode != null) { rootOfTree = rootOfTree.rightNode; return; } else { rootOfTree = rootOfTree.leftNode; return; } } else { minValueNode = rootOfTree.rightNode; if (minValueNode.leftNode == null) { rootOfTree.rightNode.leftNode = rootOfTree.leftNode; rootOfTree = rootOfTree.rightNode; } else { while (true) { if (minValueNode.leftNode.leftNode != null) { minValueNode = minValueNode.leftNode; } else { break; } } // Minvalue to the left of minvalue node rootOfTree.value = minValueNode.leftNode.value; // The value has been swapped if (minValueNode.leftNode.leftNode == null && minValueNode.leftNode.rightNode == null) { minValueNode.leftNode = null; } else { if (minValueNode.leftNode.leftNode != null) { minValueNode.leftNode = minValueNode.leftNode.leftNode; } else { minValueNode.leftNode = minValueNode.leftNode.rightNode; } // Minvalue deleted } } } } else { while (true) { if (value > markedNode.value) { if (markedNode.rightNode != null) { if (markedNode.rightNode.value == value) { break; } else { markedNode = markedNode.rightNode; } } else { System.out.println("Element Not Found"); return; } } if (value < markedNode.value) { if (markedNode.leftNode != null) { if (markedNode.leftNode.value == value) { break; } else { markedNode = markedNode.leftNode; } } else { System.out.println("Element Not Found"); return; } } } // Parent of the required element found // //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// if (markedNode.rightNode != null) { if (markedNode.rightNode.value == value) { if (markedNode.rightNode.rightNode == null && markedNode.rightNode.leftNode == null) { markedNode.rightNode = null; return; } else if (markedNode.rightNode.rightNode == null ^ markedNode.rightNode.leftNode == null) { if (markedNode.rightNode.rightNode != null) { markedNode.rightNode = markedNode.rightNode.rightNode; return; } else { markedNode.rightNode = markedNode.rightNode.leftNode; return; } } else { if (markedNode.rightNode.value == value) { minValueNode = markedNode.rightNode.rightNode; } else { minValueNode = markedNode.leftNode.rightNode; } if (minValueNode.leftNode == null) { // MinNode has no left value markedNode.rightNode = minValueNode; return; } else { while (true) { if (minValueNode.leftNode.leftNode != null) { minValueNode = minValueNode.leftNode; } else { break; } } // Minvalue to the left of minvalue node if (markedNode.leftNode != null) { if (markedNode.leftNode.value == value) { markedNode.leftNode.value = minValueNode.leftNode.value; } } if (markedNode.rightNode != null) { if (markedNode.rightNode.value == value) { markedNode.rightNode.value = minValueNode.leftNode.value; } } // MarkedNode exchanged if (minValueNode.leftNode.leftNode == null && minValueNode.leftNode.rightNode == null) { minValueNode.leftNode = null; } else { if (minValueNode.leftNode.leftNode != null) { minValueNode.leftNode = minValueNode.leftNode.leftNode; } else { minValueNode.leftNode = minValueNode.leftNode.rightNode; } // Minvalue deleted } } } // //////////////////////////////////////////////////////////////////////////////////////////////////////////////// if (markedNode.leftNode != null) { if (markedNode.leftNode.value == value) { if (markedNode.leftNode.rightNode == null && markedNode.leftNode.leftNode == null) { markedNode.leftNode = null; return; } else if (markedNode.leftNode.rightNode == null ^ markedNode.leftNode.leftNode == null) { if (markedNode.leftNode.rightNode != null) { markedNode.leftNode = markedNode.leftNode.rightNode; return; } else { markedNode.leftNode = markedNode.leftNode.leftNode; return; } } else { if (markedNode.rightNode.value == value) { minValueNode = markedNode.rightNode.rightNode; } else { minValueNode = markedNode.leftNode.rightNode; } if (minValueNode.leftNode == null) { // MinNode has no left value markedNode.leftNode = minValueNode; return; } else { while (true) { if (minValueNode.leftNode.leftNode != null) { minValueNode = minValueNode.leftNode; } else { break; } } // Minvalue to the left of minvalue node if (markedNode.leftNode != null) { if (markedNode.leftNode.value == value) { markedNode.leftNode.value = minValueNode.leftNode.value; } } if (markedNode.rightNode != null) { if (markedNode.rightNode.value == value) { markedNode.rightNode.value = minValueNode.leftNode.value; } } // MarkedNode exchanged if (minValueNode.leftNode.leftNode == null && minValueNode.leftNode.rightNode == null) { minValueNode.leftNode = null; } else { if (minValueNode.leftNode.leftNode != null) { minValueNode.leftNode = minValueNode.leftNode.leftNode; } else { minValueNode.leftNode = minValueNode.leftNode.rightNode; } // Minvalue deleted } } } } // //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// } } } } } } public class BSTImplementation { public static void main(String[] args) { BST newBst = new BST(); newBst.insertintoBST(19); newBst.insertintoBST(13); newBst.insertintoBST(10); newBst.insertintoBST(20); newBst.insertintoBST(5); newBst.insertintoBST(23); newBst.insertintoBST(28); newBst.insertintoBST(16); newBst.insertintoBST(27); newBst.insertintoBST(9); newBst.insertintoBST(4); newBst.insertintoBST(22); newBst.insertintoBST(17); newBst.insertintoBST(30); newBst.insertintoBST(40); newBst.deleteFromBST(5); newBst.deleteFromBST(4); newBst.deleteFromBST(9); newBst.deleteFromBST(10); newBst.deleteFromBST(13); newBst.deleteFromBST(16); newBst.deleteFromBST(17); newBst.searchBST(5); newBst.searchBST(4); newBst.searchBST(9); newBst.searchBST(10); newBst.searchBST(13); newBst.searchBST(16); newBst.searchBST(17); System.out.println(); newBst.deleteFromBST(20); newBst.deleteFromBST(23); newBst.deleteFromBST(27); newBst.deleteFromBST(28); newBst.deleteFromBST(30); newBst.deleteFromBST(40); newBst.searchBST(20); newBst.searchBST(23); newBst.searchBST(27); newBst.searchBST(28); newBst.searchBST(30); newBst.searchBST(40); } }

