Search Results

Search found 14961 results on 599 pages for 'tab complete'.

Page 267/599 | < Previous Page | 263 264 265 266 267 268 269 270 271 272 273 274  | Next Page >

  • Calendar event correct PHP script

    - by Marin
    Hello everybody! I need somebody(If you have time:) ) to help me find a good Calendar event script that functions:)Please help me.Thank you in advance:) Ps:I am looking for a complete web application which will run on a WAMP environment and has a GUI based installer or minimal command line installation requirements

    Read the article

  • Ldap access lists users even if user has no rights...

    - by Patkos Csaba
    I am trying to set up a more complex Active Directory structure for some testing purposes. What I did so far: set up 2 windows (one 2008 and one 2003) to control the same domain set up an Organizational Unit (ou): Developers set up 2 child OUs: "one" and "two" each OU has it's admin: adminOne and adminTwo I denied all access to OU "two" by removing on the Security tab all the groups I don't want to access it. now, when I log in as adminOne and I try to click on OU "two" it says I don't have permissions to see the users and properties of "two" - this is perfect, it's what I want Here comes my problem: I do a LDAP query with the adminOne user on the "Developers" What I expect to happen: I expect to retrieve the users from Developer - One I expect to NOT be able to retrieve the users from Developers - Two What actually happens: ldap shows all the users, both from Developers - One and Developers - Two, even if the user should not have permissions to Developers - Two And now my question: is there any specific settings on Windows 2003 or 2008 Active Directory servers which allow or deny access over LDAP? I could not find any.

    Read the article

  • OMG. Is Webmin safe? I can see file codes in Chrome browser without login

    - by Arwana
    When Im in File Manager of Webmin, I can double click and see the codes of the files in new tab in Firefox with its specific URL. But when I remove ?rand=xxxx... after the file.php and paste the URL in Chrome browser, I still can see the codes. This is the URL I just pasted in the Chrome browser http://xxx.xxx.xxx.xxx:10000/file/show.cgi/var/www/html/mysite.com/files/file.php And then, I logout of webmin, and I change the file.php with other file, I can see the codes. OMG. Is Webmin safe? and how to secure this?

    Read the article

  • Time tracking similar to Paymo Plus on Debian

    - by aditya menon
    PaymoPlus is free (closed source but no fees) PaymoPlus sits in my System Tray all day, and records every window/tab I open I would like to know if a similar app exists for Debian. Paymo for Windows/Mac has the additional sweet feature of being able to drag and drop working windows/tabs and the time spent into the tasks, but one can live without this. I would at least need to know which tasks got how much time in a 'sum total' calculation so I can enter that time into my Paymo reporting. Any ideas? Paymo does have a desktop widget for Linux but it is a dumb (non-sentient) manual time entry tool, not like Paymo Plus automatically recording everything being done.

    Read the article

  • match strings in python

    - by mesun
    Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

    Read the article

  • Convert Dashes to CamelCase in PHP

    - by Kirk
    Can someone help me complete this PHP function? I want to take a string like this: 'this-is-a-string' and convert it to this: 'thisIsAString': function dashesToCamelCase($string, $capitalizeFirstCharacter = false) { // Do stuff return $string; }

    Read the article

  • Is there any way to see the contents of a device via windows media player/sync?

    - by snorfys
    I've got a sansa clip mp3 player and an htc touch pro 2 phone that I put music/audio books etc. on. Putting stuff on there is easy peasy I open media player 11, go to the sync tab at the right and drag media to it. The problem is seeing what's already on there and removing anything I no-longer want on there - I have no way to see that aside from browsing via explorer. Both devices move media around to specifc folders so it's a bit annoying. Is there any way to do what I need in media player or is there any other good and free alternatives that will?

    Read the article

  • GNU Screen Draw Lag

    - by Daeden
    I like using screen with multiple splits. I usually like 3 sections Resource Monitoring using HTop Text Editor using VIM Command line using Bash My issue is that, when I am doing something that writes a good deal of text to STDOUT like running Make and if I am focused on that section, Screen lags on me. So much so, that the other sections no longer update and screen is not responsive to commands like CTRL-A + TAB. I'm not entirely sure what the problem is, but it appears to have something to do with the cursor location which blinks wildly while this is happening. I'm aware that using the vertical split functionality of Screen can lead to lag, but is this the cause? If so, is there a way to fix it aside from redirecting STDOUT?

    Read the article

  • What functions a lexer needs to provide?

    - by M28
    I am making a lexer, don't tell me to not do because I already did most of it. Currently it makes an array of tokens and that's it. I would like to know, what functions the lexer needs to provide and a brief explanation of what each function needs to do. I'll accept the most complete list. An example function would be: next: Consume the current token and return it

    Read the article

  • Brilliant features of C++

    - by John
    (Following Features to remove from C++ and Desired features for C++, I thought why not complete the trio...) What C++ features would you not change? What features are elegantly and brilliantly implemented and still look better than other popular languages?

    Read the article

  • alternatives to roboform

    - by ldigas
    Yes, I know there is already a few similar questions. Is there an alternative to RoboForm (which for some reason makes my FF very slow, because of some other extensions) which has the same way of working. What I mean, you click on ... and it opens a new tab with the page in question, and logs on to it (so no databases, and such ...). One other advantage would be if it kept passwords locally. Basically, I'm looking for RoboForm other than RoboForm. Anyone knows of any ?

