Search Results

Search found 8532 results on 342 pages for 'packet examples'.

Page 268/342 | < Previous Page | 264 265 266 267 268 269 270 271 272 273 274 275  | Next Page >

  • javascript class calling XMLHttpRequest internally, then handling onreadystatechange

    - by Radu M
    this thing almost works: function myClass(url) { this.source = url; this.rq = null; this.someOtherProperty = "hello"; // open connection to the ajax server this.start = function() { if (window.XMLHttpRequest) { this.rq = new XMLHttpRequest(); if (this.rq.overrideMimeType) this.rq.overrideMimeType("text/xml"); } else this.rq = new ActiveXObject("Microsoft.XMLHTTP"); try { this.rq.onreadystatechange = connectionEvent; this.rq.open("GET", this.source, true); this.rq.send(null); this.state = 1; } catch (err) { // some error handler here } } function connectionEvent() { alert("i'm here"); alert("this doesnt work: " + this.someOtherProperty); } } // myClass so it's nothing more than having the XMLHttpRequest object as a member of my class, instead of globally defined, and invoking it in the traditional way. however, inside my connectionEvent callback function, the meaning of "this" is lost, even though the function itself is scoped inside myClass. i also made sure that the object that i instantiate from myClass is kept alive long enough (declared global in the script). in all the examples of using javascript classes that i saw, "this" was still available inside the inner functions. for me, it is not, even if i take my function outside and make it a myClass.prototype.connectionEvent. what am i doing wrong? thank you.

    Read the article

  • Google Federated Login vs Hybrid Protocol vs Google Data Authentication. Whats's the Difference?

    - by johnfelix
    Hi, I am trying to implement Google Authentication in my website, in which I would also be pulling some Google Data using the Google Data API and I am using Google App Engine with Jinja2. My question is, so many ways are mentioned to do it. I am confused between Google Federated Login,Google Data Protocol, Hybrid Protocol. Are these things the same or different ways to do the same thing. From what I read and understood, which might be incorrect, Google Federated Login uses the hybrid protocol to authenticate and fetch the google data. Is there a proper guide to implement any one of these in python. Examples which I found at the google link are kind of different. From what I understood,correct me if i am wrong, I have to implement only the OpenID Consumer part. In order to implement Google Federated Login in Python, I saw that we need to download a separate library from the openid-enabled.com but I found a different library for the google data implementation at http://code.google.com/p/gdata-python-client/ As you can see, I am confused a lot :D. Please help me :) Thanks

    Read the article

  • Importing MEF-Plugins into MVC Controllers

    - by Marks
    Hello. There are several examples of using MEF to plugin whole controller/view packages into a MVC application, but i didn't found one, using MEF to plugin funcional parts, used by other controllers. For example, think of a NewsService with a simple interface like interface INewsService { List<NewsItem> GetAllNews(); } That gets news wherever he wants, and returns them in a List of NewsItems. My page should load an exported INewsService and show the news on the page. But there is the problem. I cant just use [Import] in the controllers, as they are just created when they are needed. Edit: (Importing them to the main MVCApplication class doesn't work, becouse i cant access it from the controllers.) I think i found a way to access the main app via HttpContext.ApplicationInstance. But the Service object in this instance is null although it was created successfully in the Application_Start() method. Any idea why? So, how can i access the NewsService from within a controller? Thanks in advance, Marks

