Search Results

Search found 35149 results on 1406 pages for 'yield return'.

Page 266/1406 | < Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >

  • wcf message size causing permission issue

    - by Ferrell Carr
    silverlight 3.0 client wcf 3.0 VS.Net 2005 Web Site Win 2003 Server 50 column observable collection. return observable collection select top 975 * ... no problem return observable collection select * .... Issue On SL client after proxy.Get 50 col OC logon screen from win 2003 server pops up Mever makes it to the completed event.

    Read the article

  • jQuery selector not working in IE

    - by CurlyFro
    this method should return a unique array of text from rows with a specific td class. works in ffs and chrome but not in ie8 or safari. can you spot the problem? function getUniqueIds() { var tblLnks = new Array(); $('td.tblLnk').each(function() { tblLnks.push($(this).text().trim()); }); return tblLnks.unique(); }

    Read the article

  • javascript function is not getting called onclick of hx:commandButton

    - by Sunny Mate
    When I click on the hx:commandButton the method should get called but the method is not getting called. My code is as follows: function test() { alert('ss'); return "true"; } and method calling is : <hx:commandExButton type="submit" value="Search" styleClass="action2" id="searchButton" onclick="return test();" action="#{pc_WorkInProgressUserGrid.doSearchButtonAction}" immediate="true"> </hx:commandExButton> Any suggestion would be helpful.

    Read the article

  • Returning char* in function

    - by Devel
    I have function: char *zap(char *ar) { char pie[100] = "INSERT INTO test (nazwa, liczba) VALUES ('nowy wpis', '"; char dru[] = "' )"; strcat(pie, ar); strcat(pie, dru); return pie; } and in main there is: printf("%s", zap( argv[1] ) ); When compiling I get the warning: test.c: In function ‘zap’: test.c:17: warning: function returns address of local variable How should I return char* propertly?

    Read the article

  • UITableView: Handle cell selection in a mixed cell table view static and dynamic cells

    - by AlexR
    I am trying to mix dynamic and static cells in a grouped table view: I would like to get two sections with static cells at the top followed by a section of dynamic cells (please refer to the screenshot below). I have set the table view contents to static cells. Edit Based on AppleFreak's advice I have changed my code as follows: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell; if (indexPath.section <= 1) { // section <= 1 indicates static cells cell = [super tableView:tableView cellForRowAtIndexPath:indexPath]; } else { // section > 1 indicates dynamic cells CellIdentifier = [NSString stringWithFormat:@"section%idynamic",indexPath.section]; cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier forIndexPath:indexPath]; } return cell; } However, my app crashes with error message Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'UITableView dataSource must return a cell from tableView:cellForRowAtIndexPath:' for section 0 and row 0. The cell returned from cell = [super tableView:tableView cellForRowAtIndexPath:indexPath] for section 0 and row 0 is nil. What is wrong with my code? Could there be any problems with my outlets? I haven't set any outlets because I am subclassing UITableViewController and supposedly do not any outlets for tableview to be set (?). Any suggestions on how to better do it? Edit II I have recreated my scene in storyboard (please refer to my updated screen shot above) and rewritten the view controller in order to start from a new base. I have also read the description in Apple's forum as applefreak suggested. However, I run in my first problem with the method numberOfSectionsInTableView:tableView, in which I increment the number of static sections (two) by one. - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return [super numberOfSectionsInTableView:tableView] + 1 ; } The app crashed with the error message: Terminating app due to uncaught exception 'NSRangeException', reason: '* -[__NSArrayI objectAtIndex:]: index 2 beyond bounds [0 .. 1]' Why is this code not working for me even though I followed Apple's and applefreak recommendations? It is possible that the tableView has changed a bit in iOS 6? Solution: I got this to work now using AppleFreaks code sample in his answer below. Thank you, AppleFreak! Edit III: Cell Selection: How can I handle cell selection in a mixed (dynamic and static cells) cell table view? When do I call super and when do I call self tableView? When I use [[super tableView] selectRowAtIndexPath:indexPath animated:NO scrollPosition:UITableViewScrollPositionNone] and try to check for the selected index paths with: UITableView *tableView = [super tableView]; if ( [[tableView indexPathForSelectedRow] isEqual:customGrowthIndexPath] ) { .. } I get an return value of nil. As I can't find the source of my error, I really would appreciate your help

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • Error in Print Function in Bubble Sort MIPS?

