Search Results

Search found 42421 results on 1697 pages for 'page numbers'.

Page 26/1697 | < Previous Page | 22 23 24 25 26 27 28 29 30 31 32 33  | Next Page >

  • get data from asp page

    - by sam
    I am wondering if there is anyway to grab the html that is generated from an ASP page. I am trying to pull a table from the page, and I foolishly used a static html page so I would not have to be constantly querying the server where this page resides while I tested out my code. The javascript code I wrote to grab to unlabeled table from the page works. Then when I put it into practice with the real page and found that the ASP page does not generate a viewable page with a jquery .get request on the URL. Is there any way to query the page for the table I need so that the ASP page returns a valid page on request? (I am also limited to using javascript and perl for this, the server where this will reside will not run php and I have no desire to learn ASP.NET to solve this by adding to the issue of proprietary software)

    Read the article

  • Five unique, random numbers from a subset

    - by tau
    I know similar questions come up a lot and there's probably no definitive answer, but I want to generate five unique random numbers from a subset of numbers that is potentially infinite (maybe 0-20, or 0-1,000,000). The only catch is that I don't want to have to run while loops or fill an array. My current method is to simply generate five random numbers from a subset minus the last five numbers. If any of the numbers match each other, then they go to their respective place at the end of the subset. So if the fourth number matches any other number, it will bet set to the 4th from the last number. Does anyone have a method that is "random enough" and doesn't involve costly loops or arrays? Please keep in mind this a curiosity, not some mission-critical problem. I would appreciate it if everyone didn't post "why are you having this problem?" answers. I am just looking for ideas. Thanks a lot!

    Read the article

  • Using a set of numbers inside a database without creating a temporary table

    - by Zizzencs
    I have a set of numbers and a table in a database with the id (primary key) and text (not null) columns. I would like to create a query that returns all the numbers in the set and the associated text from the table. Unfortunately not all numbers exist in the database's id column, so this won't work: select id, text from table where id in (<set of numbers>) For the non-existing ids the best would be to return null as the text from the query. Is there a way to produce the desired output without first creating a temporary table from the set inside the database? The database engine in use is a Microsoft SQL Server 2008 SP1 but I'd be interested in any solution with any database engine.

    Read the article

  • Javascript Number Random Scrambler

    - by stjowa
    Hi, I need a Javascript random number scrambler for my website. Seems simple, but I can not figure out how to do it. Can anyone help me out? I have the following array of numbers: 1 2 3 4 5 6 7 8 9 I would like to be able to have these numbers scrambled randomly. Like the following: 3 6 4 2 9 5 1 8 7 or 4 1 7 3 5 9 2 6 8 So, specifically, I would like a function that takes in an array of numbers (1 - n) and then returns that same array of numbers - scrambled randomly with different calls to the function. Maybe a noob function, but can't seem to figure it out. Thanks!

    Read the article

  • Unable to Export contents of Data table (with French formatted Numbers ) to XML

    - by Ananth
    I have a data Table with numbers formatted according to the current regional settings. ie ( in French decimal separators are ',' instead of '.' in English). I need to export it to XML. Numbers in XML needs to be formatted according to the current regional settings.But now numbers in XML are formatted in English.Is there any way to make the number formatting in XML according to current regional settings ( or based on the locale of the Data Table) during the exporting process ?

    Read the article

  • Find numbers that equals a sum in an array

    - by valli-R
    I want to find the first set of integers in an array X that the sum equals a given number N. For example: X = {5, 13, 24, 9, 3, 3} N = 28 Solution = {13, 9, 3, 3} Here what I have so far : WARNING, I know it uses global and it is bad,that's not the point of the question. <?php function s($index = 0, $total = 0, $solution = '') { global $numbers; global $sum; echo $index; if($total == 28) { echo '<br/>'.$solution.' = '.$sum.'<br/>'; } elseif($index < count($numbers) && $total != 28) { s($index + 1, $total, $solution); s($index + 1, $total + $numbers[$index], $solution.' '.$numbers[$index]); } } $numbers = array(5, 13, 24, 9, 3, 3); $sum = 28; s(); ?> I don't get how I can stop the process when it finds the solution.. I know I am not far from good solution.. Thanks in advance

    Read the article

  • Haskell. Numbers in binary numbers. words

    - by Katja
    Hi! I need to code words into binary numbers. IN: "BCD..." OUT:1011... I have written already funktion for coding characters into siple numbers IN: 'C' OUT: 3 IN: 'c' OUT: 3 lett2num :: Char -> Int lett2num x | (ord 'A' <= ord x) && (ord x <= ord 'Z') = (ord x - ord 'A') + 1 | (ord 'a' <= ord x) && (ord x <= ord 'z') = (ord x - ord 'a') +1 num2lett :: Int -> Char num2lett n | (n <= ord 'A') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) | (n <= ord 'a') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) I wrote as well function for codind simple numbers into binary. num2bin :: Int->[Int] num2bin 0 = [] num2bin n | n>=0 = n `mod` 2 : (num2bin( n `div` 2)) | otherwise = error but I donw want those binary numbers to be in a list how can I get rid of the lists? Thanks

