Search Results

Search found 6630 results on 266 pages for 'everyone'.

Page 246/266 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

  • How to fine tune FluentNHibernate's auto mapper?

    - by Venemo
    Okay, so yesterday I managed to get the latest trunk builds of NHibernate and FluentNHibernate to work with my latest little project. (I'm working on a bug tracking application.) I created a nice data access layer using the Repository pattern. I decided that my entities are nothing special, and also that with the current maturity of ORMs, I don't want to hand-craft the database. So, I chose to use FluentNHibernate's auto mapping feature with NHibernate's "hbm2ddl.auto" property set to "create". It really works like a charm. I put the NHibernate configuration in my app domain's config file, set it up, and started playing with it. (For the time being, I created some unit tests only.) It created all tables in the database, and everything I need for it. It even mapped my many-to-many relationships correctly. However, there are a few small glitches: All of the columns created in the DB allow null. I understand that it can't predict which properties should allow null and which shouldn't, but at least I'd like to tell it that it should allow null only for those types for which null makes sense in .NET (eg. non-nullable value types shouldn't allow null). All of the nvarchar and varbinary columns it created, have a default length of 255. I would prefer to have them on max instead of that. Is there a way to tell the auto mapper about the two simple rules above? If the answer is no, will it work correctly if I modify the tables it created? (So, if I set some columns not to allow null, and change the allowed length for some other, will it correctly work with them?) EDIT: I managed to achieve the above by using Fluent NHibernate's convention API. Thanks to everyone who helped! However, there is one more thing: after checking out the convention API, I really would like my IDs to be calld "ID", not "Id", but it seems to me that the PrimaryKey.Name.Is(x => "ID") is not working at all. If I add it to the conventions collection and rewrite my entities' properties to "ID" instead of "Id", it throws an exception that there is no primary key mapped. Any thoughts on this?

    Read the article

  • ASP.NET MVC : Good Replacement for User Control?

    - by David Lively
    I found user controls to be incredibly useful when working with ASP.NET webforms. By encapsulating the code required for displaying a control with the markup, creation of reusable components was very straightforward and very, very useful. While MVC provides convenient separation of concerns, this seems to break encapsulation (ie, you can add a control without adding or using its supporting code, leading to runtime errors). Having to modify a controller every time I add a control to a view seems to me to integrate concerns, not separate them. I'd rather break the purist MVC ideology than give up the benefits of reusable, packaged controls. I need to be able to include components similar to webforms user controls throughout a site, but not for the entire site, and not at a level that belongs in a master page. These components should have their own code not just markup (to interact with the business layer), and it would be great if the page controller didn't need to know about the control. Since MVC user controls don't have codebehind, I can't see a good way to do this. Update FINALLY, a good (and, in retrospect, obvious) way to accomplish this. using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.Mvc; namespace K.ObjectModel.Controls { public class TestControl : ViewUserControl { protected override void Render(System.Web.UI.HtmlTextWriter writer) { writer.Write("Hello World"); base.Render(writer); } } } Create a new class which inherits ViewUserControl Override the .Render() method as shown above. Register the control via its associated ASCX as you would in a webForm: <%@ Register TagName="tn" TagPrefix="k" Src="~/Views/Navigation/LeftBar.ascx"%> Use the corresponding tag in whatever view or master page that you need: <k:tn runat="server"/> Make sure your .ascx inherits your new control: <%@ Control Language="C#" Inherits="K.ObjectModel.Controls.TestControl" %> Voila, you're up and running. This is tested with ASP.NET MVC 2, VS 2010 and .NET 4.0. Your custom tag references the ascx partial view, which inherits from the TestControl class. The control then overrides the Render() method, which is called to render the view, giving you complete control over the process from tag to output. Why does everyone try to make this so much harder than it has to be?