    - by m00nbeam360
    Sorry that this is such a long block of code, but do you see any obvious syntax errors in this? I feel like the problem is that the code isn't printing correctly since the sort and swap methods were from my textbook. Please help if you can! .data save: .word 1,2,4,2,5,6 size: .word 6 .text swap: sll $t1, $a1, 2 #shift bits by 2 add $t1, $a1, $t1 #set $t1 address to v[k] lw $t0, 0($t1) #load v[k] into t1 lw $t2, 4($t1) #load v[k+1] into t1 sw $t2, 0($t1) #swap addresses sw $t0, 4($t1) #swap addresses jr $ra #return sort: addi $sp, $sp, -20 #make enough room on the stack for five registers sw $ra, 16($sp) #save the return address on the stack sw $s3, 12($sp) #save $s3 on the stack sw $s2, 8($sp) #save Ss2 on the stack sw $s1, 4($sp) #save $s1 on the stack sw $s0, 0($sp) #save $s0 on the stack move $s2, $a0 #copy the parameter $a0 into $s2 (save $a0) move $s3, $a1 #copy the parameter $a1 into $s3 (save $a1) move $s0, $zero #start of for loop, i = 0 for1tst: slt $t0, $s0, $s3 #$t0 = 0 if $s0 S $s3 (i S n) beq $t0, $zero, exit1 #go to exit1 if $s0 S $s3 (i S n) addi $s1, $s0, -1 #j - i - 1 for2tst: slti $t0, $s1, 0 #$t0 = 1 if $s1 < 0 (j < 0) bne $t0, $zero, exit2 #$t0 = 1 if $s1 < 0 (j < 0) sll $t1, $s1, 2 #$t1 = j * 4 (shift by 2 bits) add $t2, $s2, $t1 #$t2 = v + (j*4) lw $t3, 0($t2) #$t3 = v[j] lw $t4, 4($t2) #$t4 = v[j+1] slt $t0, $t4, $t3 #$t0 = 0 if $t4 S $t3 beq $t0, $zero, exit2 #go to exit2 if $t4 S $t3 move $a0, $s2 #1st parameter of swap is v(old $a0) move $a1, $s1 #2nd parameter of swap is j jal swap #swap addi $s1, $s1, -1 j for2tst #jump to test of inner loop j print exit2: addi $s0, $s0, 1 #i = i + 1 j for1tst #jump to test of outer loop exit1: lw $s0, 0($sp) #restore $s0 from stack lw $s1, 4($sp) #resture $s1 from stack lw $s2, 8($sp) #restore $s2 from stack lw $s3, 12($sp) #restore $s3 from stack lw $ra, 16($sp) #restore $ra from stack addi $sp, $sp, 20 #restore stack pointer jr $ra #return to calling routine .data space:.asciiz " " # space to insert between numbers head: .asciiz "The sorted numbers are:\n" .text print:add $t0, $zero, $a0 # starting address of array add $t1, $zero, $a1 # initialize loop counter to array size la $a0, head # load address of print heading li $v0, 4 # specify Print String service syscall # print heading out: lw $a0, 0($t0) # load fibonacci number for syscall li $v0, 1 # specify Print Integer service syscall # print fibonacci number la $a0, space # load address of spacer for syscall li $v0, 4 # specify Print String service syscall # output string addi $t0, $t0, 4 # increment address addi $t1, $t1, -1 # decrement loop counter bgtz $t1, out # repeat if not finished jr $ra # return

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Good style for handling constructor failure of critical object