    Read the article

  • Sequencing 2 lines of JQUERY

    - by nobosh
    I have the following lines of JQUERY: // When dragging ends stop: function(event, ui) { // Replace the placeholder with the original $placeholder.after( $this.show() ).remove(); // Run a custom stop function specitifed in the settings settings.stop.apply(this); }, I don't want settings.stop.apply(this); to run UNTIL the line above is $placeholder.after( $this.show() ).remove();, right now what's happening is the settings.stop is running to early. With JQUERY, how can I Sequence these two lines to not proceed until the first is complete? Thanks

    Read the article

  • Windows 7/Outlook 2010 cut off controls on form windows

    - by D..
    I am running windows 7 with multiple monitors. 2 at 1920 x 1200 and 1 at 1600x900 resolution. Controls are cut off and I cannot view the entire content of the window. As far as I can tell I only have the issue with Outlook 2010, it may be present in other applications but I haven't noticed it. For example to get to the more settings button I have to use tab and then click enter. The more settings button is never visible. I have used applications that allow you to force windows to be resizable, however the anchoring is such that it remains cut off. This has been present over multiple clean installs on the system. My DPI is set to 100% unlike this issue.

    Read the article

  • How can i resolve the N+1 Selects problem ?

    - by Maxime ARNSTAMM
    Hello everyone, I have trouble understanding how to avoid the n+1 select in jpa or hibernate. From what i read, there's the 'left join fetch', but i'm not sure if it still works with more than one list (oneToMany).. Could someone explain it to me, or give me a link with a clear complete explanation please ? I'm sorry if this is a noob question, but i can't find a real clear article or doc on this issue. Thanks

    Read the article

  • Is there a terminal that features sliding like guake and screen spliting like terminator on Linux?

    - by e-satis
    Sliding means I got the terminal always in background and I can call it with a shortcut, and it will slide down from the top of the screen like in Quake (which why the most known terminal implementing it is called guake). Splitting terminal means I can seen in one terminal tab several shells, like with screen or tmux. But I can also take the focus on each part of the terminal by clicking on it, not just with a 4 keys keyboard shortcut. Which terminator let me do. Is there a terminal that features both on Linux ? Even something I can pay for.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Microsoft Outlook 2007 - General Failure. The URL was: "<http:/something.com>". The parameter is incorrect

    - by Simon Peverett
    For the last two days, Outlook has decided it doesn't like URL's. Any email message that comes in containing an URL will show the following in an error dialogue message box when I click on the link: General Failure. The URL was: "http:/something.com/somewhere/". The parameter is incorrect If I copy the link into a browser, it works correctly. OS is Windows XP SP 3, Microsoft Office 2007 (Outlook), Internet Explorer 8 (also Chrome). I have, of course, Googled this and the two most popular solutions are: Solution 1: Add/Remove programs Set Program Access and Defaults Custom tab Make sure a default browser is selected Solution 2: Add/Remove Programs Select the MS Office 2007 item Click Change Click Repair I have tried both of these and I still get the problem. Has anyone else had this problem and solved it with a solution other than those listed above?

    Read the article

  • strtotime() doesn't work with dd/mm/YYYY format!

    - by Syom
    I really like the strtotime() function, but the user manual doesn't give a complete description of the supported date formats. strtotime('dd/mm/YYYY') doesn't work, it works only with mm/dd/YYYY format. if i have date in dd/mm/YYYY format, ho can i convert it to YYYY-mm-dd? i can do it by using explode() function, but i think tere are better solution. Thanks

    Read the article

  • Firefox keyboard shortcuts to menu items / add-on functions

    - by Cel
    At the moment I'm using context menus a lot to access commands in Firefox, but I would like to replace this repetitive clicking and searching with keyboard shortcuts for the common tasks that I perform. How to assign keys to add-on functionality? E.g. I use Close Other Tabs from Tab Mix Plus a lot - but I could not find any add-on that allows me to create a key combination for it e.g. Ctrl Alt Shift F4? My search did yield Key config, but this extension does not allow mapping to add-on functions I thought Menu Editor might be relevant, as you can change menus with it, and re-arrange even add-on items A rather demanding solution here, which seems to require re-compiling some jar files Customizing menu shortcuts in Firefox

    Read the article

  • Why does the task pictogram flashes instead of opening the program?

    - by fredley
    Sometimes, when I select a click a program on the Windows 7 taskbar it won't appear (it doesn't gain focus and remains behind other open windows), and the icon will flash and turn orange. This happens reasonably frequently, and I've had it happen on two separate Windows installs on different machines. It just happened now and the only programs I have with active windows are Chrome, WMP and Explorer (2). It happened when I clicked Explorer. Once this has happened to one window, it affects all windows, and the only way I can switch between programs is by finding the window manually or using Windows+Tab. The only way I've come across to get the computer to snap out of this annoying behaviour is to restart the machine. Is there a way of stopping it? Edit Here's a video of it happening: http://www.youtube.com/watch?v=P12OxKK0kM4

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

< Previous Page | 263 264 265 266 267 268 269 270 271 272 273 274  | Next Page >