    Read the article

  • Trying to understand the usage of class_eval

    - by eMxyzptlk
    Hello everyone, I'm using the rails-settings gem, and I'm trying to understand how you add functions to ActiveRecord classes (I'm building my own library for card games), and I noticed that this gem uses one of the Meta-programming techniques to add the function to the ActiveRecord::Base class (I'm far from Meta-programming master in ruby, but I'm trying to learn it) module RailsSettings class Railtie < Rails::Railtie initializer 'rails_settings.initialize', :after => :after_initialize do Railtie.extend_active_record end end class Railtie def self.extend_active_record ActiveRecord::Base.class_eval do def self.has_settings class_eval do def settings RailsSettings::ScopedSettings.for_thing(self) end scope :with_settings, :joins => "JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}')", :select => "DISTINCT #{self.table_name}.*" scope :with_settings_for, lambda { |var| { :joins => "JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}') AND settings.var = '#{var}'" } } scope :without_settings, :joins => "LEFT JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}')", :conditions => 'settings.id IS NULL' scope :without_settings_for, lambda { |var| { :joins => "LEFT JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}') AND settings.var = '#{var}'", :conditions => 'settings.id IS NULL' } } end end end end end end What I don't understand is why he uses class_eval on ActiveRecord::Base, wasn't it easier if he just open the ActiveRecord::Base class and define the functions? Specially that there's nothing dynamic in the block (What I mean by dynamic is when you do class_eval or instance_eval on a string containing variables) something like this: module ActiveRecord class Base def self.has_settings class_eval do def settings RailsSettings::ScopedSettings.for_thing(self) end scope :with_settings, :joins => "JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}')", :select => "DISTINCT #{self.table_name}.*" scope :with_settings_for, lambda { |var| { :joins => "JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}') AND settings.var = '#{var}'" } } scope :without_settings, :joins => "LEFT JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}')", :conditions => 'settings.id IS NULL' scope :without_settings_for, lambda { |var| { :joins => "LEFT JOIN settings ON (settings.thing_id = #{self.table_name}.#{self.primary_key} AND settings.thing_type = '#{self.base_class.name}') AND settings.var = '#{var}'", :conditions => 'settings.id IS NULL' } } end end end end I understand the second class_eval (before the def settings) is to define functions on the fly on every class that 'has_settings' right ? Same question here, I think he could use "def self.settings" instead of "class_eval.... def settings", no ?

    Read the article

  • Estimating the boundary of arbitrarily distributed data

    - by Dave
    I have two dimensional discrete spatial data. I would like to make an approximation of the spatial boundaries of this data so that I can produce a plot with another dataset on top of it. Ideally, this would be an ordered set of (x,y) points that matplotlib can plot with the plt.Polygon() patch. My initial attempt is very inelegant: I place a fine grid over the data, and where data is found in a cell, a square matplotlib patch is created of that cell. The resolution of the boundary thus depends on the sampling frequency of the grid. Here is an example, where the grey region are the cells containing data, black where no data exists. OK, problem solved - why am I still here? Well.... I'd like a more "elegant" solution, or at least one that is faster (ie. I don't want to get on with "real" work, I'd like to have some fun with this!). The best way I can think of is a ray-tracing approach - eg: from xmin to xmax, at y=ymin, check if data boundary crossed in intervals dx y=ymin+dy, do 1 do 1-2, but now sample in y An alternative is defining a centre, and sampling in r-theta space - ie radial spokes in dtheta increments. Both would produce a set of (x,y) points, but then how do I order/link neighbouring points them to create the boundary? A nearest neighbour approach is not appropriate as, for example (to borrow from Geography), an isthmus (think of Panama connecting N&S America) could then close off and isolate regions. This also might not deal very well with the holes seen in the data, which I would like to represent as a different plt.Polygon. The solution perhaps comes from solving an area maximisation problem. For a set of points defining the data limits, what is the maximum contiguous area contained within those points To form the enclosed area, what are the neighbouring points for the nth point? How will the holes be treated in this scheme - is this erring into topology now? Apologies, much of this is me thinking out loud. I'd be grateful for some hints, suggestions or solutions. I suspect this is an oft-studied problem with many solution techniques, but I'm looking for something simple to code and quick to run... I guess everyone is, really! Cheers, David