    Read the article

  • Optimizing code using PIL

    - by freakazo
    Firstly sorry for the long piece of code pasted below. This is my first time actually having to worry about performance of an application so I haven't really ever worried about performance. This piece of code pretty much searches for an image inside another image, it takes 30 seconds to run on my computer, converting the images to greyscale and other changes shaved of 15 seconds, I need another 15 shaved off. I did read a bunch of pages and looked at examples but I couldn't find the same problems in my code. So any help would be greatly appreciated. From the looks of it (cProfile) 25 seconds is spent within the Image module, and only 5 seconds in my code. from PIL import Image import os, ImageGrab, pdb, time, win32api, win32con import cProfile def GetImage(name): name = name + '.bmp' try: print(os.path.join(os.getcwd(),"Images",name)) image = Image.open(os.path.join(os.getcwd(),"Images",name)) except: print('error opening image;', name) return image def Find(name): image = GetImage(name) imagebbox = image.getbbox() screen = ImageGrab.grab() #screen = Image.open(os.path.join(os.getcwd(),"Images","Untitled.bmp")) YLimit = screen.getbbox()[3] - imagebbox[3] XLimit = screen.getbbox()[2] - imagebbox[2] image = image.convert("L") Screen = screen.convert("L") Screen.load() image.load() #print(XLimit, YLimit) Found = False image = image.getdata() for y in range(0,YLimit): for x in range(0,XLimit): BoxCoordinates = x, y, x+imagebbox[2], y+imagebbox[3] ScreenGrab = screen.crop(BoxCoordinates) ScreenGrab = ScreenGrab.getdata() if image == ScreenGrab: Found = True #print("woop") return x,y if Found == False: return "Not Found" cProfile.run('print(Find("Login"))')

    Read the article

  • How to explain to someone that a data structure should not draw itself, explaining separation of con

    - by leeand00
    I have another programmer who I'm trying to explain why it is that a UI component should not also be a data-structure. For instance say that you get a data-structure that contains a record-set from the "database", and you wish to display that record-set in a UI component within your application. According to this programmer (who will remain nameless, he's young and I'm teaching him...), we should subclass the data-structure into a class that will draw the UI component within our application!!!!!! And thus according to this logic, the record-set should manage the drawing of the UI. **Head Desk*** I know that asking a record-set to draw itself is wrong, because, if you wish to render the same data-structure on more than one type of component on your UI, you are going to have a real mess on your hands; you'll need to extend yet another class for each and every UI component that you render from the base-class of your record-set; I am well aware of the "cleanliness" of the of the MVC pattern (and by that what I really mean is you don't confuse your data (the Model) with your UI (the view) or the actions that take place on the data (the Controller more or less...okay not really the API should really handle that...and the Controller should just make as few calls to it as it can, telling it which view to render)) But it's certainly alot cleaner than using data-structures to render UI components! Is there any other advice I could send his way other than the example above? I understand that when you first learn OOP you go through "a stage" where you where just want to extend everything. Followed by a stage when you think that Design Patterns are the solution every single problem...which isn't entirely correct either...thanks Jeff. Is there a way that I can gently nudge this kid in the right direction? Do you have any more examples that might help explain my point to him?

    Read the article

  • WPF DataValidation on a DataTemplate object in an ItemsControl

    - by Matt H.
    I have two datatemplates, both very similar... here is one of them: <DataTemplate x:Key="HeadingTemplate"> <Grid x:Name="mainHeadingGrid" Margin="5,5,30,0" HorizontalAlignment="Stretch"> <Grid.ColumnDefinitions> <ColumnDefinition Width="Auto" /> <ColumnDefinition /> </Grid.ColumnDefinitions> <TextBlock Grid.Column="1" Margin="30,3,10,0" Foreground="Black" FontWeight="Bold" HorizontalAlignment="Left" TextWrapping="Wrap"> <TextBlock.Text> <MultiBinding Converter="{StaticResource myHeadingConverter}" ConverterParameter="getRNHeadingTitle" Mode="TwoWay"> <Binding Path="num"/> <Binding Path="name"/> </MultiBinding> </TextBlock.Text> </TextBlock> <TextBox Grid.Column="1" Text="{Binding Path=moreInfo}"/> </Grid> </DataTemplate> I use an selector in my ItemsControl to choose between the two, based on the object it is bound to. I want to use validation to check through all of the properties and put a big exclamation point in front of the whole datatemplate as it is displayed in the itemscontrol. how do I do this? All of the examples I've found explain how to set a ValidationRule on a specific control in the datatemplate, in that control's binding. I want to apply my validation rule to the entire template... Help! :)

    Read the article

  • Is there a better way to create a generic convert string to enum method or enum extension?