  Read the article

• SQL SERVER – Storing 64-bit Unsigned Integer Value in Database

  - by Pinal Dave

  Here is a very interesting question I received in an email just another day. Some questions just are so good that it makes me wonder how come I have not faced it first hand. Anyway here is the question - “Pinal, I am migrating my database from MySQL to SQL Server and I have faced unique situation. I have been using Unsigned 64-bit integer in MySQL but when I try to migrate that column to SQL Server, I am facing an issue as there is no datatype which I find appropriate for my column. It is now too late to change the datatype and I need immediate solution. One chain of thought was to change the data type of the column from Unsigned 64-bit (BIGINT) to VARCHAR(n) but that will just change the data type for me such that I will face quite a lot of performance related issues in future. In SQL Server we also have the BIGINT data type but that is Signed 64-bit datatype. BIGINT datatype in SQL Server have range of -2^63 (-9,223,372,036,854,775,808) to 2^63-1 (9,223,372,036,854,775,807). However, my digit is much larger than this number. Is there anyway, I can store my big 64-bit Unsigned Integer without loosing much of the performance of by converting it to VARCHAR.” Very interesting question, for the sake of the argument, we can ask user that there should be no need of such a big number or if you are taking about identity column I really doubt that if your table will grow beyond this table. Here the real question which I found interesting was how to store 64-bit unsigned integer value in SQL Server without converting it to String data type. After thinking a bit, I found a fairly simple answer. I can use NUMERIC data type. I can use NUMERIC(20) datatype for 64-bit unsigned integer value, NUMERIC(10) datatype for 32-bit unsigned integer value and NUMERIC(5) datatype for 16-bit unsigned integer value. Numeric datatype supports 38 maximum of 38 precision. Now here is another thing to keep in mind. Using NUMERIC datatype will indeed accept the 64-bit unsigned integer but in future if you try to enter negative value, it will also allow the same. Hence, you will need to put any additional constraint over column to only accept positive integer there. Here is another big concern, SQL Server will store the number as numeric and will treat that as a positive integer for all the practical purpose. You will have to write in your application logic to interpret that as a 64-bit Unsigned Integer. On another side if you are using unsigned integers in your application, there are good chance that you already have logic taking care of the same. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology Tagged: SQL Datatype