    Read the article

  • Dealing with personal failure

    - by codeelegance
    A while ago I was given the task of updating and extending the functionality of a software project. I was given a year to make the needed changes working solo. A month into development I came to the conclusion that it would take longer to change the existing product than to rewrite it from the ground up. I'd never attempted a complete rewrite so I talked with my boss about it and he was thrilled with the idea. I'm a fan of agile development but had never had the opportunity to take advantage of all of the prescribed practices so when I set to work I tried to incorporate as many as I could. I didn't have direct access to the customer and my coworkers (non-programmers) knew the business domain but were already so busy they didn't really have time to participate in design meetings so I resigned to working in the dark and occasionally calling one of them over to my desk to get feedback on my progress. I used TDD and refactored mercilessly and even tried taking a domain driven design approach. Things went well for a while. As the deadline came closer and the complexity of the project grew my productivity start slipping. I found myself cutting corners and ignoring the practices I had established as the pressure increased to meet the deadline. I also started working late nights and weekends to keep up with the load. In the end it made little difference how hard I worked. The project missed its deadline and what was completed wasn't enough to give to the customer. I had failed. Not only had I not finished on time but the previous version had sat untouched for almost a year so it wouldn't be of any help. Luckily we had another product that offered some of the same functionality. My boss decided to cancel the project entirely and moved all our orphaned customers to the other product. I spent weeks (along with everyone else at the company) manning the phones providing technical support for those customers. After it was all over, my boss was gracious enough not to fire me for nearly ruining the company. I was moved to the other product and have been trying to redeem myself ever since. Where did I go wrong? Has anyone else had to deal with this kind of defeat? How did you recover?

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • Floated DIVs not flowing properly

    - by NightMICU
    Hi everyone, I am working on a photo gallery, each thumbnail is in its own DIV and floated to the left in a containing DIV. It has been displaying properly up until vertical thumbnails entered the equation. Now, when the next row should start, the first item of the following row is to the left of the last vertical DIV (thumbnail), rather than flush to the left of the containing DIV. Here is the CSS: #galleryBox { width: 650px; background: #fff; margin: auto; padding: 10px; text-align: center; overflow: auto; } .item { display: block; margin: 10px; padding: 20px 5px 5px 5px; float: left; background: url('/images/content_bottom.png') repeat-x scroll bottom #828282; } and the HTML: <div id="galleryBox" class="ui-corner-all"> <div id="file" class="ui-corner-all"> <form name="uploadPhoto" id="uploadPhoto" method="post" action="" enctype="multipart/form-data"> <p><label for="photo">Photo:</label><input type="file" name="photo" id="photo"/></p> <p><label for="caption">Caption: <small>Optional</small></label><input type="text" id="caption" name="caption"/></p> <p align="center"><input type="submit" value="Upload" name="send" id="send" class="addButton ui-state-default ui-corner-all"/></p> </form> <a name="thumbs"></a> </div> <div class="item ui-corner-all"> <a href="http://tapp-essexvfd.org/gallery/photos/201004211802.jpg" class="lightbox" title="test1"> <img src="http://tapp-essexvfd.org/gallery/photos/thumbs/201004211802_thumb.jpg" alt="test1"/></a><br/> <p><span class="label">test1</span></p> </div> <div class="item ui-corner-all"> <a href="http://tapp-essexvfd.org/gallery/photos/201004211803.jpg" class="lightbox" title="test3"> <img src="http://tapp-essexvfd.org/gallery/photos/thumbs/201004211803_thumb.jpg" alt="test3"/></a><br/> <p><span class="label">test3</span></p> </div> </div>

    Read the article

  • How do you create a MANIFEST.MF that's available when you're testing and running from a jar in produ

    - by warvair
    I've spent far too much time trying to figure this out. This should be the simplest thing and everyone who distributes Java applications in jars must have to deal with it. I just want to know the proper way to add versioning to my Java app so that I can access the version information when I'm testing, e.g. debugging in Eclipse and running from a jar. Here's what I have in my build.xml: <target name="jar" depends = "compile"> <property name="version.num" value="1.0.0"/> <buildnumber file="build.num"/> <tstamp> <format property="TODAY" pattern="yyyy-MM-dd HH:mm:ss" /> </tstamp> <manifest file="${build}/META-INF/MANIFEST.MF"> <attribute name="Built-By" value="${user.name}" /> <attribute name="Built-Date" value="${TODAY}" /> <attribute name="Implementation-Title" value="MyApp" /> <attribute name="Implementation-Vendor" value="MyCompany" /> <attribute name="Implementation-Version" value="${version.num}-b${build.number}"/> </manifest> <jar destfile="${build}/myapp.jar" basedir="${build}" excludes="*.jar" /> </target> This creates /META-INF/MANIFEST.MF and I can read the values when I'm debugging in Eclipse thusly: public MyClass() { try { InputStream stream = getClass().getResourceAsStream("/META-INF/MANIFEST.MF"); Manifest manifest = new Manifest(stream); Attributes attributes = manifest.getMainAttributes(); String implementationTitle = attributes.getValue("Implementation-Title"); String implementationVersion = attributes.getValue("Implementation-Version"); String builtDate = attributes.getValue("Built-Date"); String builtBy = attributes.getValue("Built-By"); } catch (IOException e) { logger.error("Couldn't read manifest."); } } But, when I create the jar file, it loads the manifest of another jar (presumably the first jar loaded by the application - in my case, activation.jar). Also, the following code doesn't work either although all the proper values are in the manifest file. Package thisPackage = getClass().getPackage(); String implementationVersion = thisPackage.getImplementationVersion(); Any ideas?