    - by Kelsey
    I have the following methods in an enum helper class (I have simplified it for the purpose of the question): static class EnumHelper { public enum EnumType1 : int { Unknown = 0, Yes = 1, No = 2 } public enum EnumType2 : int { Unknown = 0, Dog = 1, Cat = 2, Bird = 3 } public enum EnumType3 : int { Unknown = 0, iPhone = 1, Andriod = 2, WindowsPhone7 = 3, Palm = 4 } public static EnumType1 ConvertToEnumType1(string value) { return (string.IsNullOrEmpty(value)) ? EnumType1.Unknown : (EnumType1)(Enum.Parse(typeof(EnumType1), value, true)); } public static EnumType2 ConvertToEnumType2(string value) { return (string.IsNullOrEmpty(value)) ? EnumType2.Unknown : (EnumType2)(Enum.Parse(typeof(EnumType2), value, true)); } public static EnumType3 ConvertToEnumType3(string value) { return (string.IsNullOrEmpty(value)) ? EnumType3.Unknown : (EnumType3)(Enum.Parse(typeof(EnumType3), value, true)); } } So the question here is, can I trim this down to an Enum extension method or maybe some type of single method that can handle any type. I have found some examples to do so with basic enums but the difference in my example is all the enums have the Unknown item that I need returned if the string is null or empty (if no match is found I want it to fail). Looking for something like the following maybe: EnumType1 value = EnumType1.Convert("Yes"); // or EnumType1 value = EnumHelper.Convert(EnumType1, "Yes"); One function to do it all... how to handle the Unknown element is the part that I am hung up on.

    Read the article

  • AsyncTask and Contexts

    - by Michael
    So I'm working out my first multi-threaded application using Android with the AsyncTask class. I'm trying to use it to fire off a Geocoder in a second thread, then update the UI with onPostExecute, but I keep running into an issue with the proper Context. I kind of hobbled my way through using Contexts on the main thread, but I'm not exactly sure what the Context is or how to use it on background threads, and I haven't found any good examples on it. Any help? Here is an excerpt of what I'm trying to do: public class GeoCode extends AsyncTask<GeoThread, Void, GeoThread> { @Override protected GeoThread doInBackground(GeoThread... i) { List<Address> addresses = null; Geocoder geoCode = null; geoCode = new Geocoder(null); //Expects at minimum Geocoder(Context context); addresses = geoCode.getFromLocation(GoldenHour.lat, GoldenHour.lng, 1); } } It keeps failing at the sixth line there, because of the improper Context.

    Read the article

  • Can a single developer still make money with shareware?

    - by Wouter van Nifterick
    I'm wondering if the shareware concept is dead nowadays. Like most developers, I've built up quite a collection of self-made tools and code libraries that help me to be productive. Some examples to give you an idea of the type of thing I'm talking about: A self-learning program that renames and orders all my mp3 files and adds information to the id3 tags; A Delphi component that wraps the Google Maps API; A text-to-singing-voice converter for musical purposes; A program to control a music synthesizer; A Gps-log <- KML <- ESRI-shapefile converter; I've got one of these already freely downloadable on my website, and on average it gets downloaded about a 150 times per month. Let's say I'd start charging 15 euro's for it; would there actually be people who buy it? How many? What would it depend on? If I could get some money for some of these, I'd finish them up a bit and put them online, but without that, I probably won't bother. Maintaining a SourceForge project is not very rewarding by itself. Is there anyone who is making money with shareware? How much? Any tips?

    Read the article

  • When anyDensity=false why does getDrawingCache(true) return null?

    - by Robert Nekic
    First off, my application currently defines anyDensity=false in the manifest file. Elsewhere in the app, I'm trying to capture and display a View's DrawingCache but I'm not able to get a clear Bitmap without scaling artifacts. The code below yields a Bitmap but it has scaling artifacts and is generally fuzzy. myView.setDrawingCacheEnabled(true); Bitmap myBitmap = Bitmap.Create(myView.getDrawingCache()); myImageView.setImageBitmap(myBitmap); As I read it, the documentation for getDrawingCache says this is to be expected and to use getDrawingCache(true). Yet, both code examples below throw NullPointer exceptions because the Bitmap returned by getDrawingCache(true) is always null. myView.setDrawingCacheEnabled(true); Bitmap myBitmap = Bitmap.Create(myView.getDrawingCache(true)); myImageView.setImageBitmap(myBitmap); OR myView.buildDrawingCache(true); Bitmap myBitmap = Bitmap.Create(myView.getDrawingCache(true)); myImageView.setImageBitmap(myBitmap); myView.destroyDrawingCache(); Does anyone know how to properly capture and render the drawingCache when anyDensity=false?

    Read the article

  • Eclipse PDE - Plug-in, Feature, and Product Versioning

    - by Michael
    I am having much confusion over the process of upgrading version numbers in dependent plug-ins, features, and products in a fairly large eclipse workspace. I have made API changes to java code residing in an existing plug-in and thus requires an increase of the Major part of the version identifier. This plug-in serves as a dependency to a given feature, where the feature is later included in a product. From the documentation at http://wiki.eclipse.org/Version_Numbering, I understand (for the most part) when the proper number should be increased on the containing plug-in itself. However, how would this Major version number change on the plug-in affect dependent, "down-the-line" items (e.g., features, products)? For example, assume we have the typical "Hello World" setup as follows: Plug-in: com.example.helloworld, version 1.0.0 Feature: com.example.helloworld.feature, version 1.0.0 Product: com.example.helloworld.product, version 1.0.0 If I were to make an API change in the plug-in, this would require a version update to be that of 2.0.0. What would then be the version of the feature, 1.1.0? The same question can be applied for the product level as well (e.g., if the feature is 1.1.0 OR 2.0.0, what is the product version number)? I'm sure this is quite the newbie question so I apologize for wasting anyone's time and effort. I have searched for this type of content but all I am finding is are examples showing how to develop a plug-in, feature, product, and update site for the first time. The only other content related to my search has been developing feature patches and have not touched on the versioning aspect as much as I would prefer. I am having difficulty coming into (for the first time) an Eclipse RCP / PDE environment and need to learn the proper way and / or best practices for making such versioning updates and how to best reflect this throughout other dependent projects in the workspace.

    Read the article

  • Which knowledge base/rule-based inference engine to choose for real time Runway incursion prevention

    - by Piligrim
    Hello, we are designing a project that would listen to dialog between airport controllers and pilots to prevent runway incursions (eg. one airplane is taking off while other is crossing the runway). Our professor wants us to use Jena for knowledge base (or anything else but it should be some sort of rule-based engine). Inference is not the main thing in Jena and there's not much documentation and examples of this. So we need an engine that would get messages from pilots as input and output possible risks of incursion or any other error in message protocol. It should be easy to write rules, and should be easy to provide engine with real time data. I image it something like this: A pilot sends a message that he lands on some runway, the system remembers that the runway is busy and no one should cross it If someone is given an instruction to cross this runway, the engine should fire a rule that something is wrong When the pilot sends a message that he left the runway and goes to the gate, the system clears the runway and lets other planes to use it. So is Jena, or prolog or any other rules engine suitable for this? I mean it is suitable, but do we really need to use it? I asked the prof. if we could just keep state of the runway and use some simple checks based on messages we receive and he said that it is not scalable and we need the knowledge base. Can someone give me any advise on which approach to use for this system? If you recommend k.b., then which one should we use? The project is written in java. Thank you.

    Read the article

  • Loading a javascript library in javax.script?

    - by Shane
    I want to run Protovis javascript from Java and get the evaluated SVG code. I am using javax.script.* to run the Javascript: public static void EvalScript() throws Exception { ScriptEngineManager factory = new ScriptEngineManager(); ScriptEngine engine = factory.getEngineByName("JavaScript"); Object result = engine.eval("var vis = new pv.Panel().width(300).height(300) .add (pv.Line).data ([1,0.5, 0.1, 0.01, 0.001, 0.3, 0.2,0.1,1]) .left (function () { return this.index * 30; }) .bottom (function (d) { return d * 250; }); vis.root.render(); vis.scene[0].canvas.innerHTML;"); System.out.println(result); } This would complain because I never loaded Protovis itself, as would ordinarily be done with <script type="text/javascript" src="../protovis-r3.1.0.js"></script> Is there a good way, short of sourcing in the full Javascript into the eval() command, of loading a library when running Javascript through javax.script? (Incidentally, I know of examples that use Rhino to do this from the Google discussion group.)

    Read the article

  • @OneToMany and composite primary keys?

    - by Kris Pruden
    Hi, I'm using Hibernate with annotations (in spring), and I have an object which has an ordered, many-to-one relationship which a child object which has a composite primary key, one component of which is a foreign key back to the id of the parent object. The structure looks something like this: +=============+ +================+ | ParentObj | | ObjectChild | +-------------+ 1 0..* +----------------+ | id (pk) |-----------------| parentId | | ... | | name | +=============+ | pos | | ... | +================+ I've tried a variety of combinations of annotations, none of which seem to work. This is the closest I've been able to come up with: @Entity public class ParentObject { @Column(nullable=false, updatable=false) private String id; @OneToMany(mappedBy="object", fetch=FetchType.EAGER) @IndexColumn(name = "pos", base=0) private List<ObjectChild> attrs; ... } @Entity public class ChildObject { @Embeddable public static class Pk implements Serializable { @Column(nullable=false, updatable=false) private String objectId; @Column(nullable=false, updatable=false) private String name; @Column(nullable=false, updatable=false) private int pos; ... } @EmbeddedId private Pk pk; @ManyToOne @JoinColumn(name="parentId") private ParentObject parent; ... } I arrived at this after a long bout of experimentation in which most of my other attempts yielded entities which hibernate couldn't even load for various reasons. The error I get when I try to read one of these objects (they seem to save OK), I get an error of this form: org.hibernate.exception.SQLGrammarException: could not initialize a collection: ... And the root cause is this: com.mysql.jdbc.exceptions.jdbc4.MySQLSyntaxErrorException: Unknown column 'attrs0_.id' in 'field list' I'm sure I'm missing something simple, but the documentation is not clear on this matter, and I haven't been able to find any examples of this anywhere else. Thanks!

    Read the article

  • Updating Database from DataSet

    - by clawson
    I am having trouble updating my Database from my code using a DataSet. I'm using SQL Server 2008 and Visual Studio 2008. Here is what I've done so far. I have created a table in SQL Server called MyTable which has two columns: id nchar(10), and name nchar(50). I have then created a datasource in my VB.net project that consists of this table using the dataset wizard and called this dataset MyDataSet. I run the following code on a button click: Try Dim myDataSet As New MyDataSet Dim newRow As MyDataSet.MyTableRow = myDataSet.MyTable.NewMyTableRow newRow.id = "1" newRow.name = "Alpha" myDataSet.MyTable.AddMyTableRow(newRow) myDataSet.AcceptChanges() Catch ex As Exception MsgBox(ex.Message) End Try when I run this and check the rows in SQL Server it returns 0 rows What have I missed? How can I add these rows / save changes in a dataset to the database? I have seen other examples that use a TableAdapter but I don't think I want to do this, I think I should be able to achieve this just using a DataSet. Am I mistaken? Help is greatly appreciated!

    Read the article

  • express+jade: provided local variable is undefined in view (node.js + express + jade)

    - by Jake
    Hello. I'm implementing a webapp using node.js and express, using the jade template engine. Templates render fine, and can access helpers and dynamic helpers, but not local variables other than the "body" local variable, which is provided by express and is available and defined in my layout.jade. This is some of the code: app.set ('view engine', 'jade'); app.get ("/test", function (req, res) { res.render ('test', { locals: { name: "jake" } }); }); and this is test.jade: p hello =name when I remove the second line (referencing name), the template renders correctly, showing the word "hello" in the web page. When I include the =name, it throws a ReferenceError: 500 ReferenceError: Jade:2 NaN. 'p hello' NaN. '=name' name is not defined NaN. 'p hello' NaN. '=name' I believe I'm following the jade and express examples exactly with respect to local variables. Am I doing something wrong, or could this be a bug in express or jade?

    Read the article

  • How to draw line inside a scatter plot

    - by ruffy
    I can't believe that this is so complicated but I tried and googled for a while now. I just want to analyse my scatter plot with a few graphical features. For starters, I want to add simply a line. So, I have a few (4) points and like in this plot [1] I want to add a line to it. http://en.wikipedia.org/wiki/File:ROC_space-2.png [1] Now, this won't work. And frankly, the documentation-examples-gallery combo and content of matplotlib is a bad source for information. My code is based upon a simple scatter plot from the gallery: # definitions for the axes left, width = 0.1, 0.85 #0.65 bottom, height = 0.1, 0.85 #0.65 bottom_h = left_h = left+width+0.02 rect_scatter = [left, bottom, width, height] # start with a rectangular Figure fig = plt.figure(1, figsize=(8,8)) axScatter = plt.axes(rect_scatter) # the scatter plot: p1 = axScatter.scatter(x[0], y[0], c='blue', s = 70) p2 = axScatter.scatter(x[1], y[1], c='green', s = 70) p3 = axScatter.scatter(x[2], y[2], c='red', s = 70) p4 = axScatter.scatter(x[3], y[3], c='yellow', s = 70) p5 = axScatter.plot([1,2,3], "r--") plt.legend([p1, p2, p3, p4, p5], [names[0], names[1], names[2], names[3], "Random guess"], loc = 2) # now determine nice limits by hand: binwidth = 0.25 xymax = np.max( [np.max(np.fabs(x)), np.max(np.fabs(y))] ) lim = ( int(xymax/binwidth) + 1) * binwidth axScatter.set_xlim( (-lim, lim) ) axScatter.set_ylim( (-lim, lim) ) xText = axScatter.set_xlabel('FPR / Specificity') yText = axScatter.set_ylabel('TPR / Sensitivity') bins = np.arange(-lim, lim + binwidth, binwidth) plt.show() Everything works, except the p5 which is a line. Now how is this supposed to work? What's good practice here?

    Read the article

  • Manipulate score/rank on query results from NHibernate.Search

    - by Fernando Figueiredo
    I've been working with NHibernate, NHibernate.Search and Lucene.Net to improve the search engine used on the website I develop. Basically, I use it to search contents of corporations specification documents. This is not to be confused with Lucene's notion of documents: in my case, a specification document (which I'll hereafter call a "specdoc") can contain many pages, and the content of these pages are the ones that are actually indexed (thus, the pages themselves are the ones that fall into Lucene's concept of documents). So, the pages belong to a specdoc, that in turn belong to a corporation (so, a corporation can have many specdocs). I'm using NHibernate.Search "IndexEmbedded" and "ContainedIn" attributes to associate the pages with their specdoc and the specdocs to their corporations, so I can query for terms in specdoc pages and have Lucene/NH.Search return either the pages themselves, the specdocs, or the corporations that match the query on the pages. I can query this way and get ranked results, thus presenting results (that is, corporations, specdocs or pages) by relevance, which is great. But now I need something more. Specifically in the case where I query terms and have NH.Search return the corporations that match, I need to manually/artificially tune the score of some of the results, because there are corporations that I want to show up on the top of the result set - think of "sponsored results". I'm thinking of doing it on my application, maybe creating an entity/database table that contain an association to the corporation entity, and a score boost value. But I don't know how to feed this to Lucene and have it boost the results accordingly at search time. Initially I thought about deriving a Similarity class to do this, but it doesn't look like Similarity can be used to modify result sets at search time. As per this page, it looks like what I need is to mess around with weight or scoring. But the docs are a little superficial in that there are no examples on how to implement a custom scoring, let alone integrate it with NH.Search. So, does anyone know how to do this, or point me to some documentation or working example on how to do something similar? Thanks!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Read a buffer of unknown size (Console input)

    - by Sanarothe
    Hi. I'm a little behind in my X86 Asm class, and the book is making me want to shoot myself in the face. The examples in the book are insufficient and, honestly, very frustrating because of their massive dependencies upon the author's link library, which I hate. I wanted to learn ASM, not how to call his freaking library, which calls more of his library. Anyway, I'm stuck on a lab that requires console input and output. So far, I've got this for my input: input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP I need to use the input and output procedures multiple times, so I'm trying to make it abstract. I'm just not sure how to use the data that is set to eax here. My initial idea was to take that string array and manually crawl through it by adding 8 to the offset for each possible digit (Input is integer, and there's a little bit of processing) but this doesn't work out because I don't know how big the input actually is. So, how would you swap the string array into an integer that could be used? Full code: (Haven't done the integer logic or the instruction string output because I'm stuck here.) include c:/irvine/irvine32.inc .data inputHandle HANDLE ? outputHandle HANDLE ? buffer BYTE BufSize DUP(?),0,0 bytesRead DWORD ? str1 BYTE "Enter an integer:",0Dh, 0Ah str2 BYTE "Enter another integer:",0Dh, 0Ah str3 BYTE "The higher of the two integers is: " int1 WORD ? int2 WORD ? int3 WORD ? Buf = 80 .code main PROC call handle push str1 call output call input push str2 call output call input push str3 call output call input main EndP larger PROC Ret larger EndP output PROC INVOKE WriteConsole Ret output EndP handle PROC USES eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov inputHandle,eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov outputHandle,eax Ret handle EndP input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP END main

    Read the article

  • Database warehoue design: fact tables and dimension tables

    - by morpheous
    I am building a poor man's data warehouse using a RDBMS. I have identified the key 'attributes' to be recorded as: sex (true/false) demographic classification (A, B, C etc) place of birth date of birth weight (recorded daily): The fact that is being recorded My requirements are to be able to run 'OLAP' queries that allow me to: 'slice and dice' 'drill up/down' the data and generally, be able to view the data from different perspectives After reading up on this topic area, the general consensus seems to be that this is best implemented using dimension tables rather than normalized tables. Assuming that this assertion is true (i.e. the solution is best implemented using fact and dimension tables), I would like to see some help in the design of these tables. 'Natural' (or obvious) dimensions are: Date dimension Geographical location Which have hierarchical attributes. However, I am struggling with how to model the following fields: sex (true/false) demographic classification (A, B, C etc) The reason I am struggling with these fields is that: They have no obvious hierarchical attributes which will aid aggregation (AFAIA) - which suggest they should be in a fact table They are mostly static or very rarely change - which suggests they should be in a dimension table. Maybe the heuristic I am using above is too crude? I will give some examples on the type of analysis I would like to carryout on the data warehouse - hopefully that will clarify things further. I would like to aggregate and analyze the data by sex and demographic classification - e.g. answer questions like: How does male and female weights compare across different demographic classifications? Which demographic classification (male AND female), show the most increase in weight this quarter. etc. Can anyone clarify whether sex and demographic classification are part of the fact table, or whether they are (as I suspect) dimension tables.? Also assuming they are dimension tables, could someone elaborate on the table structures (i.e. the fields)? The 'obvious' schema: CREATE TABLE sex_type (is_male int); CREATE TABLE demographic_category (id int, name varchar(4)); may not be the correct one.

    Read the article

  • One object in jTemplate?

    - by Dejan.S
    Hi I'm using jTemplate for the first time. I been reading and it's not that hard to use it BUT what I can not figure out and find any thing on is how to work with one object, all the examples I find are a list of objects. My situation is I need to work with one object only. How can I do that? I mean How to work with the data in the jTemplate like this example but one only. <script type="text/html" id="TemplateResultsTable"> {#template MAIN} <table cellpadding="10" cellspacing="0"> <tr> <th>Artist</th> <th>Company</th> <th>Title</th> <th>Price</th> </tr> {#foreach $T.d as CD} {#include ROW root=$T.CD} {#/for} </table> {#/template MAIN} {#template ROW} <tr class="{#cycle values=['','evenRow']}"> <td>{$T.Artist}</td> <td>{$T.Company}</td> <td>{$T.Title}</td> <td>{$T.Price}</td> </tr> {#/template ROW} </script>

    Read the article

  • Add Zend_Navigation to the View with old legacy bootstrap

    - by Grant Collins
    Hi, I've been struggling with Zend_Navigation all weekend, and now I have another problem, which I believe has been the cause of a lot of my issues. I am trying to add Zend_Navigation to a legacy 1.7.6 Zend Framework application, i've updated the Zend Library to 1.9.0 and updated the bootstrap to allow this library update. The problem is that I don't know how, and the examples show the new bootstrap method of how to add the Navigation object to the view, I've tried this: //initialise the application layouts with the MVC helpers $layout = Zend_Layout::startMvc(array('layoutPath' => '../application/layouts')); $view = $layout->getView(); $configNav = new Zend_Config_Xml('../application/config/navigation.xml', 'navigation'); $navigation = new Zend_Navigation($configNav); $view->navigation($navigation); $viewRenderer = new Zend_Controller_Action_Helper_ViewRenderer(); $viewRenderer->setView($view); This seems to run through fine, but when I go to use the breadcrumb view helper in my layout, it errors with: Strict Standards: Creating default object from empty value in C:\www\moobia\development\website\application\modules\employers\controllers\IndexController.php on line 27 This is caused by the following code in the init() function of my controller. $uri = $this->_request->getPathInfo(); $activeNav = $this->view->navigation()->findByUri($uri); <- this is null when called $activeNav->active = true; I believe it's because the Zend_Navigation object is not in the view. I would look at migrating the bootstrap to the current method, but at present I am running out of time for a release. Thanks, Grant

    Read the article

  • Getting text between quotes using regular expression

    - by Camsoft
    I'm having some issues with a regular expression I'm creating. I need a regex to match against the following examples and then sub match on the first quoted string: Input strings ("Lorem ipsum dolor sit amet, consectetur adipiscing elit.") ('Lorem ipsum dolor sit amet, consectetur adipiscing elit. ') ('Lorem ipsum dolor sit amet, consectetur adipiscing elit. ', 'arg1', "arg2") Must sub match Lorem ipsum dolor sit amet, consectetur adipiscing elit. Regex so far: \((["'])([^"']+)\1,?.*\) The regex does a sub match on the text between the first set of quotes and returns the sub match displayed above. This is almost working perfectly, but the problem I have is that if the quoted string contains quotes in the text the sub match stops at the first instance, see below: Failing input strings ("Lorem ipsum dolor \"sit\" amet, consectetur adipiscing elit.") Only sub matches: Lorem ipsum dolor ("Lorem ipsum dolor 'sit' amet, consectetur adipiscing elit.") The entire match fails. Notes The input strings are actually php code function calls. I'm writing a script that will scan .php source files for a specific function and grab the text from the first parameter.

    Read the article

  • UIScrollView notifications

    - by ryyst
    Hi, I'm coding an app that works much like Apple's Weather.app: There's a UIPageControl at the bottom and a UIScrollView in the middle of the screen. In my code, I implemented the - (void)scrollViewDidEndDecelerating:(UIScrollView *)scrollView method to figure out when the user did move to a new page. If they move to a new page, I load the adjacent pages' data, as to make further page-switching faster. (In one of Apple's examples, the - (void)scrollViewDidScroll:(UIScrollView *)sender is used, but that causes my app to shortly hang when loading a new page, so it's not suitable.) That code works very well. I'm using scrollRectToVisible:: to programmatically scroll inside the scrollview when the user clicks the UIPageControl. The problem is that the scrollRectToVisible: doesn't post a notification to the UIScrollViewDelegate when it's done scrolling - so the code responsible for loading adjacent pages never get's called when using the UIPageControl. Is there any way to make the UIScrollView notify its delegate when it gets called by the scrollRectToVisible: method? Or will I have to use threads in order to prevent my app from freezing? Thanks! -- Ry

    Read the article

< Previous Page | 264 265 266 267 268 269 270 271 272 273 274 275  | Next Page >