  Read the article

• SQL: empty string vs NULL value

  - by Jacek Prucia

  I know this subject is a bit controversial and there are a lot of various articles/opinions floating around the internet. Unfortunatelly, most of them assume the person doesn't know what the difference between NULL and empty string is. So they tell stories about surprising results with joins/aggregates and generally do a bit more advanced SQL lessons. By doing this, they absolutely miss the whole point and are therefore useless for me. So hopefully this question and all answers will move subject a bit forward. Let's suppose I have a table with personal information (name, birth, etc) where one of the columns is an email address with varchar type. We assume that for some reason some people might not want to provide an email address. When inserting such data (without email) into the table, there are two available choices: set cell to NULL or set it to empty string (''). Let's assume that I'm aware of all the technical implications of choosing one solution over another and I can create correct SQL queries for either scenario. The problem is even when both values differ on the technical level, they are exactly the same on logical level. After looking at NULL and '' I came to a single conclusion: I don't know email address of the guy. Also no matter how hard i tried, I was not able to sent an e-mail using either NULL or empty string, so apparently most SMTP servers out there agree with my logic. So i tend to use NULL where i don't know the value and consider empty string a bad thing. After some intense discussions with colleagues i came with two questions: am I right in assuming that using empty string for an unknown value is causing a database to "lie" about the facts? To be more precise: using SQL's idea of what is value and what is not, I might come to conclusion: we have e-mail address, just by finding out it is not null. But then later on, when trying to send e-mail I'll come to contradictory conclusion: no, we don't have e-mail address, that @!#$ Database must have been lying! Is there any logical scenario in which an empty string '' could be such a good carrier of important information (besides value and no value), which would be troublesome/inefficient to store by any other way (like additional column). I've seen many posts claiming that sometimes it's good to use empty string along with real values and NULLs, but so far haven't seen a scenario that would be logical (in terms of SQL/DB design). P.S. Some people will be tempted to answer, that it is just a matter of personal taste. I don't agree. To me it is a design decision with important consequences. So i'd like to see answers where opion about this is backed by some logical and/or technical reasons.

  Read the article

• Enum types, FlagAttribute & Zero value

  - by nmgomes

  We all know about Enums types and use them every single day. What is not that often used is to decorate the Enum type with the FlagsAttribute. When an Enum type has the FlagsAttribute we can assign multiple values to it and thus combine multiple information into a single enum. The enum values should be a power of two so that a bit set is achieved. Here is a typical Enum type: public enum OperationMode { /// <summary> /// No operation mode /// </summary> None = 0, /// <summary> /// Standard operation mode /// </summary> Standard = 1, /// <summary> /// Accept bubble requests mode /// </summary> Parent = 2 } In such scenario no values combination are possible. In the following scenario a default operation mode exists and combination is used: [Flags] public enum OperationMode { /// <summary> /// Asynchronous operation mode /// </summary> Async = 0, /// <summary> /// Synchronous operation mode /// </summary> Sync = 1, /// <summary> /// Accept bubble requests mode /// </summary> Parent = 2 } Now, it’s possible to do statements like: [DefaultValue(OperationMode.Async)] [TypeConverter(typeof(EnumConverter))] public OperationMode Mode { get; set; } /// <summary> /// Gets a value indicating whether this instance supports request from childrens. /// </summary> public bool IsParent { get { return (this.Mode & OperationMode.Parent) == OperationMode.Parent; } } or switch (this.Mode) { case OperationMode.Sync | OperationMode.Parent: Console.WriteLine("Sync,Parent"); break;[…]  But there is something that you should never forget: Zero is the absorber element for the bitwise AND operation. So, checking for OperationMode.Async (the Zero value) mode just like the OperationMode.Parent mode makes no sense since it will always be true: (this.Mode & 0x0) == 0x0 Instead, inverse logic should be used: OperationMode.Async = !OperationMode.Sync public bool IsAsync { get { return (this.Mode & ContentManagerOperationMode.Sync) != ContentManagerOperationMode.Sync; } } or public bool IsAsync { get { return (int)this.Mode == 0; } } Final Note: Benefits Allow multiple values combination The above samples snippets were taken from an ASP.NET control and enabled the following markup usage: <my:Control runat="server" Mode="Sync,Parent"> Drawback Zero value is the absorber element for the bitwise AND operation Be very carefully when evaluating the Zero value, either evaluate the enum value as an integer or use inverse logic.

  Read the article

• Interesting things – Twitter annotations and your phone as a web server

  - by jamiet

  I overheard/read a couple of things today that really made me, data junkie that I am, take a step back and think, “Hmmm, yeah, that could be really interesting” and I wanted to make a note of them here so that (a) I could bring them to the attention of anyone that happens to read this and (b) I can maybe come back here in a few years and see if either of these have come to fruition. Your phone as a web server While listening to Jon Udell’s (twitter) “Interviews with Innovators Podcast” today in which he interviewed Herbert Van de Sompel (twitter) about his Momento project. During the interview Jon and Herbert made the following remarks: Jon: [some people] really had this vision of a web of servers, the notion that every node on the internet, every connected entity, is potentially a server and a client…we can see where we’re getting to a point where these endpoint devices we have in our pockets are going to be massively capable and it may be in the not too distant future that significant chunks of the web archive will be cached all over the place including on your own machine… Herbert: wasn’t it Opera who at one point turned your browser into a server? That really got my brain ticking. We all carry a mobile phone with us and therefore we all potentially carry a mobile web server with us as well and to my mind the only thing really stopping that from happening is the capabilities of the phone hardware, the capabilities of the network infrastructure and the will to just bloody do it. Certainly all the standards required for addressing a web server on a phone already exist (to this uninitiated observer DNS and IPv6 seem to solve that problem) so why not? I tweeted about the idea and Rory Street answered back with “why would you want a phone to be a web server?”: Its a fair question and one that I would like to try and answer. Mobile phones are increasingly becoming our window onto the world as we use them to upload messages to Twitter, record our location on FourSquare or interact with our friends on Facebook but in each of these cases some other service is acting as our intermediary; to see what I’m thinking you have to go via Twitter, to see where I am you have to go to FourSquare (I’m using ‘I’ liberally, I don’t actually use FourSquare before you ask). Why should this have to be the case? Why can’t that data be decentralised? Why can’t we be masters of our own data universe? If my phone acted as a web server then I could expose all of that information without needing those intermediary services. I see a time when we can pass around URLs such as the following: http://jamiesphone.net/location/current - Where is Jamie right now? http://jamiesphone.net/location/2010-04-21 – Where was Jamie on 21st April 2010? http://jamiesphone.net/thoughts/current – What’s on Jamie’s mind right now? http://jamiesphone.net/blog – What documents is Jamie sharing with me? http://jamiesphone.net/calendar/next7days – Where is Jamie planning to be over the next 7 days? and those URLs get served off of the phone in our pockets. If we govern that data then we can control who has access to it and (crucially) how long its available for. Want to wipe yourself off the face of the web? its pretty easy if you’re in control of all the data – just turn your phone off. None of this exists today but I look forward to a time when it does. Opera really were onto something last June when they announced Opera Unite (admittedly Unite only works because Opera provide an intermediary DNS-alike system – it isn’t totally decentralised). Opening up Twitter annotations Last week Twitter held their first developer conference called Chirp where they announced an upcoming new feature called ‘Twitter Annotations’; in short this will allow us to attach metadata to a Tweet thus enhancing the tweet itself. Think of it as a richer version of hashtags. To think of it another way Twitter are turning their data into a humongous Entity-Attribute-Value or triple-tuple store. That alone has huge implications both for the web and Twitter as a whole – the ability to enrich that 140 characters data and thus make it more useful is indeed compelling however today I stumbled upon a blog post from Eugene Mandel entitled Tweet Annotations – a Way to a Metadata Marketplace? where he proposed the idea of allowing tweets to have metadata added by people other than the person who tweeted the original tweet. This idea really fascinated me especially when I read some of the potential uses that Eugene and his commenters suggested. They included: Amazon could attach an ISBN to a tweet that mentions a book. Specialist clients apps for book lovers could be built up around this metadata. Advertisers could pay to place adverts in metadata. The revenue generated from those adverts could be shared with the tweeter or people who add the metadata. Granted, allowing anyone to add metadata to a tweet has the potential to create a spam problem the like of which we haven’t even envisaged but spam hasn’t halted the growth of the web and neither should it halt the growth of data annotations either. The original tweeter should of course be able to determine who can add metadata and whether it should be moderated. As Eugene says himself: Opening publishing tweet annotations to anyone will open the way to a marketplace of metadata where client developers, data mining companies and advertisers can add new meaning to Twitter and build innovative businesses. What Eugene and his followers did not mention is what I think is potentially the most fascinating use of opening up annotations. Google’s success today is built on their page rank algorithm that measures the validity of a web page by the number of incoming links to it and the page rank of the sites containing those links – its a system built on reputation. Twitter annotations could open up a new paradigm however – let’s call it People rank- where reputation can be measured by the metadata that people choose to apply to links and the websites containing those links. Its not hard to see why Google and Microsoft have paid big bucks to get access to the Twitter firehose! Neither of these features, phones as a web server or the ability to add annotations to other people’s tweets, exist today but I strongly believe that they could dramatically enhance the web as we know it today. I hope to look back on this blog post in a few years in the knowledge that these ideas have been put into place. @Jamiet Share this post: email it! | bookmark it! | digg it! | reddit! | kick it! | live it!

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Ti sei perso l'Oracle EPM Live Webcast sul Project Planning? Ora puoi rivederlo

  - by antonella.buonagurio

  Se non hai potuto seguire l'ultimo webcast EPM dedicato al Project Planning puoi rivederlo a questo link. Il webcast, che fa parte di una serie di live webseminar  dedicati ai professionisti dell'area amministrazione finanza e controllo, è focalizzato sul processo di budgeting, forecasting e controllo di gestione per commessa e delle attività a progetto in ambito economico-finanziario. Durante il webseminar viene presentata  l'integrazione funzionale di Oracle Hyperion EPM System con le altre soluzioni Oracle per il project planning & management. Non perdere l'ultimo appuntamento prima delle vacanze! 13 luglio Oracle EPM Live webcast:  Predictive Planning clicca qui per saperne di più!

  Read the article

< Previous Page | 20 21 22 23 24 25 26 27 28 29 30 31  | Next Page >