    Read the article

  • How can I most accurately calculate the execution time of an ASP.NET page while also displaying it o

    - by henningst
    I want to calculate the execution time of my ASP.NET pages and display it on the page. Currently I'm calculating the execution time using a System.Diagnostics.Stopwatch and then store the value in a log database. The stopwatch is started in OnInit and stopped in OnPreRenderComplete. This seems to be working quite fine, and it's giving a similar execution time as the one shown in the page trace. The problem now is that I'm not able to display the execution time on the page because the stopwatch is stopped too late in the life cycle. What is the best way to do this?

    Read the article

  • Best way to associate phone numbers with names

    - by Horace Loeb
    My application stores lots of its users friends' phone numbers. I'd like to allow users to associate names with these phone numbers, but I don't want to make users manually type in names (obviously). I'm curious what the best overall approach is here, as well as the best way to implement it Overall approach-wise, I imagine using Gmail / Yahoo / Windows Live contacts is best (the Facebook API doesn't let you access phone numbers), though the gems I've found for interacting with these contacts APIs (this and this) only give you access to the names and email addresses of each contact.

    Read the article

  • Will_paginate Plugin on two objects on same page

    - by piemesons
    Hello I am using will_paginte plugin on two objects on a same page. Like on stackoverflow. There is a profile page on which there is a pagination on two things QUestions and answers. I am having problem ie:-- when user is clicking on questions pagination page 2. answers page are also updating. The reason is both is sending a post variable ie params[:page] How to change this variable so that only one should be updated. and how to maintain that user should not lose the other page. ie he is on 3rd page of questions and 1st page of answers and now he click on 5th page of the questions the result should be 3rd page of questions and 5th page of answers.

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • Extract string that is delimited with constant and ends with two numbers (numbers have to be included)

    - by Edmon
    I have a text that contains string of a following structure: text I do not care about, persons name followed by two IDs. I know that: a person's name is always preceded by XYZ code and that is always followed by two, space separated numbers. Name is not always just a last name and first name. It can be multiple last or first names (think Latin american names). So, I am looking to extract string that follows the constant XYZ code and that is always terminated by two separate numbers. You can say that my delimiter is XYZ and two numbers, but numbers need to be part of the extracted value as well. From blah, blah XYZ names, names 122322 344322 blah blah I want to extract: names, names 122322 344322 Would someone please advise on the regular expression for this that would work with Python's re package.

    Read the article

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • asp.net could a half submitted web page be processed?

    - by c00ke
    Having a weird bug in production and just wondering if it's possible for a half submitted web page to processed by the server? The page has no view state just using plain old html controls and accessing data displayed in repeater on the back end via Request.Form[name] etc. Is it possible for a request to be truncated perhaps due to lost internet connection and the page still processed by the server. Therefore if field not part of the request Request.Form[name] could result in null? I know can use fiddler to modify request but unfortunately we are not allowed to change group policy and change the proxy! Many Thanks

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • What guidelines should be followed when implementing third-party tracking pixels?

    - by Strozykowski
    Background I work on a website that gets a fair amount of traffic, and as such, we have implemented different tracking pixels and techniques across the site for various specific reasons. Because there are many agencies who are sending traffic our way through email campaigns, print ads and SEM, we have agreements with a variety of different outside agencies for tracking these page hits. Consequently, we have tracking pixels which span the entire site, as well as some that are on specific pages only. We have worked to reduce the total number of pixels available on any one page, but occasionally the site is rendered close to unusable when one of these third-party tracking pixels fails to load. This is a huge difficulty on parts of the site where Javascript is needed for functionality built into the page, but is unable to initialize until a 404 is returned on the external tracking pixel. (Sometimes up to 30 seconds later) I have spent some time attempting to research how other firms deal with this sort of instability with third-party components, but have come up a bit short. The plan currently is to implement our own stop-gap method to deal with these external outages, but rather than reinventing the wheel, we wanted to find out how this is dealt with on other sites. Question Is there a good set of guidelines that should be followed when implementing third-party tracking pixels? I would love to see some white papers or other written documents about how other people have dealt with this issue.

    Read the article

  • How to use SharePoint modal dialog box to display Custom Page Part3

    - by ybbest
    In the second part of the series, I showed you how to display and close a custom page in a SharePoint modal dialog using JavaScript and display a message after the modal dialog is closed. In this post, I’d like to show you how to use SPLongOperation with the Modal dialog box. You can download the source code here. 1. Firstly, modify the element file as follow <Elements xmlns="http://schemas.microsoft.com/sharepoint/"> <CustomAction Id="ReportConcern" RegistrationType="ContentType" RegistrationId="0x010100866B1423D33DDA4CA1A4639B54DD4642" Location="EditControlBlock" Sequence="107" Title="Display Custom Page" Description="To Display Custom Page in a modal dialog box on this item"> <UrlAction Url="javascript: function emitStatus(messageToDisplay) { statusId = SP.UI.Status.addStatus(messageToDisplay.message + ' ' +messageToDisplay.location ); SP.UI.Status.setStatusPriColor(statusId, 'Green'); } function portalModalDialogClosedCallback(result, value) { if (value !== null) { emitStatus(value); } } var options = { url: '{SiteUrl}' + '/_layouts/YBBEST/TitleRename.aspx?List={ListId}&amp;ID={ItemId}', title: 'Rename title', allowMaximize: false, showClose: true, width: 500, height: 300, dialogReturnValueCallback: portalModalDialogClosedCallback }; SP.UI.ModalDialog.showModalDialog(options);" /> </CustomAction> </Elements> 2. In your code behind, you can implement a close dialog function as below. This will close your modal dialog box once the button is clicked and display a status bar. Note that you need to use window.frameElement.commonModalDialogClose instead of window.frameElement.commonModalDialogClose protected void SubmitClicked(object sender, EventArgs e) { //Process stuff string message = "You clicked the Submit button"; string newLocation="http://www.google.com"; string information = string.Format("{{'message':'{0}','location':'{1}' }}", message, newLocation); var longOperation = new SPLongOperation(Page); longOperation.LeadingHTML = "Processing the  application"; longOperation.TrailingHTML = "Please wait while the application is being processed."; longOperation.Begin(); Thread.Sleep(5*1000); var closeDialogScript = GetCloseDialogScriptForLongProcess(information); longOperation.EndScript(closeDialogScript); } protected static string GetCloseDialogScriptForLongProcess(string message) { var scriptBuilder = new StringBuilder(); scriptBuilder.Append("window.frameElement.commonModalDialogClose(1,").Append(message).Append(");"); return scriptBuilder.ToString(); }   References: How to: Display a Page as a Modal Dialog Box

    Read the article

  • How to use SharePoint modal dialog box to display Custom Page Part3

    - by ybbest
    In the second part of the series, I showed you how to display and close a custom page in a SharePoint modal dialog using JavaScript and display a message after the modal dialog is closed. In this post, I’d like to show you how to use SPLongOperation with the Modal dialog box. You can download the source code here. 1. Firstly, modify the element file as follow <Elements xmlns="http://schemas.microsoft.com/sharepoint/"> <CustomAction Id="ReportConcern" RegistrationType="ContentType" RegistrationId="0x010100866B1423D33DDA4CA1A4639B54DD4642" Location="EditControlBlock" Sequence="107" Title="Display Custom Page" Description="To Display Custom Page in a modal dialog box on this item"> <UrlAction Url="javascript: function emitStatus(messageToDisplay) { statusId = SP.UI.Status.addStatus(messageToDisplay.message + ' ' +messageToDisplay.location ); SP.UI.Status.setStatusPriColor(statusId, 'Green'); } function portalModalDialogClosedCallback(result, value) { if (value !== null) { emitStatus(value); } } var options = { url: '{SiteUrl}' + '/_layouts/YBBEST/TitleRename.aspx?List={ListId}&amp;ID={ItemId}', title: 'Rename title', allowMaximize: false, showClose: true, width: 500, height: 300, dialogReturnValueCallback: portalModalDialogClosedCallback }; SP.UI.ModalDialog.showModalDialog(options);" /> </CustomAction> </Elements> 2. In your code behind, you can implement a close dialog function as below. This will close your modal dialog box once the button is clicked and display a status bar. Note that you need to use window.frameElement.commonModalDialogClose instead of window.frameElement.commonModalDialogClose protected void SubmitClicked(object sender, EventArgs e) { //Process stuff string message = "You clicked the Submit button"; string newLocation="http://www.google.com"; string information = string.Format("{{'message':'{0}','location':'{1}' }}", message, newLocation); var longOperation = new SPLongOperation(Page); longOperation.LeadingHTML = "Processing the  application"; longOperation.TrailingHTML = "Please wait while the application is being processed."; longOperation.Begin(); Thread.Sleep(5*1000); var closeDialogScript = GetCloseDialogScriptForLongProcess(information); longOperation.EndScript(closeDialogScript); } protected static string GetCloseDialogScriptForLongProcess(string message) { var scriptBuilder = new StringBuilder(); scriptBuilder.Append("window.frameElement.commonModalDialogClose(1,").Append(message).Append(");"); return scriptBuilder.ToString(); }   References: How to: Display a Page as a Modal Dialog Box

    Read the article

< Previous Page | 22 23 24 25 26 27 28 29 30 31 32 33  | Next Page >