    - by mtlphil
    I'm trying to decide between two ways of instantiating an object & handling any constructor exceptions for an object that is critical to my program, i.e. if construction fails the program can't continue. I have a class SimpleMIDIOut that wraps basic Win32 MIDI functions. It will open a MIDI device in the constructor and close it in the destructor. It will throw an exception inherited from std::exception in the constructor if the MIDI device cannot be opened. Which of the following ways of catching constructor exceptions for this object would be more in line with C++ best practices Method 1 - Stack allocated object, only in scope inside try block #include <iostream> #include "simplemidiout.h" int main() { try { SimpleMIDIOut myOut; //constructor will throw if MIDI device cannot be opened myOut.PlayNote(60,100); //..... //myOut goes out of scope outside this block //so basically the whole program has to be inside //this block. //On the plus side, it's on the stack so //destructor that handles object cleanup //is called automatically, more inline with RAII idiom? } catch(const std::exception& e) { std::cout << e.what() << std::endl; std::cin.ignore(); return 1; } std::cin.ignore(); return 0; } Method 2 - Pointer to object, heap allocated, nicer structured code? #include <iostream> #include "simplemidiout.h" int main() { SimpleMIDIOut *myOut; try { myOut = new SimpleMIDIOut(); } catch(const std::exception& e) { std::cout << e.what() << std::endl; delete myOut; return 1; } myOut->PlayNote(60,100); std::cin.ignore(); delete myOut; return 0; } I like the look of the code in Method 2 better, don't have to jam my whole program into a try block, but Method 1 creates the object on the stack so C++ manages the object's life time, which is more in tune with RAII philosophy isn't it? I'm still a novice at this so any feedback on the above is much appreciated. If there's an even better way to check for/handle constructor failure in a siatuation like this please let me know.

    Read the article

  • Getting jQuery slideshow animation to stop on click

    - by hollyb
    I have a slide show built with jQuery that pauses on hover. It has a group of thumbnails sitting on top of the image that advances the image when clicked, otherwise the slideshow just auto-rotates through all the images. There is also a +/- to expand and contract a caption related to each image. I want to have the slideshow's automatic advancing to stop if one of the thumbnails is clicked, or the +/-. Basically, just stop whenever a user clicks anywhere within the gallery (div class=".homeImg"). I'm having a major brain fart in getting this working properly and could use some advice. Here's the jQuery: $(document).ready(function() { $(".main_image .desc").show(); //Show image info $(".main_image .block").animate({ opacity: 0.85 }, 1 ); //Set Opacity //Click and Hover events for thumbnail list $(".image_thumb ul li:first").addClass('active'); // * Adds a class 'last' to the last li to let the rotator know when to return to the first $(".image_thumb ul li:last").addClass('last'); $(".image_thumb ul li").click(function(){ //Set Variables var imgAlt = $(this).find('img').attr("alt"); //Get Alt Tag of Image var imgTitle = $(this).find('a').attr("href"); //Get Main Image URL var imgDesc = $(this).find('.block').html(); //Get HTML of block var imgDescHeight = $(".main_image").find('.block').height(); //Calculate height of block if ($(this).is(".active")) { //If it's already active, then… return false; // Don't click through } else { //Animate $(".main_image img").animate({ opacity: 0}, 800 ); $(".main_image .block").animate({ opacity: 0, marginBottom: -imgDescHeight }, 800, function() { $(".main_image .block").html(imgDesc).animate({ opacity: 0.85, marginBottom: "0" }, 250 ); $(".main_image img").attr({ src: imgTitle , alt: imgAlt}).animate({ opacity: 1}, 250 ); }); } $(".image_thumb ul li").removeClass('active'); //Remove class of 'active' on all lists $(this).addClass('active'); //add class of 'active' on this list only return false; }) .hover(function(){ $(this).addClass('hover'); }, function() { $(this).removeClass('hover'); }); //Toggle teaser $("a.collapse").click(function(){ $(".main_image .block").slideToggle(); $("a.collapse").toggleClass("show"); return false; // added to remove # browser jump }); // If we are hovering over the image area, pause the clickNext function pauseClickNext = false; $(".homeImg").hover( function () { pauseClickNext = true; }, function () { pauseClickNext = false; } ); // Define function to click the next li var clickNext = function(){ if(!pauseClickNext) { /// find the next li after .active var $next_li = $("li.active").next("li"); if($("li.active").hasClass("last") ){ $(".image_thumb ul li:first").trigger("click"); } else { $next_li.trigger("click"); } } }; // Time between image transition setInterval(clickNext, 6000); });