    Read the article

  • How can I create the XML::Simple data structure using a Perl XML SAX parser?

    - by DVK
    Summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog—due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. I'm looking for an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been. I don't care much what the interface of the new module is; e.g whether I need to call next_record() or give it a callback coderef accepting a record.

    Read the article

  • how to send put request with data as an xml element, from JavaScript ?

    - by Sarang
    Hi everyone, My data is an xml element & I want send PUT request with JavaScript. How do I do this ? For reference : Update Cell As per fredrik suggested, I did this : function submit(){ var xml = "<entry>" + "<id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id>" + "<link rel=\"edit\" type=\"application/atom+xml\"" + "href=\"https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/worksheetId/private/full/R2C1\"/>" + "<gs:cell row=\"2\" col=\"1\" inputValue=\"300\"/>" + "</entry>"; document.getElementById('submitForm').submit(xml); } </script> </head> <body> <form id="submitForm" method="put" action="https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1"> <input type="submit" value="submit" onclick="submit()"/> </form> However, it doesn't write back but positively it returns xml file like : <?xml version='1.0' encoding='UTF-8'?> <entry xmlns='http://www.w3.org/2005/Atom' xmlns:gs='http://schemas.google.com/spreadsheets/2006' xmlns:batch='http://schemas.google.com/gdata/batch'> <id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id> <updated>2011-01-11T07:35:09.767Z</updated> <category scheme='http://schemas.google.com/spreadsheets/2006' term='http://schemas.google.com/spreadsheets/2006#cell'/> <title type='text'>A2</title> <content type='text'></content> <link rel='self' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1'/> <link rel='edit' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1/1ekg'/> <gs:cell row='2' col='1' inputValue=''></gs:cell> </entry> Any further solution for the same ?

    Read the article

  • Polymorphic :has_many, :through as module in Rails 3.1 plugin

    - by JohnMetta
    I've search everywhere for a pointer to this, but can't find one. Basically, I want to do what everyone else wants to do when they create a polymorphic relationship in a :has_many, :through way… but I want to do it in a module. I keep getting stuck and think I must be overlooking something simple. To wit: module ActsPermissive module PermissiveUser def self.included(base) base.extend ClassMethods end module ClassMethods def acts_permissive has_many :ownables has_many :owned_circles, :through => :ownables end end end class PermissiveCircle < ActiveRecord::Base belongs_to :ownable, :polymorphic => true end end With a migration that looks like this: create_table :permissive_circles do |t| t.string :ownable_type t.integer :ownable_id t.timestamps end The idea, of course, is that whatever loads acts_permissive will be able to have a list of circles that it owns. For simple tests, I have it "should have a list of circles" do user = Factory :user user.owned_circles.should be_an_instance_of Array end which fails with: Failure/Error: @user.circles.should be_an_instance_of Array NameError: uninitialized constant User::Ownable I've tried: using :class_name => 'ActsPermissive::PermissiveCircle' on the has_many :ownables line, which fails with: Failure/Error: @user.circles.should be_an_instance_of Array ActiveRecord::HasManyThroughSourceAssociationNotFoundError: Could not find the source association(s) :owned_circle or :owned_circles in model ActsPermissive::PermissiveCircle. Try 'has_many :owned_circles, :through => :ownables, :source => <name>'. Is it one of :ownable? while following the suggestion and setting :source => :ownable fails with Failure/Error: @user.circles.should be_an_instance_of Array ActiveRecord::HasManyThroughAssociationPolymorphicSourceError: Cannot have a has_many :through association 'User#owned_circles' on the polymorphic object 'Ownable#ownable' Which seems to suggest that doing things with a non-polymorphic-through is necessary. So I added a circle_owner class similar to the setup here: module ActsPermissive class CircleOwner < ActiveRecord::Base belongs_to :permissive_circle belongs_to :ownable, :polymorphic => true end module PermissiveUser def self.included(base) base.extend ClassMethods end module ClassMethods def acts_permissive has_many :circle_owners, :as => :ownable has_many :circles, :through => :circle_owners, :source => :ownable, :class_name => 'ActsPermissive::PermissiveCircle' end end class PermissiveCircle < ActiveRecord::Base has_many :circle_owners end end With a migration: create_table :permissive_circles do |t| t.string :name t.string :guid t.timestamps end create_table :circle_owner do |t| t.string :ownable_type t.string :ownable_id t.integer :permissive_circle_id end which still fails with: Failure/Error: @user.circles.should be_an_instance_of Array NameError: uninitialized constant User::CircleOwner Which brings us back to the beginning. How can I do what seems to be a rather common polymorphic :has_many, :through on a module? Alternatively, is there a good way to allow an object to be collected by arbitrary objects in a similar way that will work with a module?

    Read the article

  • Why is my program freezing when I use a method? (Java)

    - by user2915567
    When I use a boolean method in the Main body, my program freezes and stops working. I've tried putting the method at different places but the exact same thing happens - it freezes. The method is really simple and well-written, I'm not sure what's causing the problem. P.S. The method is on the bottom of the code. Thanks for your help! Edit: That was a dumb question now that I look at it. Thanks again everyone! public static void main(String[] args) { Scanner keyboard = new Scanner(System.in); int stringNumber = 0; String[] stringArray = new String[10]; for (int i = 0; i <= stringArray.length; i++) { boolean itemExists = false; boolean AddItem = AddItem(); if (AddItem == true) { out.println("\nEnter a string"); String input = keyboard.next(); if (i > 0) { for (int j = 0; j < stringArray.length; j++) { if (input.equalsIgnoreCase(stringArray[j])) { itemExists = true; out.println("Item \"" + input + "\" already exists."); break; } } } if (itemExists == false) { stringArray[stringNumber] = input; out.println("\"" + stringArray[stringNumber] + "\"" + " has been stored.\n"); } else { out.println("Try again."); i--; } PrintArray(stringArray); stringNumber++; } } } // This is the method I was talking about // public static boolean AddItem() { Scanner keyboard = new Scanner(System.in); int input = keyboard.nextInt(); out.println("If you want to add an item, Press 1"); if (input == 1) { return true; } else { out.println("Invalid input."); return false; } }

    Read the article

  • Google Code + SVN or GitHub + Git

    - by Nazgulled
    Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • How to do a proper search with nhibernate

    - by Denis Rosca
    Hello everyone, i'm working on a small project that is supposed to allow basic searches of the database. Currently i'm using nhibernate for the database interaction. In the database i have 2 tables: Person and Address. The Person table has a many-to-one relationship with Address. The code i've come up with for doing searches is: public IList<T> GetByParameterList(List<QueryParameter> parameterList) { if (parameterList == null) { return GetAll(); } using (ISession session = NHibernateHelper.OpenSession()) { ICriteria criteria = session.CreateCriteria<T>(); foreach (QueryParameter param in parameterList) { switch (param.Constraint) { case ConstraintType.Less: criteria.Add(Expression.Lt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.More: criteria.Add(Expression.Gt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.LessOrEqual: criteria.Add(Expression.Le(param.ParameterName, param.ParameterValue)); break; case ConstraintType.EqualOrMore: criteria.Add(Expression.Ge(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Equals: criteria.Add(Expression.Eq(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Like: criteria.Add(Expression.Like(param.ParameterName, param.ParameterValue)); break; } } try { IList<T> result = criteria.List<T>(); return result; } catch { //TODO: Implement some exception handling throw; } } } The query parameter is a helper object that i use to create criterias and send it to the dal, it looks like this: public class QueryParameter { public QueryParameter(string ParameterName, Object ParameterValue, ConstraintType constraintType) { this.ParameterName = ParameterName; this.ParameterValue = ParameterValue; this.Constraint = constraintType; } public string ParameterName { get; set; } public Object ParameterValue { get; set; } public ConstraintType Constraint { get; set; } } Now this works well if i'm doing a search like FirstName = "John" , but not when i try to give a parameter like Street = "Some Street". It seems that nhibernate is looking for a street column in the Person table but not in the Address table. Any idea on how should i change my code for so i could do a proper search? Tips? Maybe some alternatives? Disclaimer: i'm kind of a noob so please be gentle ;) Thanks, Denis.

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • output with "Private`" Content in Mathematica Package

    - by madalina
    Hello everyone, I am trying to solve the following implementation problem in Mathematica 7.0 for some days now and I do not understand exactly what is happening so I hope someone can give me some hints. I have 3 functions that I implemented in Mathematica in a source file with extension *.nb. They are working okay to all the examples. Now I want to put these functions into 3 different packages. So I created three different packages with extension .*m in which I put all the desired Mathematica function. An example in the "stereographic.m" package which contain the code: BeginPackage["stereographic`"] stereographic::usage="The package stereographic...." formEqs::usage="The function formEqs[complexBivPolyEqn..." makePoly::usage="The function makePoly[algebraicEqn] ..." getFixPolys::usage="The function..." milnorFibration::usage="The function..." Begin["Private`"] Share[]; formEqs[complex_,{m_,n_}]:=Block[{complexnew,complexnew1, realeq, imageq, expreal, expimag, polyrealF, polyimagF,s,t,u,v,a,b,c,epsilon,x,y,z}, complexnew:=complex/.{m->s+I*t,n->u+I*v}; complexnew1:=complexnew/.{s->(2 a epsilon)/(1+a^2+b^2+c^2),t->(2 b epsilon)/(1+a^2+b^2+c^2),u->(2 c epsilon)/(1+a^2+b^2+c^2),v->(- epsilon+a^2 epsilon+b^2 epsilon+c^2 epsilon)/(1+a^2+b^2+c^2)}; realeq:=ComplexExpand[Re[complexnew1]]; imageq:=ComplexExpand[Im[complexnew1]]; expreal:=makePoly[realeq]; expimag:=makePoly[imageq]; polyrealF:=expreal/.{a->x,b->y,c->z}; polyimagF:=expimag/.{a->x,b->y,c->z}; {polyrealF,polyimagF} ] End[] EndPackage[] Now to test the function I load the package Needs["stereographic`"] everything is okay. But when I test the function for example with formEqs[x^2-y^2,{x,y}] I get the following ouput: {Private`epsilon^2 + 2 Private`x^2 Private`epsilon^2 + Private`x^4 Private`epsilon^2 - 6 Private`y^2 Private`epsilon^2 + 2 Private`x^2 Private`y^2 Private`epsilon^2 + Private`y^4 Private`epsilon^2 - 6 Private`z^2 Private`epsilon^2 + 2 Private`x^2 Private`z^2 Private`epsilon^2 + 2 Private`y^2 Private`z^2 Private`epsilon^2 + Private`z^4 Private`epsilon^2, 8 Private`x Private`y Private`epsilon^2 + 4 Private`z Private`epsilon^2 - 4 Private`x^2 Private`z Private`epsilon^2 - 4 Private`y^2 Private`z Private`epsilon^2 - 4 Private`z^3 Private`epsilon^2} Of course I do not understand why Private` appears in front of any local variable which I returned in the final result. I would want not to have this Private` in the computed output. Any idea or better explanations which could indicate me why this happens? Thank you very much for your help. Best wishes, madalina

    Read the article

  • how to animate 2 surfaces in Matlab?

    - by Kate
    Hi everyone, I've written this code which makes an animation of 2 ellipsoids. Parameter k1 of these ellipsoids must depend on time (so they'd move asynchronously), but I need to animate them in one figure. Can I use loop for it or is it better to use timer & some kind of callback functions? The second problem - I need to move inner ellipsoid so they would have one common side. How can I do this? a=5; b=a; c=10; u = (0:0.05*pi:2*pi)'; v = [0:0.05*pi:2*pi]; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; % cut upper V1=4/3*pi*a*b*c; d=1/2; e=2^d; a2=a/e; b2=a/e; c2=c; V2=4/3*pi*a2*b2*c2; X2 = a2*sin(u)*cos(v);%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; % cut h=1/3; for j = 1:20 k1=(sin(pi*j/20)+0.5)^h; a=a*k1; c=c*k1; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; a2=a2*k1; b2=a2*k1; c2=c2*k1; X2 = a2*sin(u)*cos(v)+5;%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; hS1=surf(X,Y,Z); alpha(.11) hold on hS2=surf(X2,Y2,Z2); hold off axis([-20 20 -20 20 -20 20]); F(j) = getframe; end movie(F,4)

    Read the article

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • Rails send mail with GMail

    - by Danny McClelland
    Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

    Read the article

  • MySQL - Calculating fields on the fly vs storing calculated data

    - by Christian Varga
    Hi Everyone, I apologise if this has been asked before, but I can't seem to find an answer to a question that I have about calculating on the fly vs storing fields in a database. I read a few articles that suggested it was preferable to calculate when you can, but I would just like to know if that still applies to the following 2 examples. Example 1. Say you are storing data relating to a car. You store the fuel tank size in litres, and how many litres it uses per 100km. You also want to know how many KMs it can travel, which can be calculated from the tank size and economy. I see 2 ways of doing this: When a car is added or updated, calculate the amount of KMs and store this as a static field in the database. Every time a car is accessed, calculate the amount of KMs on the fly. Because the cars economy/tank size doesn't change (although it could be edited), the KMs is a pretty static value. I don't see why we would calculate it every single time the car is accessed. Wouldn't this waste cpu time as opposed to simply storing it in a separate field in the database and calculating only when a car is added or updated? My next example, which is almost an entirely different question (but on the same topic), relates to counting children. Let's say we have a app which has categories and items. We have a view where we display all the categories, and a count of all the items inside each category. Again, I'm wondering what's better. To perform a MySQL query to count all the items in each category every single time the page is accessed? Or store the count in a field in the categories table and update when an item is added / deleted? I know it is redundant to store anything that can be calculated, but I worry that calculating fields or counting records might be slow as opposed to storing the data in a field. If it's not then please let me know, I just want to learn about when to use either method. On a small scale I guess it wouldn't matter either way, but apps like Facebook, would they really count the amount of friends you have every time someone views your profile or would they just store it as a field? I'd appreciate any responses to both of these scenarios, and any resource that might explain the benefits of calculating vs storing. Thanks in advance, Christian

    Read the article

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • MooTools event listener disappears after element.innerHTML is changed

    - by acoder
    Hi everyone, I am trying to achieve this task using MooTools. Description: I attached an event listener to "myButton" link. A click on this link initiates an AJAX request and updates "myDiv" content based on the response text. During this request a POST variable is being sent to "button.php", but it's not used at the moment.. (i wish to use it later) OK, as a result, "myDiv" gets exactly the same link with the same ID (myButton) + a random number, so that we could see that each click generates a new number. The problem: After the first click on "myButton", "myDiv" updates correctly, showing a random number. When I click "myButton" for the second time (this time in newly updated div), the div does not refresh anymore. Please note that I need "myButton" to be inside "myDiv", and "myDiv" must be updated (refreshed) after each click without having to refresh the entire page. Can somebody show me how to achieve this task based on this simplified code example? index.html <html> <head> <script type="text/javascript" src="mootools-1.2.4-core-nc.js"></script> <script> window.addEvent('domready', function() { $('myButton').addEvent('click', function(e) { e.stop(); var myRequest = new Request({ method: 'post', url: 'button.php', data: { action : 'test' }, onRequest: function() { $('myDiv').innerHTML = '<img src="images/loading.gif" />'; }, onComplete: function(response) { $('myDiv').innerHTML = response; } }); myRequest.send(); $('myButton').removeEvent('click'); }); }); </script> </head> <body> <div id="myDiv"> <a id="myButton" href="#">Button</a> </div> </body> </html> button.php <a id="myButton" href="#">Button</a> clicked <?php echo rand(1,100); ?>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >