Search Results

Search found 674 results on 27 pages for 'refactor'.

Page 25/27 | < Previous Page | 21 22 23 24 25 26 27  | Next Page >

• A Semantic Model For Html: TagBuilder and HtmlTags

  - by Ryan Ohs

  In this post I look into the code smell that is HTML literals and show how we can refactor these pesky strings into a friendlier and more maintainable model.   The Problem When I started writing MVC applications, I quickly realized that I built a lot of my HTML inside HtmlHelpers. As I did this, I ended up moving quite a bit of HTML into string literals inside my helper classes. As I wanted to add more attributes (such as classes) to my tags, I needed to keep adding overloads to my helpers. A good example of this end result is the default html helpers that come with the MVC framework. Too many overloads make me crazy! The problem with all these overloads is that they quickly muck up the API and nobody can remember exactly what order the parameters go in. I've seen many presenters (including members of the ASP.NET MVC team!) stumble before realizing that their view wasn't compiling because they needed one more null parameter in the call to Html.ActionLink(). What if instead of writing Html.ActionLink("Edit", "Edit", null, new { @class = "navigation" }) we could do Html.LinkToAction("Edit").Text("Edit").AddClass("navigation") ? Wouldn't that be much easier to remember and understand?  We can do this if we introduce a semantic model for building our HTML.   What is a Semantic Model? According to Martin Folwer, "a semantic model is an in-memory representation, usually an object model, of the same subject that the domain specific language describes." In our case, the model would be a set of classes that know how to render HTML. By using a semantic model we can free ourselves from dealing with strings and instead output the HTML (typically via ToString()) once we've added all the elements and attributes we desire to the model. There are two primary semantic models available in ASP.NET MVC: MVC 2.0's TagBuilder and FubuMVC's HtmlTags.   TagBuilder TagBuilder is the html builder that is available in ASP.NET MVC 2.0. I'm not a huge fan but it gets the job done -- for simple jobs.  Here's an overview of how to use TagBuilder. See my Tips section below for a few comments on that example. The disadvantage of TagBuilder is that unless you wrap it up with our own classes, you still have to write the actual tag name over and over in your code. eg. new TagBuilder("div") instead of new DivTag(). I also think it's method names are a little too long. Why not have AddClass() instead of AddCssClass() or Text() instead of SetInnerText()? What those methods are doing should be pretty obvious even in the short form. I also don't like that it wants to generate an id attribute from your input instead of letting you set it yourself using external conventions. (See GenerateId() and IdAttributeDotReplacement)). Obviously these come from Microsoft's default approach to MVC but may not be optimal for all programmers.   HtmlTags HtmlTags is in my opinion the much better option for generating html in ASP.NET MVC. It was actually written as a part of FubuMVC but is available as a stand alone library. HtmlTags provides a much cleaner syntax for writing HTML. There are classes for most of the major tags and it's trivial to create additional ones by inheriting from HtmlTag. There are also methods on each tag for the common attributes. For instance, FormTag has an Action() method. The SelectTag class allows you to set the default option or first option independent from adding other options. With TagBuilder there isn't even an abstraction for building selects! The project is open source and always improving. I'll hopefully find time to submit some of my own enhancements soon.   Tips 1) It's best not to have insanely overloaded html helpers. Use fluent builders. 2) In html helpers, return the TagBuilder/tag itself (not a string!) so that you can continue to add attributes outside the helper; see my first sample above. 3) Create a static entry point into your builders. I created a static Tags class that gives me access all the HtmlTag classes I need. This way I don't clutter my code with "new" keywords. eg. Tags.Div returns a new DivTag instance. 4) If you find yourself doing something a lot, create an extension method for it. I created a Nest() extension method that reads much more fluently than the AddChildren() method. It also accepts a params array of tags so I can very easily nest many children.   I hope you have found this post helpful. Join me in my war against HTML literals! I’ll have some more samples of how I use HtmlTags in future posts.

  Read the article

• Memento with optional state?

  - by Korey Hinton

  EDIT: As pointed out by Steve Evers and pdr, I am not correctly implementing the Memento pattern, my design is actually State pattern. Menu Program I built a console-based menu program with multiple levels that selects a particular test to run. Each level more precisely describes the operation. At any level you can type back to go back one level (memento). Level 1: Server Type? [1] Server A [2] Server B Level 2: Server environment? [1] test [2] production Level 3: Test type? [1] load [2] unit Level 4: Data Collection? [1] Legal docs [2] Corporate docs Level 4.5 (optional): Load Test Type [2] Multi TIF [2] Single PDF Level 5: Command Type? [1] Move [2] Copy [3] Remove [4] Custom Level 6: Enter a keyword [setup, cleanup, run] Design States PROBLEM: Right now the STATES enum is the determining factor as to what state is BACK and what state is NEXT yet it knows nothing about what the current memento state is. Has anyone experienced a similar issue and found an effective way to handle mementos with optional state? static enum STATES { SERVER, ENVIRONMENT, TEST_TYPE, COLLECTION, COMMAND_TYPE, KEYWORD, FINISHED } Possible Solution (Not-flexible) In reference to my code below, every case statement in the Menu class could check the state of currentMemo and then set the STATE (enum) accordingly to pass to the Builder. However, this doesn't seem flexible very flexible to change and I'm struggling to see an effective way refactor the design. class Menu extends StateConscious { private State state; private Scanner reader; private ServerUtils utility; Menu() { state = new State(); reader = new Scanner(System.in); utility = new ServerUtils(); } // Recurring menu logic public void startPromptingLoop() { List<State> states = new ArrayList<>(); states.add(new State()); boolean redoInput = false; boolean userIsDone = false; while (true) { // get Memento from last loop Memento currentMemento = states.get(states.size() - 1) .saveMemento(); if (currentMemento == null) currentMemento = new Memento.Builder(0).build(); if (!redoInput) System.out.println(currentMemento.prompt); redoInput = false; // prepare Memento for next loop Memento nextMemento = null; STATES state = STATES.values()[states.size() - 1]; // get user input String selection = reader.nextLine(); switch (selection) { case "exit": reader.close(); return; // only escape case "quit": nextMemento = new Memento.Builder(first(), currentMemento, selection).build(); states.clear(); break; case "back": nextMemento = new Memento.Builder(previous(state), currentMemento, selection).build(); if (states.size() <= 1) { states.remove(0); } else { states.remove(states.size() - 1); states.remove(states.size() - 1); } break; case "1": nextMemento = new Memento.Builder(next(state), currentMemento, selection).build(); break; case "2": nextMemento = new Memento.Builder(next(state), currentMemento, selection).build(); break; case "3": nextMemento = new Memento.Builder(next(state), currentMemento, selection).build(); break; case "4": nextMemento = new Memento.Builder(next(state), currentMemento, selection).build(); break; default: if (state.equals(STATES.CATEGORY)) { String command = selection; System.out.println("Executing " + command + " command on: " + currentMemento.type + " " + currentMemento.environment); utility.executeCommand(currentMemento.nickname, command); userIsDone = true; states.clear(); nextMemento = new Memento.Builder(first(), currentMemento, selection).build(); } else if (state.equals(STATES.KEYWORD)) { nextMemento = new Memento.Builder(next(state), currentMemento, selection).build(); states.clear(); nextMemento = new Memento.Builder(first(), currentMemento, selection).build(); } else { redoInput = true; System.out.println("give it another try"); continue; } break; } if (userIsDone) { // start the recurring menu over from the beginning for (int i = 0; i < states.size(); i++) { if (i != 0) { states.remove(i); // remove all except first } } reader = new Scanner(System.in); this.state = new State(); userIsDone = false; } if (!redoInput) { this.state.restoreMemento(nextMemento); states.add(this.state); } } } }

  Read the article

• When is my View too smart?

  - by Kyle Burns

  In this posting, I will discuss the motivation behind keeping View code as thin as possible when using patterns such as MVC, MVVM, and MVP.  Once the motivation is identified, I will examine some ways to determine whether a View contains logic that belongs in another part of the application.  While the concepts that I will discuss are applicable to most any pattern which favors a thin View, any concrete examples that I present will center on ASP.NET MVC. Design patterns that include a Model, a View, and other components such as a Controller, ViewModel, or Presenter are not new to application development.  These patterns have, in fact, been around since the early days of building applications with graphical interfaces.  The reason that these patterns emerged is simple – the code running closest to the user tends to be littered with logic and library calls that center around implementation details of showing and manipulating user interface widgets and when this type of code is interspersed with application domain logic it becomes difficult to understand and much more difficult to adequately test.  By removing domain logic from the View, we ensure that the View has a single responsibility of drawing the screen which, in turn, makes our application easier to understand and maintain. I was recently asked to take a look at an ASP.NET MVC View because the developer reviewing it thought that it possibly had too much going on in the view.  I looked at the .CSHTML file and the first thing that occurred to me was that it began with 40 lines of code declaring member variables and performing the necessary calculations to populate these variables, which were later either output directly to the page or used to control some conditional rendering action (such as adding a class name to an HTML element or not rendering another element at all).  This exhibited both of what I consider the primary heuristics (or code smells) indicating that the View is too smart: Member variables – in general, variables in View code are an indication that the Model to which the View is being bound is not sufficient for the needs of the View and that the View has had to augment that Model.  Notable exceptions to this guideline include variables used to hold information specifically related to rendering (such as a dynamically determined CSS class name or the depth within a recursive structure for indentation purposes) and variables which are used to facilitate looping through collections while binding. Arithmetic – as with member variables, the presence of arithmetic operators within View code are an indication that the Model servicing the View is insufficient for its needs.  For example, if the Model represents a line item in a sales order, it might seem perfectly natural to “normalize” the Model by storing the quantity and unit price in the Model and multiply these within the View to show the line total.  While this does seem natural, it introduces a business rule to the View code and makes it impossible to test that the rounding of the result meets the requirement of the business without executing the View.  Within View code, arithmetic should only be used for activities such as incrementing loop counters and calculating element widths. In addition to the two characteristics of a “Smart View” that I’ve discussed already, this View also exhibited another heuristic that commonly indicates to me the need to refactor a View and make it a bit less smart.  That characteristic is the existence of Boolean logic that either does not work directly with properties of the Model or works with too many properties of the Model.  Consider the following code and consider how logic that does not work directly with properties of the Model is just another form of the “member variable” heuristic covered earlier: @if(DateTime.Now.Hour < 12) {     <div>Good Morning!</div> } else {     <div>Greetings</div> } This code performs business logic to determine whether it is morning.  A possible refactoring would be to add an IsMorning property to the Model, but in this particular case there is enough similarity between the branches that the entire branching structure could be collapsed by adding a Greeting property to the Model and using it similarly to the following: <div>@Model.Greeting</div> Now let’s look at some complex logic around multiple Model properties: @if (ModelPageNumber + Model.NumbersToDisplay == Model.PageCount         || (Model.PageCount != Model.CurrentPage             && !Model.DisplayValues.Contains(Model.PageCount))) {     <div>There's more to see!</div> } In this scenario, not only is the View code difficult to read (you shouldn’t have to play “human compiler” to determine the purpose of the code), but it also complex enough to be at risk for logical errors that cannot be detected without executing the View.  Conditional logic that requires more than a single logical operator should be looked at more closely to determine whether the condition should be evaluated elsewhere and exposed as a single property of the Model.  Moving the logic above outside of the View and exposing a new Model property would simplify the View code to: @if(Model.HasMoreToSee) {     <div>There’s more to see!</div> } In this posting I have briefly discussed some of the more prominent heuristics that indicate a need to push code from the View into other pieces of the application.  You should now be able to recognize these symptoms when building or maintaining Views (or the Models that support them) in your applications.

  Read the article

• How to properly add texture to multi-fixture/shape b2Body

  - by Blazej Wdowikowski

  Hello to everyone this is my first poste here I hope that will be not fail start. At start I must say I make part 1 in Ray's Tutorial "How To Make A Game Like Fruit Ninja With Box2D and Cocos2D". But I wonder what when I want make more complex body with texture? Simple just add n b2FixtureDef to the same body. OK but what about texture? If I will take code from that tutorial it only fill last fixture. Probably it does not takes every b2Vec2 point. I was right, it did not. So quick refactor and from that -(id)initWithTexture:(CCTexture2D*)texture body:(b2Body*)body original:(BOOL)original { // gather all the vertices from our Box2D shape b2Fixture *originalFixture = body->GetFixtureList(); b2PolygonShape *shape = (b2PolygonShape*)originalFixture->GetShape(); int vertexCount = shape->GetVertexCount(); NSMutableArray *points = [NSMutableArray arrayWithCapacity:vertexCount]; for(int i = 0; i < vertexCount; i++) { CGPoint p = ccp(shape->GetVertex(i).x * PTM_RATIO, shape->GetVertex(i).y * PTM_RATIO); [points addObject:[NSValue valueWithCGPoint:p]]; } if ((self = [super initWithPoints:points andTexture:texture])) { _body = body; _body->SetUserData(self); _original = original; // gets the center of the polygon _centroid = self.body->GetLocalCenter(); // assign an anchor point based on the center self.anchorPoint = ccp(_centroid.x * PTM_RATIO / texture.contentSize.width, _centroid.y * PTM_RATIO / texture.contentSize.height); } return self; } I came up with that -(id)initWithTexture:(CCTexture2D*)texture body:(b2Body*)body original:(BOOL)original { int vertexCount = 0; //gather total number of b2Vect2 points b2Fixture *currentFixture = body->GetFixtureList(); while (currentFixture) { //new b2PolygonShape *shape = (b2PolygonShape*)currentFixture->GetShape(); vertexCount += shape->GetVertexCount(); currentFixture = currentFixture->GetNext(); } NSMutableArray *points = [NSMutableArray arrayWithCapacity:vertexCount]; // gather all the vertices from our Box2D shape b2Fixture *originalFixture = body->GetFixtureList(); while (originalFixture) { //new NSLog((NSString*)@"-"); b2PolygonShape *shape = (b2PolygonShape*)originalFixture->GetShape(); int currentVertexCount = shape->GetVertexCount(); for(int i = 0; i < currentVertexCount; i++) { CGPoint p = ccp(shape->GetVertex(i).x * PTM_RATIO, shape->GetVertex(i).y * PTM_RATIO); [points addObject:[NSValue valueWithCGPoint:p]]; } originalFixture = originalFixture->GetNext(); } if ((self = [super initWithPoints:points andTexture:texture])) { _body = body; _body->SetUserData(self); _original = original; // gets the center of the polygon _centroid = self.body->GetLocalCenter(); // assign an anchor point based on the center self.anchorPoint = ccp(_centroid.x * PTM_RATIO / texture.contentSize.width,_centroid.y * PTM_RATIO / texture.contentSize.height); } return self; } I was working for simple two fixtures body like b2BodyDef bodyDef; bodyDef.type = b2_dynamicBody; bodyDef.position = position; bodyDef.angle = rotation; b2Body *body = world->CreateBody(&bodyDef); b2FixtureDef fixtureDef; fixtureDef.density = 1.0; fixtureDef.friction = 0.5; fixtureDef.restitution = 0.2; fixtureDef.filter.categoryBits = 0x0001; fixtureDef.filter.maskBits = 0x0001; b2Vec2 vertices[] = { b2Vec2(0.0/PTM_RATIO,50.0/PTM_RATIO), b2Vec2(0.0/PTM_RATIO,0.0/PTM_RATIO), b2Vec2(50.0/PTM_RATIO,30.1/PTM_RATIO), b2Vec2(60.0/PTM_RATIO,60.0/PTM_RATIO) }; b2PolygonShape shape; shape.Set(vertices, 4); fixtureDef.shape = &shape; body->CreateFixture(&fixtureDef); b2Vec2 vertices2[] = { b2Vec2(20.0/PTM_RATIO,50.0/PTM_RATIO), b2Vec2(20.0/PTM_RATIO,0.0/PTM_RATIO), b2Vec2(70.0/PTM_RATIO,30.1/PTM_RATIO), b2Vec2(80.0/PTM_RATIO,60.0/PTM_RATIO) }; shape.Set(vertices2, 4); fixtureDef.shape = &shape; body->CreateFixture(&fixtureDef); But if I try put secondary shape upper than first it starting wierd, texture goes crazy. For example not mention about more complex shapes. What's more if shapes have one common point texture will not render for them at all [For that I use Physics Edytor like in tutorial part1] BTW. I use PolygonSprite and in method createWithWorld... another shapes. Uff.. Question So my question is, why texture coords are in such a mess up? It's my modify method or just wrong approach? Maybe I should remove duplicated from points array?

  Read the article

• The Enterprise is a Curmudgeon

  - by John K. Hines

  Working in an enterprise environment is a unique challenge.  There's a lot more to software development than developing software.  A project lead or Scrum Master has to manage personalities and intra-team politics, has to manage accomplishing the task at hand while creating the opportunities and a reputation for handling desirable future work, has to create a competent, happy team that actually delivers while being careful not to burn bridges or hurt feelings outside the team.  Which makes me feel surprised to read advice like: " The enterprise should figure out what is likely to work best for itself and try to use it." - Ken Schwaber, The Enterprise and Scrum. The enterprises I have experience with are fundamentally unable to be self-reflective.  It's like asking a Roman gladiator if he'd like to carve out a little space in the arena for some silent meditation.  I'm currently wondering how compatible Scrum is with the top-down hierarchy of life in a large organization.  Specifically, manufacturing-mindset, fixed-release, harmony-valuing large organizations.  Now I understand why Agile can be a better fit for companies without much organizational inertia. Recently I've talked with nearly two dozen software professionals and their managers about Scrum and Agile.  I've become convinced that a developer, team, organization, or enterprise can be Agile without using Scrum.  But I'm not sure about what process would be the best fit, in general, for an enterprise that wants to become Agile.  It's possible I should read more than just the introduction to Ken's book. I do feel prepared to answer some of the questions I had asked in a previous post: How can Agile practices (including but not limited to Scrum) be adopted in situations where the highest-placed managers in a company demand software within extremely aggressive deadlines? Answer: In a very limited capacity at the individual level.  The situation here is that the senior management of this company values any software release more than it values developer well-being, end-user experience, or software quality.  Only if the developing organization is given an immediate refactoring opportunity does this sort of development make sense to a person who values sustainable software.   How can Agile practices be adopted by teams that do not perform a continuous cycle of new development, such as those whose sole purpose is to reproduce and debug customer issues? Answer: It depends.  For Scrum in particular, I don't believe Scrum is meant to manage unpredictable work.  While you can easily adopt XP practices for bug fixing, the project-management aspects of Scrum require some predictability.  My question here was meant toward those who want to apply Scrum to non-development teams.  In some cases it works, in others it does not. How can a team measure if its development efforts are both Agile and employ sound engineering practices? Answer: I'm currently leaning toward measuring these independently.  The Agile Principles are a terrific way to measure if a software team is agile.  Sound engineering practices are those practices which help developers meet the principles.  I think Scrum is being mistakenly applied as an engineering practice when it is essentially a project management practice.  In my opinion, XP and Lean are examples of good engineering practices. How can Agile be explained in an accurate way that describes its benefits to sceptical developers and/or revenue-focused non-developers? Answer: Agile techniques will result in higher-quality, lower-cost software development.  This comes primarily from finding defects earlier in the development cycle.  If there are individual developers who do not want to collaborate, write unit tests, or refactor, then these are simply developers who are either working in an area where adding these techniques will not add value (i.e. they are an expert) or they are a developer who is satisfied with the status quo.  In the first case they should be left alone.  In the second case, the results of Agile should be demonstrated by other developers who are willing to receive recognition for their efforts.  It all comes down to individuals, doesn't it?  If you're working in an organization whose Agile adoption consists exclusively of Scrum, consider ways to form individual Agile teams to demonstrate its benefits.  These can even be virtual teams that span people across org-chart boundaries.  Once you can measure real value, whether it's Scrum, Lean, or something else, people will follow.  Even the curmudgeons.

  Read the article

• Avoiding coupling

  - by Seralize

  It is also true that a system may become so coupled, where each class is dependent on other classes that depend on other classes, that it is no longer possible to make a change in one place without having a ripple effect and having to make subsequent changes in many places.[1] This is why using an interface or an abstract class can be valuable in any object-oriented software project. Quote from Wikipedia Starting from scratch I'm starting from scratch with a project that I recently finished because I found the code to be too tightly coupled and hard to refactor, even when using MVC. I will be using MVC on my new project aswell but want to try and avoid the pitfalls this time, hopefully with your help. Project summary My issue is that I really wish to keep the Controller as clean as possible, but it seems like I can't do this. The basic idea of the program is that the user picks wordlists which is sent to the game engine. It will pick random words from the lists until there are none left. Problem at hand My main problem is that the game will have 'modes', and need to check the input in different ways through a method called checkWord(), but exactly where to put this and how to abstract it properly is a challenge to me. I'm new to design patterns, so not sure whether there exist any might fit my problem. My own attempt at abstraction Here is what I've gotten so far after hours of 'refactoring' the design plans, and I know it's long, but it's the best I could do to try and give you an overview (Note: As this is the sketch, anything is subject to change, all help and advice is very welcome. Also note the marked coupling points): Wordlist class Wordlist { // Basic CRUD etc. here! // Other sample methods: public function wordlistCount($user_id) {} // Returns count of how many wordlists a user has public function getAll($user_id) {} // Returns all wordlists of a user } Word class Word { // Basic CRUD etc. here! // Other sample methods: public function wordCount($wordlist_id) {} // Returns count of words in a wordlist public function getAll($wordlist_id) {} // Returns all words from a wordlist public function getWordInfo($word_id) {} // Returns information about a word } Wordpicker class Wordpicker { // The class needs to know which words and wordlists to exclude protected $_used_words = array(); protected $_used_wordlists = array(); // Wordlists to pick words from protected $_wordlists = array(); /* Public Methods */ public function setWordlists($wordlists = array()) {} public function setUsedWords($used_words = array()) {} public function setUsedWordlists($used_wordlists = array()) {} public function getRandomWord() {} // COUPLING POINT! Will most likely need to communicate with both the Wordlist and Word classes /* Protected Methods */ protected function _checkAvailableWordlists() {} // COUPLING POINT! Might need to check if wordlists are deleted etc. protected function _checkAvailableWords() {} // COUPLING POINT! Method needs to get all words in a wordlist from the Word class } Game class Game { protected $_session_id; // The ID of a game session which gets stored in the database along with game details protected $_game_info = array(); // Game instantiation public function __construct($user_id) { if (! $this->_session_id = $this->_gameExists($user_id)) { // New game } else { // Resume game } } // This is the method I tried to make flexible by using abstract classes etc. // Does it even belong in this class at all? public function checkWord($answer, $native_word, $translation) {} // This method checks the answer against the native word / translation word, depending on game mode public function getGameInfo() {} // Returns information about a game session, or creates it if it does not exist public function deleteSession($session_id) {} // Deletes a game session from the database // Methods dealing with game session information protected function _gameExists($user_id) {} protected function _getProgress($session_id) {} protected function _updateProgress($game_info = array()) {} } The Game /* CONTROLLER */ /* "Guess the word" page */ // User input $game_type = $_POST['game_type']; // Chosen with radio buttons etc. $wordlists = $_POST['wordlists']; // Chosen with checkboxes etc. // Starts a new game or resumes one from the database $game = new Game($_SESSION['user_id']); $game_info = $game->getGameInfo(); // Instantiates a new Wordpicker $wordpicker = new Wordpicker(); $wordpicker->setWordlists((isset($game_info['wordlists'])) ? $game_info['wordlists'] : $wordlists); $wordpicker->setUsedWordlists((isset($game_info['used_wordlists'])) ? $game_info['used_wordlists'] : NULL); $wordpicker->setUsedWords((isset($game_info['used_words'])) ? $game_info['used_words'] : NULL); // Fetches an available word if (! $word_id = $wordpicker->getRandomWord()) { // No more words left - game over! $game->deleteSession($game_info['id']); redirect(); } else { // Presents word details to the user $word = new Word(); $word_info = $word->getWordInfo($word_id); } The Bit to Finish /* CONTROLLER */ /* "Check the answer" page */ // ?????????????????? ( http://pastebin.com/cc6MtLTR ) Make sure you toggle the 'Layout Width' to the right for a better view. Thanks in advance. Questions To which extent should objects be loosely coupled? If object A needs info from object B, how is it supposed to get this without losing too much cohesion? As suggested in the comments, models should hold all business logic. However, as objects should be independent, where to glue them together? Should the model contain some sort of "index" or "client" area which connects the dots? Edit: So basically what I should do for a start is to make a new model which I can more easily call with oneliners such as $model->doAction(); // Lots of code in here which uses classes! How about the method for checking words? Should it be it's own object? I'm not sure where I should put it as it's pretty much part of the 'game'. But on another hand, I could just leave out the 'abstraction and OOPness' and make it a method of the 'client model' which will be encapsulated from the controller anyway. Very unsure about this.

  Read the article

• drawing thick, textured lines in OpenGL

  - by NateS

  I need to draw thick textured line segments in OpenGL. Actually I need curves made out of short line segments. Here is what I have: In the upper left is an example of two connected line segments. The second image shows once the lines are given width, they overlap. If I apply a texture that uses translucency, the overlap looks terrible. The third image shows that both lines are shortened by half the amount necessary to make the thick line corners just touch. This way I can fill the space between the lines with a triangle. On the right you can see this works well (ignore the horizontal line when the crappy texture repeats). But it doesn't always work well. In the bottom left the curve is made of many short line segments. Note the incorrect texture application. My program is written in Java, making use of the LWJGL OpenGL binding (and minor use of Slick, a 2D helper framework). I've made a zip file that contains an executable JAR so you can easily see the problem. It also has the Java code (there is only one source file) and an Eclipse project, so you can instantly run it through Eclipse and hack at it if you like. Here she is: http://n4te.com/temp/lines.zip To run, execute "java -jar lines.jar". You may need "-Djava.library.path=." before -jar if you are not on Windows. Press space to toggle texture/wireframe. The wireframe only shows the line segments, the triangle between them isn't drawn. I don't need to draw arbitrary lines, just bezier curves similar to what you see in the program. Sorry the code is a bit messy, once I have a solution I will refactor. I have investigated using GLUtessellator. It greatly simplified construction of the line, but I found that applying the texture was perfect. It worked most of the time (top image below), but long vertical curves would have severe texture distortion (bottom image below): This turned out to be much easier to code, but in the end worse than my approach. I believe what I'm trying to do is called "line tessellation" or "stroke tessellation". I assume this has been solved already? Is there standard code I can leverage? Otherwise, how can I fix my code so that the texture does not freak out on short, vertical curves?

  Read the article

• Can I read an Outlook (2003/2007) PST file in C#?

  - by Andy May

  Is it possible to read a .PST file using C#? I would like to do this as a standalone application, not as an Outlook addin (if that is possible). If have seen other SO questions similar to this mention MailNavigator but I am looking to do this programmatically in C#. I have looked at the Microsoft.Office.Interop.Outlook namespace but that appears to be just for Outlook addins. LibPST appears to be able to read PST files, but this is in C (sorry Joel, I didn't learn C before graduating). Any help would be greatly appreciated, thanks! EDIT: Thank you all for the responses! I accepted Matthew Ruston's response as the answer because it ultimately led me to the code I was looking for. Here is a simple example of what I got to work (You will need to add a reference to Microsoft.Office.Interop.Outlook): using System; using System.Collections.Generic; using Microsoft.Office.Interop.Outlook; namespace PSTReader { class Program { static void Main () { try { IEnumerable<MailItem> mailItems = readPst(@"C:\temp\PST\Test.pst", "Test PST"); foreach (MailItem mailItem in mailItems) { Console.WriteLine(mailItem.SenderName + " - " + mailItem.Subject); } } catch (System.Exception ex) { Console.WriteLine(ex.Message); } Console.ReadLine(); } private static IEnumerable<MailItem> readPst(string pstFilePath, string pstName) { List<MailItem> mailItems = new List<MailItem>(); Application app = new Application(); NameSpace outlookNs = app.GetNamespace("MAPI"); // Add PST file (Outlook Data File) to Default Profile outlookNs.AddStore(pstFilePath); MAPIFolder rootFolder = outlookNs.Stores[pstName].GetRootFolder(); // Traverse through all folders in the PST file // TODO: This is not recursive, refactor Folders subFolders = rootFolder.Folders; foreach (Folder folder in subFolders) { Items items = folder.Items; foreach (object item in items) { if (item is MailItem) { MailItem mailItem = item as MailItem; mailItems.Add(mailItem); } } } // Remove PST file from Default Profile outlookNs.RemoveStore(rootFolder); return mailItems; } } } Note: This code assumes that Outlook is installed and already configured for the current user. It uses the Default Profile (you can edit the default profile by going to Mail in the Control Panel). One major improvement on this code would be to create a temporary profile to use instead of the Default, then destroy it once completed.

  Read the article

• Very slow compile times on Visual Studio

  - by johnc

  We are getting very slow compile times, which can take upwards of 20+ minutes on dual core 2GHz, 2G Ram machines. A lot of this is due to the size of our solution which has grown to 70+ projects, as well as VSS which is a bottle neck in itself when you have a lot of files. (swapping out VSS is not an option unfortunately, so I don't want this to descend into a VSS bash) We are looking at combing projects (not nice, as we like the separation of concerns, but is a good opportunity to refactor away some dead wood). We are also looking at having multiple solutions to achieve greater separation of concerns and quicker compile times for each element of the application. This I can see will become a dll hell as we try to keep things in synch. I am interested to know how other teams have dealt with this scaling issue, what do you do when your code base reaches a critical mass that you are wasting half the day watching the status bar deliver compile messages UPDATE Apologies, I neglected to mention this is a C# solution. Thanks for all the cpp suggestions, but it's been a few years since I've had to worry about headers. At a distance I say I miss C++, but I'm not sure I want to go back EDIT: Nice suggestions that have helped so far (not saying there aren't other nice suggestions below, just what has helped) New 3GHz laptop - the power of lost utilization works wonders when whinging to management Disable Anti Virus during compile 'Disconnecting' from VSS (actually the network) during compile - I may get us to remove VS-VSS integration altogether and stick to using the VSS UI Still not rip-snorting through a compile, but every bit helps. Orion did mention in a comment that generics may have a play also. From my tests there does appear to be a minimal performance hit, but not high enough to sure - compile times can be inconsistent due to disc activity. Due to time limitations, my tests didn't include as many Generics, or as much code, as would appear in live system, so that may accumulate. I wouldn't avoid using generics where they are supposed to be used, just for compile time performance WORKAROUND We are testing the practice of building new areas of the application in new solutions, importing in the latest dlls as required, them integrating them into the larger solution when we are happy with them. We may also do them same to existing code by creating temporary solutions that just encapsulate the areas we need to work on, and throwing them away after reintegrating the code. We need to weigh up the time it will take to reintegrate this code against the time we gain by not having Rip Van Winkle like experiences with rapid recompiling during development.

  Read the article

• Accessing UI context from asynch task

  - by cdonner

  I came across this android example that runs an AsyncTask from a UI thread. The class ExportDatabaseTask is declared and instantiated in the Activity, and apparently it is possible to reference the activity's UI context from the onPreExecute and onPostExecute events, like this: public class ManageData extends Activity { private ExportDatabaseTask exportDatabaseTask; [...] @Override public void onCreate(final Bundle savedInstanceState) { [...] ManageData.this.exportDatabaseTask = new ExportDatabaseTask(); ManageData.this.exportDatabaseTask.execute(); [...] } private class ExportDatabaseTask extends AsyncTask<String, Void, Boolean> { private final ProgressDialog dialog = new ProgressDialog(ManageData.this); protected void onPreExecute() { this.dialog.setMessage("Exporting database..."); this.dialog.show(); } protected Boolean doInBackground(final String... args) { [...] } protected void onPostExecute(final Boolean success) { if (this.dialog.isShowing()) { this.dialog.dismiss(); } } } I am trying to refactor this so that the ExportDatabaseTask is declared in another class that is not the Activity, for various reasons, and I can't quite figure out how to make it work. I am lacking some basic Java concepts here, which I readily admit. Specifically, myActivity is null in onPreExecute(). Why is that? public void onClick(View v) { Exporter ex = new Exporter(getApplicationContext(), ActivityMain.this); ex.exportDatabaseTask.execute(); } public class Exporter { public ExportDatabaseTask exportDatabaseTask; public Exporter(Context ctx, ActivityMain act) { myContext = ctx; myActivity = act; this.exportDatabaseTask = new ExportDatabaseTask(); } public class ExportDatabaseTask extends AsyncTask<Void, Void, Boolean> { private final ProgressDialog dialog = new ProgressDialog(myContext); // can use UI thread here? protected void onPreExecute() { // ====> this throws a Nullpointer exception: myActivity.dialog.setMessage("Exporting database..."); myActivity.dialog.show(); } protected Boolean doInBackground(final Void... args) { } protected void onPostExecute(final Boolean success) { if (myActivity.dialog.isShowing()) { myActivity.dialog.dismiss(); } } } }

  Read the article

• How to load entities into private collections using the entity framework

  - by Anton P

  I have a POCO domain model which is wired up to the entity framework using the new ObjectContext class. public class Product { private ICollection<Photo> _photos; public Product() { _photos = new Collection<Photo>(); } public int Id { get; set; } public string Name { get; set; } public virtual IEnumerable<Photo> Photos { get { return _photos; } } public void AddPhoto(Photo photo) { //Some biz logic //... _photos.Add(photo); } } In the above example i have set the Photos collection type to IEnumerable as this will make it read only. The only way to add/remove photos is through the public methods. The problem with this is that the Entity Framework cannot load the Photo entities into the IEnumerable collection as it's not of type ICollection. By changing the type to ICollection will allow callers to call the Add mentod on the collection itself which is not good. What are my options? Edit: I could refactor the code so it does not expose a public property for Photos: public class Product { public Product() { Photos = new Collection<Photo>(); } public int Id { get; set; } public string Name { get; set; } private Collection<Photo> Photos {get; set; } public IEnumerable<Photo> GetPhotos() { return Photos; } public void AddPhoto(Photo photo) { //Some biz logic //... Photos.Add(photo); } } And use the GetPhotos() to return the collection. The other problem with the approach is that I will loose the change tracking abilities as I cannot mark the collection as Virtual - It is not possible to mark a property as private virtual. In NHibernate I believe it's possible to map the proxy class to the private collection via configuration. I hope that this will become a feature of EF4. Currently i don't like the inability to have any control over the collection!

  Read the article

• WPF DataTemplates with VS2010 designer support + reusable - would you do it that way?

  - by Christian

  Ok, I am currently tidying up all my old stuff. I ran into the issue of "code only DataTemplates" - which are really a pain in the ass. You can't see anything, they are really hard to design, and I want to improve my project. So I had the idea to use the following solution. The main benefits are: You have designer support for your data template You can easily include example sample data The file naming is consistent and easy to remember The preview does not require an additional XAML wrapper (even with code only controls) I will try to explain and illustrate my solution using a few pictures. I am interested in feedback, especially if you can imagine a better way to do it. And, of course, if you see any maintenance or performance issues. Ok, lets start with a simple PreviewObject. I want to have some data in it, so I create a subclass which will automatically fill in some dummy data. Then I add a list to the control, and name this list. Afterwards I add a DataTemplate, this is the sole reason for the whole control (to be able to see and edit the DataTemplate in place): Now I use this control to get my DataTemplate, to use it in other places. To make this easier, I added some code in the code behind, see here: Now I want a control to show me a list of PreviewItems, so I created a "code-only" control which creates an instance of my service (or gets one using DI in real world) and fills its list box with it: To view the result of this work, I added this control inside the same named XAML, this is basically only to be able to see the final result: What I do not like in this solution: The need to create the last control in "code only". So I tried something different while writing this post. The following two screenshots illustrate the approach. I am creating an instance of the service inside the DataContext, and I am using bindings to supply the Itemssourc and the ItemTemplate. The reason for the strange "static property" is refactoring support. If I hardcode the path in the designer (e.g. using "Path = PreviewHistory") and I refactor the names (which happens quite often, early design phase) - I screw up my controls without realizing it. Does anyone has a better idea for this? I am using Resharper, btw. Thanks for any input, and sorry for the image overkill. Just easier to explain that way.. Chris

  Read the article

• Do you still limit line length in code?

  - by Noldorin

  This is a matter on which I would like to gauge the opinion of the community: Do you still limit the length of lines of code to a fixed maximum? This was certainly a convention of the past for many languages; one would typically cap the number of characters per line to a value such as 80 (and more recnetly 100 or 120 I believe). As far as I understand, the primary reasons for limiting line length are: Readability - You don't have to scroll over horizontally when you want to see the end of some lines. Printing - Admittedly (at least in my experience), most code that you are working on does not get printed out on paper, but by limiting the number of characters you can insure that formatting doesn't get messed up when printed. Past editors (?) - Not sure about this one, but I suspect that at some point in the distant past of programming, (at least some) text editors may have been based on a fixed-width buffer. I'm sure there are points that I am still missing out, so feel free to add to these... Now, when I tend to observe C or C# code nowadays, I often see a number of different styles, the main ones being: Line length capped to 80, 100, or even 120 characters. As far as I understand, 80 is the traditional length, but the longer ones of 100 and 120 have appeared because of the widespread use of high resolutions and widescreen monitors nowadays. No line length capping at all. This tends to be pretty horrible to read, and I don't see it too often, though it's certainly not too rare either. Inconsistent capping of line length. The length of some lines are limited to a fixed maximum (or even a maximum that changes depending on the file/location in code), while others (possibly comments) are not at all. My personal preference here (at least recently) has been to cap the line length to 100 in the Visual Studio editor. This means that in a decently sized window (on a non-widescreen monitor), the ends of lines are still fully visible. I can however see a few disadvantages in this, especially when you end up writing code that's indented 3 or 4 levels and then having to include a long string literal - though I often take this as a sign to refactor my code! In particular, I am curious what the C and C# coders (or anyone who uses Visual Studio for that matter) think about this point, though I would be interested in hearing anyone's thoughts on the subject. Edit Thanks for the all answers - I appreciate the variety of opinions here, all presenting sound reasons. Consensus does seem to be tipping in the direction of always (or almost always) limit the line length. Interestingly, it seems to be in various coding standards to limit the line length. Judging by some of the answers, both the Python and Google CPP guidelines set the limit at 80 chars. I haven't seen anything similar regarding C# or VB.NET, but I would be curious to see if there are ones anywhere.

  Read the article

• Putting update logic in your migrations

  - by Daniel Abrahamsson

  A couple of times I've been in the situation where I've wanted to refactor the design of some model and have ended up putting update logic in migrations. However, as far as I've understood, this is not good practice (especially since you are encouraged to use your schema file for deployment, and not your migrations). How do you deal with these kind of problems? To clearify what I mean, say I have a User model. Since I thought there would only be two kinds of users, namely a "normal" user and an administrator, I chose to use a simple boolean field telling whether the user was an adminstrator or not. However, after I while I figured I needed some third kind of user, perhaps a moderator or something similar. In this case I add a UserType model (and the corresponding migration), and a second migration for removing the "admin" flag from the user table. And here comes the problem. In the "add_user_type_to_users" migration I have to map the admin flag value to a user type. Additionally, in order to do this, the user types have to exist, meaning I can not use the seeds file, but rather create the user types in the migration (also considered bad practice). Here comes some fictional code representing the situation: class CreateUserTypes < ActiveRecord::Migration def self.up create_table :user_types do |t| t.string :name, :nil => false, :unique => true end #Create basic types (can not put in seed, because of future migration dependency) UserType.create!(:name => "BASIC") UserType.create!(:name => "MODERATOR") UserType.create!(:name => "ADMINISTRATOR") end def self.down drop_table :user_types end end class AddTypeIdToUsers < ActiveRecord::Migration def self.up add_column :users, :type_id, :integer #Determine type via the admin flag basic = UserType.find_by_name("BASIC") admin = UserType.find_by_name("ADMINISTRATOR") User.all.each {|u| u.update_attribute(:type_id, (u.admin?) ? admin.id : basic.id)} #Remove the admin flag remove_column :users, :admin #Add foreign key execute "alter table users add constraint fk_user_type_id foreign key (type_id) references user_types (id)" end def self.down #Re-add the admin flag add_column :users, :admin, :boolean, :default => false #Reset the admin flag (this is the problematic update code) admin = UserType.find_by_name("ADMINISTRATOR") execute "update users set admin=true where type_id=#{admin.id}" #Remove foreign key constraint execute "alter table users drop foreign key fk_user_type_id" #Drop the type_id column remove_column :users, :type_id end end As you can see there are two problematic parts. First the row creation part in the first model, which is necessary if I would like to run all migrations in a row, then the "update" part in the second migration that maps the "admin" column to the "type_id" column. Any advice?

  Read the article

• Turn class "Interfaceable"

  - by scooterman

  Hi folks, On my company system, we use a class to represent beans. It is just a holder of information using boost::variant and some serialization/deserialization stuff. It works well, but we have a problem: it is not over an interface, and since we use modularization through dlls, building an interface for it is getting very complicated, since it is used in almost every part of our app, and sadly interfaces (abstract classes ) on c++ have to be accessed through pointers, witch makes almost impossible to refactor the entire system. Our structure is: dll A: interface definition through abstract class dll B: interface implementation there is a painless way to achieve that (maybe using templates, I don't know) or I should forget about making this work and simply link everything with dll B? thanks Edit: Here is my example. this is on dll A BeanProtocol is a holder of N dataprotocol itens, wich are acessed by a index. class DataProtocol; class UTILS_EXPORT BeanProtocol { public: virtual DataProtocol& get(const unsigned int ) const { throw std::runtime_error("Not implemented"); } virtual void getFields(std::list<unsigned int>&) const { throw std::runtime_error("Not implemented"); } virtual DataProtocol& operator[](const unsigned int ) { throw std::runtime_error("Not implemented"); } virtual DataProtocol& operator[](const unsigned int ) const { throw std::runtime_error("Not implemented"); } virtual void fromString(const std::string&) { throw std::runtime_error("Not implemented"); } virtual std::string toString() const { throw std::runtime_error("Not implemented"); } virtual void fromBinary(const std::string&) { throw std::runtime_error("Not implemented"); } virtual std::string toBinary() const { throw std::runtime_error("Not implemented"); } virtual BeanProtocol& operator=(const BeanProtocol&) { throw std::runtime_error("Not implemented"); } virtual bool operator==(const BeanProtocol&) const { throw std::runtime_error("Not implemented"); } virtual bool operator!=(const BeanProtocol&) const { throw std::runtime_error("Not implemented"); } virtual bool operator==(const char*) const { throw std::runtime_error("Not implemented"); } virtual bool hasKey(unsigned int field) const { throw std::runtime_error("Not implemented"); } }; the other class (named GenericBean) implements it. This is the only way I've found to make this work, but now I want to turn it in a truly interface and remove the UTILS_EXPORT (which is an _declspec macro), and finally remove the forced linkage of B with A.

  Read the article

• How to make freelance clients understand the costs of developing and maintaining mature products?

  - by John

  I have a freelance web application project where the client requests new features every two weeks or so. I am unable to anticipate the requirements of upcoming features. So when the client requests a new feature, one of several things may happen: I implement the feature with ease because it is compatible with the existing platform I implement the feature with difficulty because I have to rewrite a significant portion of the platform's foundation Client withdraws request because it costs too much to implement against existing platform At the beginning of the project, for about six months, all feature requests fell under category 1) because the system was small and agile. But for the past six months, most feature implementation fell under category 2). The system is mature, forcing me to refactor and test everytime I want to add new modules. Additionally, I find myself breaking things that use to work, and fixing it (I don't get paid for this). The client is starting to express frustration at the time and cost for me to implement new features. To them, many of the feature requests are of the same scale as the features they requested six months ago. For example, a client would ask, "If it took you 1 week to build a ticketing system last year, why does it take you 1 month to build an event registration system today? An event registration system is much simpler than a ticketing system. It should only take you 1 week!" Because of this scenario, I fear feature requests will soon land in category 3). In fact, I'm already eating a lot of the cost myself because I volunteer many hours to support the project. The client is often shocked when I tell him honestly the time it takes to do something. The client always compares my estimates against the early months of a project. I don't think they're prepared for what it really costs to develop, maintain and support a mature web application. When working on a salary for a full time company, managers were more receptive of my estimates and even encouraged me to pad my numbers to prepare for the unexpected. Is there a way to condition my clients to think the same way? Can anyone offer advice on how I can continue to work on this web project without eating too much of the cost myself? Additional info - I've only been freelancing full time for 1 year. I don't yet have the high end clients, but I'm slowly getting there. I'm getting better quality clients as time goes by.

  Read the article

• Django admin fails when using includes in urlpatterns

  - by zenWeasel

  I am trying to refactor out my application a little bit to keep it from getting too unwieldily. So I started to move some of the urlpatterns out to sub files as the documentation proposes. Besides that fact that it just doesn't seem to be working (the items are not being rerouted) but when I go to the admin, it says that 'urlpatterns has not been defined'. The urls.py I have at the root of my application is: if settings.ENABLE_SSL: urlpatterns = patterns('', (r'^checkout/orderform/onepage/(\w*)/$','checkout.views.one_page_orderform',{'SSL':True},'commerce.checkout.views.single_product_orderform'), ) else: urlpatterns = patterns('', (r'^checkout/orderform/onepage/(\w*)/$','commerce.checkout.views.single_product_orderform'), ) urlpatterns+= patterns('', (r'^$', 'alchemysites.views.route_to_home'), (r'^%s/' % settings.DAJAXICE_MEDIA_PREFIX, include('dajaxice.urls')), (r'^/checkout/', include('commerce.urls')), (r'^/offers',include('commerce.urls')), (r'^/order/',include('commerce.urls')), (r'^admin/', include(admin.site.urls)), (r'^accounts/login/$', login), (r'^accounts/logout/$', logout), (r'^(?P<path>.*)/$','alchemysites.views.get_path'), (r'^static/(?P<path>.*)$', 'django.views.static.serve', {'document_root':settings.MEDIA_ROOT}), The urls I have moved out so far are the checkout/offers/order which are all subapps of 'commerce' where the urls.py for the apps are so to be clear. /urls.py in questions (included here) /commerce/urls.py where the urls.py I want to include is: order_info = { 'queryset': Order.objects.all(), } urlpatterns+= patterns('', (r'^offers/$','offers.views.start_offers'), (r'^offers/([a-zA-Z0-9-]*)/order/(\d*)/add/([a-zA-Z0-9-]*)/(\w*)/next/([a-zA-Z0-9-)/$','offers.views.show_offer'), (r'^reports/orders/$', list_detail.object_list,order_info), ) and the applications offers lies under commerce. And so the additional problem is that admin will not work at all, so I'm thinking because I killed it somewhere with my includes. Things I have checked for: Is the urlpatterns variable accidentally getting reset somewhere (i.e. urlpatterns = patterns, instead of urlpatterns+= patterns) Are the patterns in commerce.urls valid (yes, when moved back to root they work). So from there I am stumped. I can move everything back into the root, but was trying to get a little decoupled, not just for theoretical reason but for some short terms ones. Lastly if I enter www.domainname/checkout/orderform/onepage/xxxjsd I get the correct page. However, entering www.domainname/checkout/ gets handled by the alchemysites.views.get_path. If not the answer (because this is pretty darn specific), then is there a good way for troubleshoot urls.py? It seems to just be trial and error. Seems there should be some sort of parser that will tell you what your urlpatterns will do.

  Read the article

• Rails. Putting update logic in your migrations

  - by Daniel Abrahamsson

  A couple of times I've been in the situation where I've wanted to refactor the design of some model and have ended up putting update logic in migrations. However, as far as I've understood, this is not good practice (especially since you are encouraged to use your schema file for deployment, and not your migrations). How do you deal with these kind of problems? To clearify what I mean, say I have a User model. Since I thought there would only be two kinds of users, namely a "normal" user and an administrator, I chose to use a simple boolean field telling whether the user was an adminstrator or not. However, after I while I figured I needed some third kind of user, perhaps a moderator or something similar. In this case I add a UserType model (and the corresponding migration), and a second migration for removing the "admin" flag from the user table. And here comes the problem. In the "add_user_type_to_users" migration I have to map the admin flag value to a user type. Additionally, in order to do this, the user types have to exist, meaning I can not use the seeds file, but rather create the user types in the migration (also considered bad practice). Here comes some fictional code representing the situation: class CreateUserTypes < ActiveRecord::Migration def self.up create_table :user_types do |t| t.string :name, :nil => false, :unique => true end #Create basic types (can not put in seed, because of future migration dependency) UserType.create!(:name => "BASIC") UserType.create!(:name => "MODERATOR") UserType.create!(:name => "ADMINISTRATOR") end def self.down drop_table :user_types end end class AddTypeIdToUsers < ActiveRecord::Migration def self.up add_column :users, :type_id, :integer #Determine type via the admin flag basic = UserType.find_by_name("BASIC") admin = UserType.find_by_name("ADMINISTRATOR") User.all.each {|u| u.update_attribute(:type_id, (u.admin?) ? admin.id : basic.id)} #Remove the admin flag remove_column :users, :admin #Add foreign key execute "alter table users add constraint fk_user_type_id foreign key (type_id) references user_types (id)" end def self.down #Re-add the admin flag add_column :users, :admin, :boolean, :default => false #Reset the admin flag (this is the problematic update code) admin = UserType.find_by_name("ADMINISTRATOR") execute "update users set admin=true where type_id=#{admin.id}" #Remove foreign key constraint execute "alter table users drop foreign key fk_user_type_id" #Drop the type_id column remove_column :users, :type_id end end As you can see there are two problematic parts. First the row creation part in the first model, which is necessary if I would like to run all migrations in a row, then the "update" part in the second migration that maps the "admin" column to the "type_id" column. Any advice?

  Read the article

• Looking for RESTful Suggestions In Porting ASP.NET to MVC.NET

  - by DaveDev

  I've been tasked with porting/refactoring a Web Application Platform that we have from ASP.NET to MVC.NET. Ideally I could use all the existing platform's configurations to determine the properties of the site that is presented. Is it RESTful to keep a SiteConfiguration object which contains all of our various page configuration data in the System.Web.Caching.Cache? There are a lot of settings that need to be loaded when the user acceses our site so it's inefficient for each user to have to load the same settings every time they access. Some data the SiteConfiguration object contains is as follows and it determines what Master Page / site configuration / style / UserControls are available to the client, public string SiteTheme { get; set; } public string Region { private get; set; } public string DateFormat { get; set; } public string NumberFormat { get; set; } public int WrapperType { private get; set; } public string LabelFileName { get; set; } public LabelFile LabelFile { get; set; } // the following two are the heavy ones // PageConfiguration contains lots of configuration data for each panel on the page public IList<PageConfiguration> Pages { get; set; } // This contains all the configurations for the factsheets we produce public List<ConfiguredFactsheet> ConfiguredFactsheets { get; set; } I was thinking of having a URL structure like this: www.MySite1.com/PageTemplate/UserControl/ the domain determines the SiteConfiguration object that is created, where MySite1.com is SiteId = 1, MySite2.com is SiteId = 2. (and in turn, style, configurations for various pages, etc.) PageTemplate is the View that will be rendered and simply defines a layout for where I'm going to inject the UserControls Can somebody please tell me if I'm completely missing the RESTful point here? I'd like to refactor the platform into MVC because it's better to work in but I want to do it right but with a minimum of reinventing-the-wheel because otherwise it won't get approval. Any suggestions otherwise? Thanks

  Read the article

• Looking for an Open Source Project in need of help

  - by hvidgaard

  Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

  Read the article

• Overwhelmed by design patterns... where to begin?

  - by Pete

  I am writing a simple prototype code to demonstrate & profile I/O schemes (HDF4, HDF5, HDF5 using parallel IO, NetCDF, etc.) for a physics code. Since focus is on IO, the rest of the program is very simple: class Grid { public: floatArray x,y,z; }; class MyModel { public: MyModel(const int &nip1, const int &njp1, const int &nkp1, const int &numProcs); Grid grid; map<string, floatArray> plasmaVariables; }; Where floatArray is a simple class that lets me define arbitrary dimensioned arrays and do mathematical operations on them (i.e. x+y is point-wise addition). Of course, I could use better encapsulation (write accessors/setters, etc.), but that's not the concept I'm struggling with. For the I/O routines, I am envisioning applying simple inheritance: Abstract I/O class defines read & write functions to fill in the "myModel" object HDF4 derived class HDF5 HDF5 using parallel IO NetCDF etc... The code should read data in any of these formats, then write out to any of these formats. In the past, I would add an AbstractIO member to myModel and create/destroy this object depending on which I/O scheme I want. In this way, I could do something like: myModelObj.ioObj->read('input.hdf') myModelObj.ioObj->write('output.hdf') I have a bit of OOP experience but very little on the Design Patterns front, so I recently acquired the Gang of Four book "Design Patterns: Elements of Reusable Object-Oriented Software". OOP designers: Which pattern(s) would you recommend I use to integrate I/O with the myModel object? I am interested in answering this for two reasons: To learn more about design patterns in general Apply what I learn to help refactor an large old crufty/legacy physics code to be more human-readable & extensible. I am leaning towards applying the Decerator pattern to myModel, so I can attach the I/O responsibilities dynamically to myModel (i.e. whether to use HDF4, HDF5, etc.). However, I don't feel very confident that this is the best pattern to apply. Reading the Gang of Four book cover-to-cover before I start coding feels like a good way to develop an unhealthy caffeine addiction. What patterns do you recommend?

  Read the article

• Delphi Unit local variables - how to make each instance unique?

  - by Justin

  Ok, this, I'm sure is something simple that is easy to do. The problem : I've inherited scary spaghetti code and am slowly trying to better it when new features need adding - generally when a refactor makes adding the new feature neater. I've got a bunch of code I'm packing into a single unit which, in different places in the application, controls the same physical thing in the outside world. The control appears in several places in the application and operates slightly differently in each instance. What I've done is to create a unit with all of the features I need which I can simply drop, as a frame, into each form that requires it. Each form then uses the unit's interface methods to customise the behaviour for each instance. The problem within the problem : In the unit in question (the frame) I have a variable declared in the IMPLEMENTATION section - local to the unit. I also have a procedure, declared in the TYPE section which takes an argument and assigns that argument to the local variable in question - each form passes a unique variable to each instance of the frame/unit. What I want it to do is for each instance of the frame to keep its own version of that variable, different from the others, and use that to define how it operates. What seems to be happening, however, is that all instances are using the same value, even if I explicitly pass each instance a different variable. ie: Unit FlexibleUnit; interface uses //the uses stuff type TFlexibleUnit=class(TFrame) //declarations including procedure makeThisInstanceX(passMeTheVar:integer); private // public // end; implementation uses //the uses var myLocalVar; procedure makeThisInstanceX(passMeTheVar:integer); begin myLocalVar:=passMeTheVar; end; //other procedures using myLocalVar //etc to the end; Now somewhere in another Form I've dropped this Frame onto the Design pane, sometimes two of these frames on one Form, and have it declared in the proper places, etc. Each is unique in that : ThisFlexibleUnit : TFlexibleUnit; ThatFlexibleUnit : TFlexibleUnit; and when I do a: ThisFlexibleUnit.makeThisInstanceX(var1); //want to behave in way "var1" ThatFlexibleUnit.makeThisInstanceX(var2); //want to behave in way "var2" it seems that they both share the same variable "myLocalVar". Am I doing this wrong, in principle? If this is the correct method then it's a matter of debugging what I have (which is too huge to post) but if this is not correct in principle then is there a way to do what I am suggesting? Thanks in advance, Stack Overflow - you guys (and gals!) are legendary.

  Read the article

• How do I do distributed UML development (à la FOSS)?

  - by James A. Rosen

  I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Getting up to speed on modern architecture

  - by Matt Thrower

  Hi, I don't have any formal qualifications in computer science, rather I taught myself classic ASP back in the days of the dotcom boom and managed to get myself a job and my career developed from there. I was a confident and, I think, pretty good programmer in ASP 3 but as others have observed one of the problems with classic ASP was that it did a very good job of hiding the nitty-gritty of http so you could become quite competent as a programmer on the basis of relatively poor understanding of the technology you were working with. When I changed on to .NET at first I treated it like classic ASP, developing stand-alone applications as individual websites simply because I didn't know any better at the time. I moved jobs at this point and spent the next several years working on a single site whose architecture relied heavily on custom objects: in other words I gained a lot of experience working with .NET as a middle-tier development tool using a quite old-fashioned approach to OO design along the lines of the classic "car" class example that's so often used to teach OO. Breaking down programs into blocks of functionality and basing your classes and methods around that. Although we worked under an Agile approach to manage the work the whole setup was classic client/server stuff. That suited me and I gradually got to grips with .NET and started using it far more in the manner that it should be, and I began to see the power inherent in the technology and precisely why it was so much better than good old ASP 3. In my latest job I have found myself suddenly dropped in at the deep end with two quite young, skilled and very cutting-edge programmers. They've built a site architecture which is modelling along a lot of stuff which is new to me and which, in truth I'm having a lot of trouble understanding. The application is built on a cloud computing model with multi-tenancy and the architecture is all loosely coupled using a lot of interfaces, factories and the like. They use nHibernate a lot too. Shortly after I joined, both these guys left and I'm now supposedly the senior developer on a system whose technology and architecture I don't really understand and I have no-one to ask questions of. Except you, the internet. Frankly I feel like I've been pitched in at the deep end and I'm sinking. I'm not sure if this is because I lack the educational background to understand this stuff, if I'm simply not mathematically minded enough for modern computing (my maths was never great - my approach to design is often to simply debug until it works, then refactor until it looks neat), or whether I've simply been presented with too much of too radical a nature at once. But the only way to find out which it is is to try and learn it. So can anyone suggest some good places to start? Good books, tutorials or blogs? I've found a lot of internet material simply presupposes a level of understanding that I just don't have. Your advice is much appreciated. Help a middle-aged, stuck in the mud developer get enthusastic again! Please!

  Read the article

< Previous Page | 21 22 23 24 25 26 27  | Next Page >