Search Results

Search found 19953 results on 799 pages for 'post get'.

Page 244/799 | < Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >

  • Problem retrieving values from Zend_Form_SubForms - no values returned

    - by anu iyer
    I have a Zend_Form that has 4 or more subforms. /** Code Snippet **/ $bigForm = new Zend_Form(); $littleForm1 = new Form_LittleForm1(); $littleForm1->setMethod('post'); $littleForm2 = new Form_LittleForm2(); $littleForm2->setMethod('post'); $bigForm->addSubForm($littleForm1,'littleForm1',0); $bigForm->addSubForm($littleForm2,'littleForm2',0); On clicking the 'submit' button, I'm trying to print out the values entered into the forms, like so: /** Code snippet, currently not validating, just printing **/ if($this-_request-getPost()){ $formData = array(); foreach($bigForm->getSubForms() as $subForm){ $formData = array_merge($formData, $subForm->getValues()); } /* Testing */ echo "<pre>"; print_r($formData); echo "</pre>"; } The end result is that - all the elements in the form do get printed, but the values entered before posting the form don't get printed. Any thoughts are appreciated...I have run around circles working on this! Thanks in advance!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Optimized Publish/Subcribe JMS Broker Cluster and Conflicting Posts on StackOverFlow for the Answer

    - by Gene
    Hi, I am looking to build a publish/subscribe distributed messaging framework that can manage huge volumes of message traffic with some intelligence at the broker level. I don't know if there's a topology that describes this, but this is the model I'm going after: EXAMPLE MODEL A A) There are two running message brokers (ideally all on localhost if possible, for easier demo-ing) : Broker-A Broker-B B) Each broker will have 2 listeners and 1 publisher. Example Figure [subscriber A1, subscriber A2, publisher A1] <-- BrokerA <-- BrokerB <-- [publisher B1, subscriber B1, subscriber B2] IF a message-X is published to broker A and there no subscribers for it among the listeners on Broker-B (via criteria in Message Selectors or Broker routing rules), then that message-X will never be published to Broker-B. ELSE, broker A will publish the message to broker B, where one of the broker B listeners/subscribers/services is expecting that message based on the subscription criteria. Is Clustering the Correct Approach? At first, I concluded that the "Broker Clustering" concept is what I needed to support this. However, as I have come to understand it, the typical use of clustering entails either: message redundancy across all brokers ... or Competing Consumers pattern ... and neither of these satisfy the requirement in the EXAMPLE MODEL A. What is the Correct Approach? My question is, does anyone know of a JMS implementation that supports the model I described? I scanned through all the stackoverflow post titles for the search: JMS and Cluster. I found these two informative, but seemingly conflicting posts: Says the EXAMPLE MODEL A is/should-be implicitly supported: http://stackoverflow.com/questions/2255816/jms-consumer-with-activemq-network-of-brokers " this means you pick a broker, connect to it, and let the broker network sort it out amongst themselves. In theory." Says the EXAMPLE MODEL A IS NOT suported: http://stackoverflow.com/questions/2017520/how-does-a-jms-topic-subscriber-in-a-clustered-application-server-recieve-message "All the instances of PropertiesSubscriber running on different app servers WILL get that message." Any suggestions would be greatly appreciated. Thanks very much for reading my post, Gene

    Read the article

  • Using embedded standard HTML forms with ASP.NET

    - by RM
    I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

    Read the article

  • Django QuerySet API: How do I join iexact and icontains?

    - by Zeynel
    Hello, I have this join: lawyers = Lawyer.objects.filter(last__iexact=last_name).filter(first__icontains=first_name) This is the site If you try Last Name: Abbas and First Name: Amr it tells you that amr abbas has 1 schoolmates. But if you try First name only it says that there are no lawyers in the database called amr (obviously there is). If I change (last__iexact=last_name) to (last__icontains=last_name) then leaving Last Name blank works fine and amr is found. But with last__icontains=last_name if you search for "collin" you also get "collins" and "collingwood" which is not what I want. Do you know how I can use iexact and also have it ignored if it is blank? Thanks This is the view function: def search_form(request): if request.method == 'POST': search_form = SearchForm(request.POST) if search_form.is_valid(): last_name = search_form.cleaned_data['last_name'] first_name = search_form.cleaned_data['first_name'] lawyers = Lawyer.objects.filter(last__iexact=last_name).filter(first__icontains=first_name) if len(lawyers)==0: form = SearchForm() return render_to_response('not_in_database.html', {'last': last_name, 'first': first_name, 'form': form}) if len(lawyers)>1: form = SearchForm(initial={'last_name': last_name}) return render_to_response('more_than_1_match.html', {'lawyers': lawyers, 'last': last_name, 'first': first_name, 'form': form}) q_school = Lawyer.objects.filter(last__icontains=last_name).filter(first__icontains=first_name).values_list('school', flat=True) q_year = Lawyer.objects.filter(last__icontains=last_name).filter(first__icontains=first_name).values_list('year_graduated', flat=True) lawyers1 = Lawyer.objects.filter(school__iexact=q_school[0]).filter(year_graduated__icontains=q_year[0]).exclude(last__icontains=last_name) form = SearchForm() return render_to_response('search_results.html', {'lawyers': lawyers1, 'last': last_name, 'first': first_name, 'form': form}) else: form = SearchForm() return render_to_response('search_form.html', {'form': form, })

    Read the article

  • JsonParseException on Valid JSON

    - by user2909602
    I am having an issue calling a RESTful service from my client code. I have written the RESTful service using CXF/Jackson, deployed to localhost, and tested using RESTClient successfully. Below is a snippet of the service code: @POST @Produces("application/json") @Consumes("application/json") @Path("/set/mood") public Response setMood(MoodMeter mm) { this.getMmDAO().insert(mm); return Response.ok().entity(mm).build(); } The model class and dao work successfully and the service itself works fine using RESTClient. However, when I attempt to call this service from Java Script, I get the error below on the server side: Caused by: org.codehaus.jackson.JsonParseException: Unexpected character ('m' (code 109)): expected a valid value (number, String, array, object, 'true', 'false' or 'null') I have copied the client side code below. To make sure it has nothing to do with the JSON data itself, I used a valid JSON string (which works using RESTClient, JSON.parse() method, and JSONLint) in the vars 'json' (string) and 'jsonData' (JSON). Below is the Java Script code: var json = '{"mood_value":8,"mood_comments":"new comments","user_id":5,"point":{"latitude":37.292929,"longitude":38.0323323},"created_dtm":1381546869260}'; var jsonData = JSON.parse(json); $.ajax({ url: 'http://localhost:8080/moodmeter/app/service/set/mood', dataType: 'json', data: jsonData, type: "POST", contentType: "application/json" }); I've seen the JsonParseException a number of times on other threads, but in this case the JSON itself appears to be valid (and tested). Any thoughts are appreciated.

    Read the article

  • Non RBAC User Roles and Permissions System: checking the user's City

    - by micha12
    We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • How does overlayViewTouched notification work in the MoviePlayer sample code

    - by Jonathan
    Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

    Read the article

  • RedirectToAction and validate MVC 2

    - by Dan
    Hi, my problem is the View where the user typed, the validation. I have to take RedirectToAction on the site because on the site upload a file. Thats my code. My model class public class Person { [Required(ErrorMessage= "Please enter name")] public string name { get; set; } } My View <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage<MvcWebRole1.Models.Person>" %> Name <h2>Information Data</h2> <%= Html.ValidationSummary() %> <%using (Html.BeginForm ("upload","Home", FormMethod.Post, new{ enctype ="multipart/form-data" })) {%> <fieldset> <legend>Fields</legend> <p> <label for="name">name:</label> <%= Html.TextBox("name") %> <%= Html.ValidationMessage("name", "*") %> </p> </fieldset> <% } %> and the Controller [AcceptVerbs(HttpVerbs.Post)] public ActionResult upload(FormCollection form) { Person lastname = new Person(); lastname.name = form["name"]; return RedirectToAction("Index"); } Thx for answer my question In advance

    Read the article

  • Cannot get a session with Facebook app? (using its Graph API)

    - by Jian Lin
    I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

    Read the article

  • How can I attach a file using Wordpress custom fields / meta boxes?

    - by shipshape
    I am using Wordpress's add_meta_box() function to add customized meta fields to the Add New Post page, like this. I want one of these fields to allow the user to upload a file, so that a single image, pdf, audio file, or video can be associated with the post. The closest example I've seen is this one. Unfortunately it does not suit my needs, as I want my file to be processed by Wordpress's Media Uploader - so it should appear in the Media Library afterwards, and thumbnails should be generated according to the Media settings. I think ideally there would be a way to tap into Wordpress's existing Add Media dialog, and simply output the URL of the uploaded file into a text box, but I don't see how to do that. This question is similar, but the answers are a little clunky - I would like to keep this super simple for my end users. How can I accomplish this? Please do not recommend plugins such as Flutter or Magic Fields - I have tried these and they do not suit my purposes (I want the images to be processed by Wordpress's Media Uploader). I am using Wordpress 3.0-alpha. Thanks!

    Read the article

  • Fork or copy a users browser session in IE

    - by jmoeller
    Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

    Read the article

  • Prototype's Ajax.Updater not actually updating on IE7.

    - by Ben S
    I am trying to submit a form using Ajax.Updater and have the result of that update a div element in my page. Everything works great in IE6, FF3, Chrome and Opera. However, In IE7 it sporadically works, but more often than not, it just doesn't seem to do anything. Here's the javascript: function testcaseHistoryUpdate(testcase, form) { document.body.style.cursor = 'wait'; var param = Form.serialize(form); new Ajax.Updater("content", "results/testcaseHistory/" + testcase, { onComplete: function(transport) {document.body.style.cursor = 'auto'}, parameters: param, method: 'post' } ); } I've verified using alert() calls that param is set to what I expect. I've read in many places that IE7 caches aggressively and that it might be the root cause, however every after adding the following to my php response, it still doesn't work. header("Last-Modified: " . gmdate("D, d M Y H:i:s") . " GMT"); header("Cache-Control: no-store, no-cache, must-revalidate"); header("Cache-Control: post-check=0, pre-check=0", false); header("Pragma: no-cache"); To further try to fix a caching issue I've tried adding a bogus parameter which just gets filled with a random value to have different parameters for every call, but that didn't help. I've also found this, where UTF-8 seemed to be causing an issue with IE7, but my page is clearly marked: <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> Does anyone have any idea what could be wrong with IE7 as opposed to the other browsers I tested to cause this kind of issue?

    Read the article

  • How do I debug a HTTP 502 error?

    - by Bialecki
    I have a Python Tornado server sitting behind a nginx frontend. Every now and then, but not every time, I get a 502 error. I look in the nginx access log and I see this: 127.0.0.1 - - [02/Jun/2010:18:04:02 -0400] "POST /a/question/updates HTTP/1.1" 502 173 "http://localhost/tagged/python" "Mozilla/5.0 (X11; U; Linux i686; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3" and in the error log: 2010/06/02 18:04:02 [error] 14033#0: *1700 connect() failed (111: Connection refused) while connecting to upstream, client: 127.0.0.1, server: _, request: "POST /a/question/updates HTTP/1.1", upstream: "http://127.0.0.1:8888/a/question/updates", host: "localhost", referrer: "http://localhost/tagged/python" I don't think any errors show up in the Tornado log. How would you go about debugging this? Is there something I can put in the Tornado or nginx configuration to help debug this? EDIT: In addition, I get a fair number of 504, gateway timeout errors. Is it possible that the Tornado instance is just busy or something?

    Read the article

  • Posting XML form data to a RESTful Server with Javascript or PHP

    - by pjs-worker
    Hi folks, I've been given the task of posting to a RESTful server. I'm new to the official "REST" but I've played with the concept before. However, this time I have an XML Payload example file that I am supposed to post. I'm struggling to figure out how the two relate. Can you help? Right now I can post to a specific site, say www.pcpost.com/schema/Application I can generate the URL for the inital, ie: postApplication?userid=4&... Being relatively new to web programming, I find that don't know how to take the following and interface it with the server. I'm at least familiar with Javascript and PHP. If this is impossible with those two types, I can learn whatever would be best. Thanks for your help on this. C <?xml version=\"1.0\" ?> <Application xmlns="http://www.pcpost.com/schema/Application" SchemaVersion="1.0" ProgramId="8" ApplicationDate="2009-08-29"> <Vendors> <Vendor Role="Applicant" Company="Test Company" Contact="Smith, John"/> <Vendor Role="Seller" Company="Test Company" Contact="Doe, Jane"/> <Vendor Role="Installer" Company="Test Company" Contact="Funk, Carl"/> </Vendors> <Participants> <Participant TaxStatus="Individual" Sector="Commercial"> <Roles> <Role>Host Customer</Role> </Roles> </Participants> </Application>

    Read the article

  • regular expression to remove original message from reply mail using in java ?

    - by ravi ravi
    In my forum, users can reply through email. I am handling mails from their reply. When they are replying the original message getting appended. I want to get only the reply message not the original message. I have to write regular expression for gmail & hotmail. I written regex for gmail as follows : \n.wrote:(?s).--End of Post-- It is removing the original message except date. I want to remove the date also. before removing the original message : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr wrote: The following update has been posted to this discussion: test as user 222 [$MESSAGE_SIGNATURE_HEADER$] --End of Post-- " When I use the above regex it is filtering as follows : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr " Here i want only the actual message 'hi 33' not that date. How can I filter the date using above regex? Also I need regex for Hotmail also. I appreciate for any reply. Thanks in advance.

    Read the article

  • Cucumber Error: Socket Error for Test Environment Host in REST API

    - by tmo256
    I posted this to the Cucumber group with no replies, which makes me wonder if this is actually a cucumber issue or not. I'm pretty new to cucumber, and there are a number of things I really don't quite understand about how the cucumber environment is set up and executed within the test environment. I have a REST API rails app I'm testing with cucumber, using the RestClient gem to generate a post to controller create action. When I run the feature with a hard-coded URL pointing to a running localhost server (my local dev server environment; replacing tickets_url with "http:// localhost/tickets" in the snippet below), my cucumber steps execute as expected. However, when the resource URL resolves to the cucumber host I'm declaring, I get a socket error exception. getaddrinfo: nodename nor servname provided, or not known (SocketError) From the steps file: When /^POS Adapter sends JSON data to the Tickets resource$/ do ticket = { :ticket = { ... } } host! "test.host" puts tickets_url RestClient.post tickets_url, ticket.to_json, :content_type = :json, :accepts = :json end (the "puts" statement prints "http://test.host/tickets") Using the following gems: cucumber-0.6.1 webrat-0.6.0 rest-client-1.2.0 I should also say I have a similar set up in another rails app, using test.host as my host, and it seems to work fine. I'd appreciate any insight on what I might be missing in my configuration or what this could be related to.

    Read the article

  • Use localeURL middleware with apache prefix

    - by Olivier R.
    Good morning everyone, I Got a question about localeURL usage. Everything works great for me with url like this : www.mysite.com/ If I type www.mysite.com/ in adress bar, it turns correctly in www.mysite.com/en/ for example. If I use the view change_locale, it's also all right (ie change www.mysite.com/en/ in www.mysite.com/fr/). But my application use apache as server, and use a prefix for the site, that gives url like this : www.mysite.com/prefix/ If I type www.mysite.com/prefix/ in the adress bar, the adress turns into www.mysite.com/en/ without prefix (so 404) I change code of view to manage our settings.SERVER_PREFIX value : def change_locale(request) : """ Redirect to a given url while changing the locale in the path The url and the locale code need to be specified in the request parameters. O. Rochaix; Taken from localeURL view, and tuned to manage : - SERVER_PREFIX from settings.py """ next = request.REQUEST.get('next', None) if not next: next = request.META.get('HTTP_REFERER', None) if not next: next = settings.SERVER_PREFIX + '/' next = urlsplit(next).path prefix = False if settings.SERVER_PREFIX!="" and next.startswith(settings.SERVER_PREFIX) : prefix = True next = "/" + next.lstrip(settings.SERVER_PREFIX) _, path = utils.strip_path (next) if request.method == 'POST': locale = request.POST.get('locale', None) if locale and check_for_language(locale): path = utils.locale_path(path, locale) if prefix : path = settings.SERVER_PREFIX + path response = http.HttpResponseRedirect(path) return response with this customized view, i'm able to correctly change language, but i'm not sure that's the right way of doing stuff. Is there any option on localeURL to manage prefix of apache ?