    Read the article

  • How to translate,use JSON in GWT?

    - by graybow
    I'm new in gwt. and need to know how to use JSON in gwt so i try this simple data loader but i'm still confuse. I create a project named 'tesdb3' in eclipse. I create the PHP side to access the database, and made the output as JSON.. I create the userdata.php in folder war. then I compile tesdb3 project. Folder tesdb3 and the userdata.php in war moved in local server(I use WAMP). I put the PHP in folder tesdb3. This is the result from my localhost/phpmyadmin/tesdb3/userdata.php [{"kode":"002","nama":"bambang gentolet"}{"kode":"012","nama":"Algiz"}] From that result I think the PHP side was working good.Then I create UserData.java as JSNI overlay like this: package com.tesdb3.client; import com.google.gwt.core.client.JavaScriptObject; class UserData extends JavaScriptObject{ protected UserData() {} public final native String getKode() /*-{ return this.kode; }-*/; public final native String getNama() /*-{ return this.nama; }-*/; public final String getFullData() { return getKode() + ":" + getNama(); } } Then Finally in the tesdb3.java: public class Tesdb3 implements EntryPoint { String url= "http://localhost/phpmyadmin/tesdb3/datauser.php"; private native JsArray<UserData> getuserdata(String Json) /*-{ return eval(json); }-*/; public void LoadData() throws RequestException{ RequestBuilder builder = new RequestBuilder(RequestBuilder.POST, URL.encode(url)); builder.sendRequest(null, new RequestCallback(){ @Override public void onError(Request request, Throwable exception) { Window.alert("error " + exception); } public void onResponseReceived(Request request, Response response) { getuserdata(response.getText()); //this is how i use the userdata json(is this already translated?) UserData UD = null; String LKode =UD.getKode(); String LName =UD.getNama(); Label L = new Label(LKode+""+LName); RootPanel.get().add(L); } }); } public void onModuleLoad() { try { LoadData(); } catch (RequestException e) { e.printStackTrace(); } } } The result is blank(i use development mode). and there was an eror like this:(I show it just some part) 10:46:29.984 [ERROR] [tesdb3] Uncaught exception escaped com.google.gwt.core.client.JavaScriptException: (ReferenceError): json is not defined fileName: http://localhost:1092 lineNumber: 2 stack: ("")@http://localhost:1092:2 My question is: How I use the translated Json in right way?? Is there any wrong use from my code? Is that necessary to move the compiled project to local server folder?(i do it following a tutorial from google). Sorry too many ask. but i'm really really confused.

    Read the article

  • Access static class variable of parent class in Python

    - by fuenfundachtzig
    I have someting like this class A: __a = 0 def __init__(self): A.__a = A.__a + 1 def a(self): return A.__a class B(A): def __init__(self): # how can I access / modify A.__a here? A.__a = A.__a + 1 # does not work def a(self): return A.__a Can I access the __astatic variable in B? It's possible writing a instead of __a, is this the only way? (I guess the answer might be rather short: yes :)

    Read the article

  • C# Create Values in Registry Local Machine

    - by Shahmir Javaid
    This is not working for me: public bool createRegistry() { if (!registryExists()) { Microsoft.Win32.Registry.LocalMachine.CreateSubKey("Software\\xelo\\"); Microsoft.Win32.Registry.LocalMachine.OpenSubKey("Software\\xelo").SetValue("hostname", (string)hostname, Microsoft.Win32.RegistryValueKind.String); return true; } else { return updateRegistry(); } } The exception error is to do with Not Authorized to do this. Any Help would be apreaciated Exeption: System.UnauthorizedAccessException | "Cannot write to the registry key"

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • Python datetime to Unix timestamp

    - by Off Rhoden
    I have to create an "Expires" value 5 minutes in the future, but I have to supply it in UNIX Timestamp format. I have this so far, but it seems like a hack. def expires(): '''return a UNIX style timestamp representing 5 minutes from now''' epoch = datetime.datetime(1970, 1, 1) seconds_in_a_day = 60 * 60 * 24 five_minutes = datetime.timedelta(seconds=5*60) five_minutes_from_now = datetime.datetime.now() + five_minutes since_epoch = five_minutes_from_now - epoch return since_epoch.days * seconds_in_a_day + since_epoch.seconds Is there a module or function that does the timestamp conversion for me?

    Read the article

  • javascript function is not getting called onclick of hx:commant button

    - by Sunny Mate
    hi i have method called test() when iu click on the commandButton the method should get called but the method is not getting called my code is as follows method **function test() { alert('ss'); return "true"; }** and method calling is <hx:commandExButton type="submit" value="Search" styleClass="action2" id="searchButton" **onclick="return test();"** action="#{pc_WorkInProgressUserGrid.doSearchButtonAction}" immediate="true </hx:commandExButton> any suggestion would be helpful

    Read the article

  • Is it safe to access asp.net session variables through static properties of a static object?

    - by Ronnie Overby
    Is it safe to access asp.net session variables through static properties of a static object? Here is what I mean: public static class SessionHelper { public static int Age { get { return (int)HttpContext.Current.Session["Age"]; } set { HttpContext.Current.Session["Age"] = value; } } public static string Name { get { return (string)HttpContext.Current.Session["Name"]; } set { HttpContext.Current.Session["Name"] = value; } } } Is it possible that userA could access userB's session data this way?

    Read the article

  • Use hash or case-statement [Ruby]

    - by user94154
    Generally which is better to use?: case n when 'foo' result = 'bar' when 'peanut butter' result = 'jelly' when 'stack' result = 'overflow' return result or map = {'foo' => 'bar', 'peanut butter' => 'jelly', 'stack' => 'overflow'} return map[n] More specifically, when should I use case-statements and when should I simply use a hash?

    Read the article

  • Output Parameter Not Returned

    - by Mark Plumpton
    Why does this script return a pair of nulls? I'm using SQL Server 2008, script run in MSSMS. CREATE PROCEDURE proc_Test ( @Input int, @Out1 int OUTPUT, @Out2 varchar(10) OUTPUT ) AS BEGIN SET NOCOUNT OFF SET @Out1 = 100 + @Input SET @Out2 = 'result=' + CONVERT(varchar,@Out1) RETURN END GO DECLARE @Out1 int, @Out2 varchar(10) exec proc_Test @Input=1, @Out1=@Out1, @Out2=@Out2 select @Out1, @Out2

    Read the article

  • A* algorithm works OK, but not perfectly. What's wrong?

    - by Bart van Heukelom
    This is my grid of nodes: I'm moving an object around on it using the A* pathfinding algorithm. It generally works OK, but it sometimes acts wrongly: When moving from 3 to 1, it correctly goes via 2. When going from 1 to 3 however, it goes via 4. When moving between 3 and 5, it goes via 4 in either direction instead of the shorter way via 6 What can be wrong? Here's my code (AS3): public static function getPath(from:Point, to:Point, grid:NodeGrid):PointLine { // get target node var target:NodeGridNode = grid.getClosestNodeObj(to.x, to.y); var backtrace:Map = new Map(); var openList:LinkedSet = new LinkedSet(); var closedList:LinkedSet = new LinkedSet(); // begin with first node openList.add(grid.getClosestNodeObj(from.x, from.y)); // start A* var curNode:NodeGridNode; while (openList.size != 0) { // pick a new current node if (openList.size == 1) { curNode = NodeGridNode(openList.first); } else { // find cheapest node in open list var minScore:Number = Number.MAX_VALUE; var minNext:NodeGridNode; openList.iterate(function(next:NodeGridNode, i:int):int { var score:Number = curNode.distanceTo(next) + next.distanceTo(target); if (score < minScore) { minScore = score; minNext = next; return LinkedSet.BREAK; } return 0; }); curNode = minNext; } // have not reached if (curNode == target) break; else { // move to closed openList.remove(curNode); closedList.add(curNode); // put connected nodes on open list for each (var adjNode:NodeGridNode in curNode.connects) { if (!openList.contains(adjNode) && !closedList.contains(adjNode)) { openList.add(adjNode); backtrace.put(adjNode, curNode); } } } } // make path var pathPoints:Vector.<Point> = new Vector.<Point>(); pathPoints.push(to); while(curNode != null) { pathPoints.unshift(curNode.location); curNode = backtrace.read(curNode); } pathPoints.unshift(from); return new PointLine(pathPoints); } NodeGridNode::distanceTo() public function distanceTo(o:NodeGridNode):Number { var dx:Number = location.x - o.location.x; var dy:Number = location.y - o.location.y; return Math.sqrt(dx*dx + dy*dy); }

    Read the article

  • Memory management with Objective-C Distributed Objects: my temporary instances live forever!

    - by jkp
    I'm playing with Objective-C Distributed Objects and I'm having some problems understanding how memory management works under the system. The example given below illustrates my problem: Protocol.h #import <Foundation/Foundation.h> @protocol DOServer - (byref id)createTarget; @end Server.m #import <Foundation/Foundation.h> #import "Protocol.h" @interface DOTarget : NSObject @end @interface DOServer : NSObject < DOServer > @end @implementation DOTarget - (id)init { if ((self = [super init])) { NSLog(@"Target created"); } return self; } - (void)dealloc { NSLog(@"Target destroyed"); [super dealloc]; } @end @implementation DOServer - (byref id)createTarget { return [[[DOTarget alloc] init] autorelease]; } @end int main() { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; DOServer *server = [[DOServer alloc] init]; NSConnection *connection = [[NSConnection new] autorelease]; [connection setRootObject:server]; if ([connection registerName:@"test-server"] == NO) { NSLog(@"Failed to vend server object"); } else [[NSRunLoop currentRunLoop] run]; [pool drain]; return 0; } Client.m #import <Foundation/Foundation.h> #import "Protocol.h" int main() { unsigned i = 0; for (; i < 3; i ++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; id server = [NSConnection rootProxyForConnectionWithRegisteredName:@"test-server" host:nil]; [server setProtocolForProxy:@protocol(DOServer)]; NSLog(@"Created target: %@", [server createTarget]); [[NSRunLoop currentRunLoop] runUntilDate:[NSDate dateWithTimeIntervalSinceNow:1.0]]; [pool drain]; } return 0; } The issue is that any remote objects created by the root proxy are not released when their proxy counterparts in the client go out of scope. According to the documentation: When an object’s remote proxy is deallocated, a message is sent back to the receiver to notify it that the local object is no longer shared over the connection. I would therefore expect that as each DOTarget goes out of scope (each time around the loop) it's remote counterpart would be dellocated, since there is no other reference to it being held on the remote side of the connection. In reality this does not happen: the temporary objects are only deallocate when the client application quits, or more accurately, when the connection is invalidated. I can force the temporary objects on the remote side to be deallocated by explicitly invalidating the NSConnection object I'm using each time around the loop and creating a new one but somehow this just feels wrong. Is this the correct behaviour from DO? Should all temporary objects live as long as the connection that created them? Are connections therefore to be treated as temporary objects which should be opened and closed with each series of requests against the server? Any insights would be appreciated.

    Read the article

< Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >