Search Results

Search found 14961 results on 599 pages for 'tab complete'.

Page 268/599 | < Previous Page | 264 265 266 267 268 269 270 271 272 273 274 275  | Next Page >

  • Why does the task pictogram flashes instead of opening the program?

    - by fredley
    Sometimes, when I select a click a program on the Windows 7 taskbar it won't appear (it doesn't gain focus and remains behind other open windows), and the icon will flash and turn orange. This happens reasonably frequently, and I've had it happen on two separate Windows installs on different machines. It just happened now and the only programs I have with active windows are Chrome, WMP and Explorer (2). It happened when I clicked Explorer. Once this has happened to one window, it affects all windows, and the only way I can switch between programs is by finding the window manually or using Windows+Tab. The only way I've come across to get the computer to snap out of this annoying behaviour is to restart the machine. Is there a way of stopping it? Edit Here's a video of it happening: http://www.youtube.com/watch?v=P12OxKK0kM4

    Read the article

  • Office 365 - unable to deactivate

    - by Jake
    We are using Office 365 ProPlus 2013. A new user tried to activate their install and received the error that they had reached their install limit of 5 machines. Upon clicking the link the deactivate previous installs that appears in that error dialog, the user is taken to their Office software management tab. Usually, if the user has previous installs, they are listed here and the user is able to deactivate. However, in this case, previous installs do not appear and it seems something else may be the problem. I am looking for any suggestions as to what may be the problem, thanks.

    Read the article

  • how not to allow muliple keystokes received at one key press?

    - by Untopronor
    when we press a key and keep pressing it the keypress and keydown event continuously fires. Is there a way to let these fire only after a complete cycle ,eg keydown and then key up. I would like the user not to be able press the key continuously rather would like the user have to press then release the key board to type a character ! so that following case do not occur eg : pppppppppppppppppppppppp when user presses 'p' for 1 sec.

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Auto-connect Bluetooth headphones in Windows 7 64bit

    - by CptSkippy
    I have a pair of bluetooth headphones that I've successfully paired with my Windows 7 64bit machine and audio plays through them without a hitch. On the Device Stage under the properties of the headphones in troubleshooting it shows "last connected" as "currently connected" even if I power cycle the headphones or after a reboot of my computer. So the Windows bluetooth stack has no trouble finding them. The problem I have is that whenever the headphones reconnect to my pc they show up as disconnected in the Sound Settings and no sound is routed to them until I manually connect them. I have to go into Sound Settings, then from the Playback tab right click on the headphones and choose the Connect option. Is there a way to make the Sound Settings connect automatically whenever the headphones are available to Windows?

    Read the article

  • How do I turn off caching in IIS7?

    - by jammus
    Hello. I'm developing an ASP classic site under Windows 7 (form a queue ladies). The problem is IIS seems to be heavily making use of its cache for both static and dynamic content which really conflicts with my 'make a small change, alt-tab, hit ctrl-F5' development style. Changes made to .asp files may take two or three refreshes to show up where as changes to .js files can take 20 times as many. How do I go about turning the caching off on my development machine? Cheers. in b4 stop using asp classic

    Read the article

  • How can i resolve the N+1 Selects problem ?

    - by Maxime ARNSTAMM
    Hello everyone, I have trouble understanding how to avoid the n+1 select in jpa or hibernate. From what i read, there's the 'left join fetch', but i'm not sure if it still works with more than one list (oneToMany).. Could someone explain it to me, or give me a link with a clear complete explanation please ? I'm sorry if this is a noob question, but i can't find a real clear article or doc on this issue. Thanks

    Read the article

  • Could not load file or assembly for c1webreport1 tool in compnentone studio

    - by Omprakash
    I'm using Licensed componentone product in my ASP.NET application and spcefically i use C1WebReport1 control from the product.while upgrading C1WebReport1 control from version 2.5.20072.239 to 2.6.20093.53207,i get the error message as "Could not load file or assembly 'C1.Web.C1WebReport.2, Version=2.6.20093.53207, Culture=neutral, PublicKeyToken=594a0605db190bb9' or one of its dependencies. The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040)" can any one help me to bring complete solution? Thanks in advance. Regards Omprakash

    Read the article

  • how to change the default open-with program to a program on the second disk

    - by Scott????
    I have a 250GB HDD for my system and a 60GB SSD using a SATA port. I installed most of my applications on the SSD. There's a strange thing though. I can not change the default open-with program to a program which is on the SSD. I think it may be caused by permission so I gave my user a 'full control' permission on the security tab in disk properties. But changing permissions is not work. After I choose an application (I've tried Notepad++, Sublime, 7Zip, etc.), nothing is added in the below window: Also, if I install 7Zip on my machine, the right click menu items can not be added.

    Read the article

  • How to columnate text with tabs (in vim or on the shell)

    - by kine
    I have a frequent need to manually manipulate tab-delimited text for data entry and other purposes, and when i do this it helps if the text is aligned properly into columns. For example (assuming 4-space tabs): # original format abcdefghijklmnop field2 abcdefgh field2 abcdefghijkl field2 # ideal format abcdefghijklmnop field2 abcdefgh field2 abcdefghijkl field2 I am very familiar with using the column utility to columnate text this way, but the problem is that it uses spaces to align the columns, and i specifically need tabs. This requirement also appears to rule out the Tabularize plug-in. Is there any way that i can columnate text with tabs specifically, either within vim or at the shell? It looks like i might be able to do it with groff/tbl, but honestly i'd rather columnate it by hand than mess with that....

    Read the article

  • how to detect whether strings are not captured for localization in .po files i.e no equivalent entry

    - by Manjushree
    Hi we have some queries regarding localization/.po files 1 We want to detect the missing strings or strings which are not being captured for L10N. how we can detect that? is that any method or command to update the strings 2 Locale files (.po) for "cn-zh" or another Locale are not complete (missing strings) 3 String has been captured for L10N but does not have a matching pair in .po files

    Read the article

  • FlexUnit 4 Error

    - by OXMO456
    Hi, I am facing a strange FlexUnit Error: Whoa... been asked to send another complete and I already did that The error seem to occur when the number of test exceede 27...? test exemple: [Test] public function whenDoingThat_expectThatIsTrue():void{ //blabla assertTrue(...) } Any help welcome !

    Read the article

  • Firefox generating error?

    - by Lynda
    I run Firebug on my computer since I develop websites. And I have been noticing this error consistently with every page I go to and I am lost as to what it is and believe it might be Firefox causing this error. Has anyone seen it before? Here is the error: An exception occurred. Traceback (most recent call last): File "resource://jid1-g0j5yenav9jwla-at-jetpack-api-utils-lib/tabs/tab.js", line 254, in null .getInterface(Ci.nsIWebNavigation) Error: Permission denied for <http://superuser.com> to create wrapper for object of class UnnamedClass

    Read the article

  • What do light purple color mean in uTorrent

    - by blasteralfred
    I run uTorrent 3.1.2 in my Windows 7 PC. When I download one file, I see some purple colored lines under Files Tab Pieces. Below is an image of what I am telling (little resized); I think that the light green color indicates downloaded parts. But I have no idea about purple lines. The file is a streamable mp3 file. The connection speed is very low, about 5KB/s down and 1KB/s up. The done file size is not progressing in a smooth way (usually changes in KB are visible), it stays as it is for sometime and then changes to a size (changes in MB), and again the same thing. Questions: Why does this happen? What does the purple color mean? Thank you.

    Read the article

  • Autocomplete functionality on a textarea

    - by sslepian
    Is there a way to implement auto-complete functionality in a region defined by textarea tags or something similar? I'm currently using a jquery autocomplete plugin to suggest input to the user inside input tags, but the issue is that the autocomplete phrases can often be fairly long and thus scroll off the edge of the input field.

    Read the article

  • How to make Microsoft Keyboard special keys run osascript commands on OS X?

    - by t-a-w
    I'm trying to make (1) special key open new terminal window. I bound it to file /Users/taw/bin/new_term, which contains: #!/bin/sh exec osascript -e 'tell application "Terminal" to do script "cd ."' This does the trick, except it also opens a Terminal window with this (even though Terminal.app is configured to always close windows when processes finish): Last login: Thu Mar 11 19:41:29 on ttys000 /Users/taw/bin/new_term ; exit; ~$ /Users/taw/bin/new_term ; exit; tab 1 logout [Process completed] How do I make it all work correctly? (possibly using a way different that what I've been attempting so far)

    Read the article

  • Microsoft Outlook 2007 - General Failure. The URL was: "<http:/something.com>". The parameter is incorrect

    - by Simon Peverett
    For the last two days, Outlook has decided it doesn't like URL's. Any email message that comes in containing an URL will show the following in an error dialogue message box when I click on the link: General Failure. The URL was: "http:/something.com/somewhere/". The parameter is incorrect If I copy the link into a browser, it works correctly. OS is Windows XP SP 3, Microsoft Office 2007 (Outlook), Internet Explorer 8 (also Chrome). I have, of course, Googled this and the two most popular solutions are: Solution 1: Add/Remove programs Set Program Access and Defaults Custom tab Make sure a default browser is selected Solution 2: Add/Remove Programs Select the MS Office 2007 item Click Change Click Repair I have tried both of these and I still get the problem. Has anyone else had this problem and solved it with a solution other than those listed above?

    Read the article

  • download file exception handling

    - by klaus-vlad
    Hi, In my application I download several critical files from a server, and I want to write some code that handles the case where the a file download didn't complete for a reason or other ,to retry downloading it at next startup. The function that downloads a file at a time however throws only MalformedURLException and IOException , but if these exceptions are thrown that means that the download didn't even begin. How should I arrange things so I can treat the case where a download failed , even if it began ? download(String file) throws MalformedURLException ,IOException { }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Notepad++ tabbing out of tags, autocomplete

    - by Matt
    I'm trying to learn a little HTML. Everyone says to use Notepad++ over notepad. I have autocomplete on. My question: When I type my opening tag and Notepad++ then puts"""" closing tag, how do I "jump" out of the tag when I'm done typing? If I tab or hit enter, I'm still stuck before the closing tag. I can use my arrow keys, but if I'm going to do that, I would rather just type the closing tags. Also if I have an UL of 10 items, and I want to change it to an OL, how do I select both the opening and closing tags so I may edit them at the same time? Thanks PS I wasn't able to post the HTML tags.

    Read the article

  • How to poll the popular websites in PHP?

    - by Runner
    It's springed from this answer: http://superuser.com/questions/129741/how-does-search-engines-update-indexing-so-soon/129743#129743 BTW,for the servers that's polled,is it the same whether the request is just for polling(header information) or complete web page?

    Read the article

  • Google docs spreadsheet not loading

    - by Pythonista's Apprentice
    I have a Google spreadsheet with a lot of very important data and some scripts that where working well. At some point, the brownser crash and I reload the page. After that, I can't acess that (only that!) spreadsheet any more! I try it from other Google accounts but it doesn't work. All I get is the "Loading..." message in the brownser tab and nothing more (the loading process never completes). I also can't: copy the file or download it! Ie, I can lose all the information in my spreadsheet and also lose all my scripts! (I never think something like this could hapen with a Google Product) How can I solve this problem? Thanks in advance for any help!

    Read the article

  • jQuery scroll fails for iframe (firefox)

    - by knappy
    I cannot get scroll to work, here is the complete stuff: http://zed.mit.edu/scroll2/buc.php I'm trying to refresh the page while maintaining the scroll position of the iframe inside. I'd like to have an alert when I actively scroll the iframe, these two both fail: $(top).frames['#iframe_bucinid'].scroll(function() .... $('#iframe_bucinid').scroll(function() ... The page's iframe is defined as: <iframe class="inframe" src="bucin.php" name="bucin" id="iframe_bucinid"> Notice that getting the scrollTop works with top.frames['bucin'].document.body.scrollTop

    Read the article

< Previous Page | 264 265 266 267 268 269 270 271 272 273 274 275  | Next Page >