    Read the article

  • Django Cannot set values on a ManyToManyField which specifies an intermediary model

    - by dana
    i am using a m2m and a through table, and when i was trying to save, my error was: Cannot set values on a ManyToManyField which specifies an intermediary model so, i've modified my code, so that when i save the form, to insert data into the 'through' table too.But now, i'm having another error. (i've bolded the lines where i think i am wrong) i have in models.py: class Classroom(models.Model): user = models.ForeignKey(User, related_name = 'classroom_creator') classname = models.CharField(max_length=140, unique = True) date = models.DateTimeField(auto_now=True) open_class = models.BooleanField(default=True) members = models.ManyToManyField(User,related_name="list of invited members", through = 'Membership') class Membership(models.Model): accept = models.BooleanField(User) date = models.DateTimeField(auto_now = True) classroom = models.ForeignKey(Classroom, related_name = 'classroom_membership') member = models.ForeignKey(User, related_name = 'user_membership') and in def save_classroom(request): if request.method == 'POST': form = ClassroomForm(request.POST, request.FILES, user = request.user) **classroom_instance = Classroom member_instance = Membership** if form.is_valid(): new_obj = form.save(commit=False) new_obj.user = request.user r = Relations.objects.filter(initiated_by = request.user) membership = Membership.objects.create(**classroom = classroom_instance, member = member_instance,date=datetime.datetime.now())** new_obj.save() form.save_m2m() return HttpResponseRedirect('/classroom/classroom_view/{{user}}/') else: form = ClassroomForm(user = request.user) return render_to_response('classroom/classroom_form.html', { 'form': form, }, context_instance=RequestContext(request)) but i don't seem to initialise okay the classroom_instance and menber_instance.My error os: Cannot assign "": "Membership.classroom" must be a "Classroom" instance. Thanks!

    Read the article

  • Exporting data from php page to word document

    - by udaya
    Hi I exported data from php page to word document but the problm is the header is not available in all pages I got the same problem while i am exporting the datas to pdf but i got the result for that one by using fpdf library In pdf i got the results like this ex page1 slno name 1 udaya 2 sankar In page 2 slno name 3 chendu 4 Akila I want the same kind of result in word how to get that This is the function i used function changeDetails() { $bType = $this-input-post('textvalue'); if($bType == "word") { $this-load-library('table'); $data['countrytoword'] = $this-AddEditmodel1-export(); $this-table-set_heading('Name','Country','State','Town'); $out = $this-table-generate($data['countrytoword']); header("Content-Type: application/vnd.ms-word"); header("Expires: 0"); header("Cache-Control: must-revalidate, post-check=0, pre-check=0"); header("Content-disposition: attachment; filename=$cur_date.doc"); echo ''; echo 'CountryList'; print_r($out); } } Name Country State Town

    Read the article

  • Sample twitter application.

    - by Jack
    <?php function updateTwitter($status) { // Twitter login information $username = 'xxxxx'; $password = 'xxxxxx'; // The url of the update function $url = 'http://twitter.com/statuses/update.xml'; // Arguments we are posting to Twitter $postargs = 'status='.urlencode($status); // Will store the response we get from Twitter $responseInfo=array(); // Initialize CURL $ch = curl_init($url); // Tell CURL we are doing a POST curl_setopt ($ch, CURLOPT_POST, true); // Give CURL the arguments in the POST curl_setopt ($ch, CURLOPT_POSTFIELDS, $postargs); // Set the username and password in the CURL call curl_setopt($ch, CURLOPT_USERPWD, $username.':'.$password); // Set some cur flags (not too important) curl_setopt($ch, CURLOPT_VERBOSE, 1); curl_setopt($ch, CURLOPT_NOBODY, 0); curl_setopt($ch, CURLOPT_HEADER, 0); curl_setopt($ch, CURLOPT_FOLLOWLOCATION,1); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); // execute the CURL call $response = curl_exec($ch); // Get information about the response $responseInfo=curl_getinfo($ch); // Close the CURL connection curl_close($ch); // Make sure we received a response from Twitter if(intval($responseInfo['http_code'])==200){ // Display the response from Twitter echo $response; }else{ // Something went wrong echo "Error: " . $responseInfo['http_code']; } } updateTwitter("Just finished a sweet tutorial on http://brandontreb.com"); ?> I get the following output Error: 0 Please help.

    Read the article

  • Best Pattern for AllowUnsafeUpdates

    - by webwires
    So far, in my research I have seen that it is unwise to set AllowUnsafeUpdates on GET request operation to avoid cross site scripting. But, if it is required to allow this, what is the proper way to handle the situation to mitigate any exposure? Here is my best first guess on a reliable pattern if you absolutely need to allow web or site updates on a GET request. Best Practice? protected override void OnLoad(System.EventArgs e) { if(Request.HttpMethod == "POST") { SPUtility.ValidateFormDigest(); // will automatically set AllowSafeUpdates to true } // If not a POST then AllowUnsafeUpdates should be used only // at the point of update and reset immediately after finished // NOTE: Is this true? How is cross-site scripting used on GET // and what mitigates the vulnerability? } // Point of item update SPSecurity.RunWithElevatedPrivledges(delegate() { using(SPSite site = new SPSite(SPContext.Current.Site.Url)) { using (SPWeb web = site.RootWeb) { bool allowUpdates = web.AllowUnsafeUpdates; //store original value web.AllowUnsafeUpdates = true; //... Do something and call Update() ... web.AllowUnsafeUpdates = allowUpdates; //restore original value } } }); Feedback on the best pattern is appreciated.

    Read the article

  • asynchronous pages

    - by lockedscope
    I have just read the multi-threading and custom threading in asp.net articles. http://www.williablog.net/williablog/post/2008/12/16/Custom-Threading-in-ASPNET.aspx http://www.williablog.net/williablog/post/2008/12/16/Multi-Threading-in-ASPNET.aspx I have couple of questions. What does he mean by returning a thread to the pool? Is that thread completely removed from memory or put in to a state that it does not scheduled to CPU(is it in sleep state or whatever)? If that thread is removed from memory how could it survive after async point? How this mechanism works? Are every objects(pages class, request,response etc.) are copied to somewhere else before they are disposed? (Or, is it just waiting in a sleep state and then its waked when async call ends?) He is saying that; "Having said that, making pages asynchronous is not really about improving performance, it is about improving scalability" then he is saying; "I'm sorry to say that it will do nothing for scalability or performance." So which one is true? or for which case(s) are they true?

    Read the article

  • unable to find a MessageBodyReader

    - by Cristian Boariu
    Hi guys, I have this interface: @Path("inbox") public interface InboxQueryResourceTest { @POST @Path("{membershipExternalId}/query") @Consumes(MediaType.APPLICATION_XML) @Produces("multipart/mixed") public MultipartOutput query(@PathParam("membershipExternalId") final String membershipExternalId, @QueryParam("page") @DefaultValue("0") final int page, @QueryParam("pageSize") @DefaultValue("10") final int pageSize, @QueryParam("sortProperty") final List<String> sortPropertyList, @QueryParam("sortReversed") final List<Boolean> sortReversed, @QueryParam("sortType") final List<String> sortTypeString, final InstanceQuery instanceQuery) throws IOException; } I have implemented the method to return a MultipartOutput. I am posting an xml query from Fiddler and i receive the result without any problem. BUT i have done an integration test for the same interface, i send the same objects and i put the response like: final MultipartOutput multiPartOutput = getClient().query(getUserRestAuth(), 0, 25, null, null, null, instanceQuery); But here, so from integration tests, i receive a strange error: Unable to find a MessageBodyReader of content-type multipart/mixed;boundary="74c5b6b4-e820-452d-abea-4c56ffb514bb" and type class org.jboss.resteasy.plugins.providers.multipart.MultipartOutput Anyone has any ideea why only in integration tests i receive this error? PS: Some of you will say that i do not send application/xml as ContentType but multipart, which of course is false because the objects are annotated with the required @XmlRootElement etc, otherways neither the POST from Fiddler would work.

    Read the article

< Previous Page | 240 241 242 243 244 245 246 247 248 249 250 251  | Next Page >