Search Results

Search found 4231 results on 170 pages for 'pre buildevent'.

Page 27/170 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Paypal NVP API - Keep getting error 81002

    - by Andree
    Hi there, I am new to PayPal API, and I'm having trouble calling SetExpressCheckout using CURL in PHP. I have set everything correctly, as far as I'm concerned, but I kept getting an 81002 error "Method Specified is not Supported". The code snippet is below. I got the CA Root certificates file from here. <?php $paypal_data = array( 'USER' => urlencode('andree_1272823561_biz_api1.gmail.com'), 'PWD' => urlencode('1272823576'), 'SIGNATURE' => urlencode('Am1t0wiu2tv7VwZ5ebdeY9zv1GF6Ad0PFz-qTGFFf7vbWU6ee4bxy8KL'), 'VERSION' => urlencode('52.0'), 'PAYMENTACTION' => urlencode('Sale'), 'METHOD' => urlencode('SetExpressCheckout'), 'AMT' => urlencode('52.00'), 'RETURNURL' => urlencode('get_express_checkout_details.php'), 'CANCELURL' => urlencode('index.php') ); $url = 'https://api-3t.sandbox.paypal.com/nvp?' . http_build_query($paypal_data); $curl = curl_init(); curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_RETURNTRANSFER, 1); curl_setopt($curl, CURLOPT_CAINFO, dirname(__FILE__) . '/cacert.pem'); $result = curl_exec($curl); curl_close($curl); parse_str($result, $result); ?> <pre>Data sent: <?php print_r($paypal_data); ?></pre> <pre>Result: <?php print_r($result); ?></pre> When I run the code, the output is the following: Data sent: Array ( [USER] => andree_1272823561_biz_api1.gmail.com [PWD] => 1272823576 [SIGNATURE] => Am1t0wiu2tv7VwZ5ebdeY9zv1GF6Ad0PFz-qTGFFf7vbWU6ee4bxy8KL [VERSION] => 52.0 [PAYMENTACTION] => Sale [METHOD] => SetExpressCheckout [AMT] => 52.00 [RETURNURL] => get_express_checkout_details.php [CANCELURL] => index.php ) Result: Array ( [ACK] => Failure [L_ERRORCODE0] => 81002 [L_SHORTMESSAGE0] => Unspecified Method [L_LONGMESSAGE0] => Method Specified is not Supported [L_SEVERITYCODE0] => Error ) Anyone knows what could be the problem? Regards, Andree.

    Read the article

  • Installing Rails 3 - /usr/local/bin/rails: No such file or directory

    - by viatropos
    I just ran these two commands: sudo gem install rails --pre sudo gem install railties --pre Now when I run rails myapp, I get this: -bash: /usr/local/bin/rails: No such file or directory Here's some system info: $ ruby -v ruby 1.8.7 (2009-06-12 patchlevel 174) [i686-darwin9.7.0] $ sudo gem update --system Updating RubyGems Nothing to update I tried copy/pasting the bin/rails file into /usr/local/bin/rails, and changing permissions to sudo chmod 755 /usr/local/bin/rails, but that doesn't work. Any ideas how to get up and running?

    Read the article

  • aspNetCompatibility WCF and WinForm

    - by user190084
    I would like to use Windows Forms with a WCF service and leverage the pre-built authentication of asp.net by using aspNetCompatibilityEnabled = true in the WCF service. Is there any module or pre-built assemblies that can add ASP.NET functionality to a Windows Forms application? As far as I understand, this functionality isn't built into Windows Forms and can't be leveraged.

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • how to generate PMK?

    - by sebby_zml
    Hi everyone, I would like to know how can I generate a random pre-master key PMK in java? (related in key exchange and authentication) Is it similar with other randam key generating? What particularly is a pre master key? Thanks, Sebby.

    Read the article

  • problems with chili source code highlighter (mysql)

    - by jason
    I am using Chili source code highlighter it works fine with php source using php as the class. But when i change it to mysql it doesnt highlight any SQL code i also tried sql as the classname, i double checked the recipes' and there is a mysql recipes in there. ... What could i be doing wrong? <pre><code id="code" class="php"></code></pre>

    Read the article

  • iPhone HTTP Live Streaming not working on models below 3GS

    - by dreamer
    We are using http live streaming for on demand video from within our iPhone app and on the 3GS models the videos play as they are meant to. However, on the models pre 3GS it gives an error saying this movie format is not supported. I have seen other threads on this however no solutions or insights. Does anyone know if this really is a hardware limitation of the pre 3GS phones or does it have something to do with our code?

    Read the article

  • shell_exec() Doesn't Show The Output

    - by Nathan Campos
    I'm doing a PHP site that uses a shell_exec() function like this: $file = "upload/" . $_FILES["file"]["name"]; $output = shell_exec("leaf $file"); echo "<pre>$output</pre>"; Where leaf is a program that is located in the same directory of my script, but when I tried to run this script on the server, I just got nothing. What is wrong?

    Read the article

  • Visual C++ preprocessor definitions

    - by alemjerus
    Is there a way to transfer C++ preprocessor definitions into a custom pre-link step procedure call as a command-line parameter or export them into a file any other way? Example: Let's say, I have a c++ project, and in it's Debug configuration I put a preprocessor definition like MAKUMBA_OBA=0x13 Then I add custom pre-link step which executes some javascript like sarahjessicaparker.js /to tomsrhinoplasty $(MAKUMBA_OBA) It would be great, if it just worked, but I never get a third parameter in my js. So the question is: how to pass a preprocessor definition to s script?

    Read the article

  • Difference in DocumentBuilder.parse when using JRE 1.5 and JDK 1.6

    - by dhiller
    Recently at last we have switched our projects to Java 1.6. When executing the tests I found out that using 1.6 a SAXParseException is not thrown which has been thrown using 1.5. Below is my test code to demonstrate the problem. import java.io.StringReader; import javax.xml.parsers.DocumentBuilder; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.stream.StreamSource; import javax.xml.validation.SchemaFactory; import org.junit.Test; import org.xml.sax.InputSource; import org.xml.sax.SAXParseException; /** * Test class to demonstrate the difference between JDK 1.5 to JDK 1.6. * * Seen on Linux: * * <pre> * #java version "1.6.0_18" * Java(TM) SE Runtime Environment (build 1.6.0_18-b07) * Java HotSpot(TM) Server VM (build 16.0-b13, mixed mode) * </pre> * * Seen on OSX: * * <pre> * java version "1.6.0_17" * Java(TM) SE Runtime Environment (build 1.6.0_17-b04-248-10M3025) * Java HotSpot(TM) 64-Bit Server VM (build 14.3-b01-101, mixed mode) * </pre> * * @author dhiller (creator) * @author $Author$ (last editor) * @version $Revision$ * @since 12.03.2010 11:32:31 */ public class TestXMLValidation { /** * Tests the schema validation of an XML against a simple schema. * * @throws Exception * Falls ein Fehler auftritt * @throws junit.framework.AssertionFailedError * Falls eine Unit-Test-Pruefung fehlschlaegt */ @Test(expected = SAXParseException.class) public void testValidate() throws Exception { final StreamSource schema = new StreamSource( new StringReader( "<?xml version=\"1.0\" encoding=\"UTF-8\"?>" + "<xs:schema xmlns:xs=\"http://www.w3.org/2001/XMLSchema\" " + "elementFormDefault=\"qualified\" xmlns:xsd=\"undefined\">" + "<xs:element name=\"Test\"/>" + "</xs:schema>" ) ); final String xml = "<Test42/>"; final DocumentBuilderFactory newFactory = DocumentBuilderFactory.newInstance(); newFactory.setSchema( SchemaFactory.newInstance( "http://www.w3.org/2001/XMLSchema" ).newSchema( schema ) ); final DocumentBuilder documentBuilder = newFactory.newDocumentBuilder(); documentBuilder.parse( new InputSource( new StringReader( xml ) ) ); } } When using a JVM 1.5 the test passes, on 1.6 it fails with "Expected exception SAXParseException". The Javadoc of the DocumentBuilderFactory.setSchema(Schema) Method says: When errors are found by the validator, the parser is responsible to report them to the user-specified ErrorHandler (or if the error handler is not set, ignore them or throw them), just like any other errors found by the parser itself. In other words, if the user-specified ErrorHandler is set, it must receive those errors, and if not, they must be treated according to the implementation specific default error handling rules. The Javadoc of the DocumentBuilder.parse(InputSource) method says: BTW: I tried setting an error handler via setErrorHandler, but there still is no exception. Now my question: What has changed to 1.6 that prevents the schema validation to throw a SAXParseException? Is it related to the schema or to the xml that I tried to parse?

    Read the article

  • Algorithm to suggest a list of tags to users

    - by Itay Moav
    Given a free text, I need to analyse this this text and suggest a list of tags from a pre existing list. What algorithms are out there in the market? Can they handle a case where, for example, the text have a word like high cholesterol and I would like it so suggest heart disease although "high cholesterol" might not exists (initially) in the pre defined list.

    Read the article

  • Is an editable select box the right way?

    - by Neil Middleton
    I have a scenario where a user is emailing another user in an HTML based web app. For the To: field, the user may select one of a pre-defined list of emails OR enter their own ignoring the pre-defined options. What would be the best way of doing this from a UI point of view? I've looked at editable select boxes using jQuery but none seem to let you enter your own option. Is there some other UI mechanism that would work here?

    Read the article

  • jQuery datepicker calendar - call to function updates database

    - by erbaker
    So I'm using the datepicker plugin to make an availability calendar. Here is my javascript: http://pastebin.com/H7D9PcAg When dpSetSelected() is called it is also calling dateSelected() which triggers the AJAX call to my PHP script. I need a way to only update the database if the date is clicked on and not pre-loaded. When I pre-load the dates they are sent to the PHP page and subsequently removed.

    Read the article

  • How to avoid my this facebook app api login page?

    - by user1035140
    I got a problem regrading with my apps which is once I go to my apps, it sure will show me a login page instead of allow page? it always display the login page 1st then only display allow page, I had tried other apps, if I am 1st time user, It sure will appear the allow page only, it did not show me the login page. my question is how to I avoid my login page direct go to allow page? here is my login page picture here is my apps link https://apps.facebook.com/christmas_testing/ here is my facebook php jdk api coding <?php $fbconfig['appid' ] = "XXXXXXXXXXXXX"; $fbconfig['secret'] = "XXXXXXXXXXXXX"; $fbconfig['baseUrl'] = "myserverlink"; $fbconfig['appBaseUrl'] = "http://apps.facebook.com/christmas_testing/"; if (isset($_GET['code'])){ header("Location: " . $fbconfig['appBaseUrl']); exit; } if (isset($_GET['request_ids'])){ //user comes from invitation //track them if you need header("Location: " . $fbconfig['appBaseUrl']); } $user = null; //facebook user uid try{ include_once "facebook.php"; } catch(Exception $o){ echo '<pre>'; print_r($o); echo '</pre>'; } // Create our Application instance. $facebook = new Facebook(array( 'appId' => $fbconfig['appid'], 'secret' => $fbconfig['secret'], 'cookie' => true, )); //Facebook Authentication part $user = $facebook->getUser(); $loginUrl = $facebook->getLoginUrl( array( 'scope' => 'email,publish_stream,user_birthday,user_location,user_work_history,user_about_me,user_hometown' ) ); if ($user) { try { // Proceed knowing you have a logged in user who's authenticated. $user_profile = $facebook->api('/me'); } catch (FacebookApiException $e) { //you should use error_log($e); instead of printing the info on browser d($e); // d is a debug function defined at the end of this file $user = null; } } if (!$user) { echo "<script type='text/javascript'>top.location.href = '$loginUrl';</script>"; exit; } //get user basic description $userInfo = $facebook->api("/$user"); function d($d){ echo '<pre>'; print_r($d); echo '</pre>'; } ?

    Read the article

  • selenium, get text from id

    - by user3766148
    on the following url - http://www.filestube.to/26frq-Buffalo-Clover-Test-Your-Love-2014-9Jai9TJFukAS9fq9sWngAD.html I am trying to copy the; Direct links: turbobit.net/9mrb0eu9eksx/26frq.Buffalo.Clover..Test.Your.Love.2014.rar.html via css path or xpath and unable to retrieve the information and store it to a variable. firebug gives me html body div.cnt div.rH.no-js.fd div.rl div.fgBx pre span#copy_paste_links but when I apply css=html.body.div.cnt.div.rH.no-js.fd.div.rl.div.fgBx.pre.span#copy_paste_links/text() to the target, I get error not found http://i.imgur.com/KdBmDHE.png

    Read the article

  • Code example with annotation in JavaDoc

    - by John
    Hello, my JavaDoc doesn't work when I have a code example with an annotation. Any suggestions? /** * <pre> * public class Demo { * @DemoAnnotation * public void demoMethod() { * } * } * </pre> */ @Retention(RetentionPolicy.RUNTIME) @Target({ElementType.METHOD}) public @interface DemoAnnotation {

    Read the article

  • What's the fastest lookup algorithm for a key, pair data structure (i.e, a map)?

    - by truncheon
    In the following example a std::map structure is filled with 26 values from A - Z (for key) and 0 – 26 for value. The time taken (on my system) to lookup the last entry (10000000 times) is roughly 250 ms for the vector, and 125 ms for the map. (I compiled using release mode, with O3 option turned on for g++ 4.4) But if for some odd reason I wanted better performance than the std::map, what data structures and functions would I need to consider using? I apologize if the answer seems obvious to you, but I haven't had much experience in the performance critical aspects of C++ programming. #include <ctime> #include <map> #include <vector> #include <iostream> struct mystruct { char key; int value; mystruct(char k = 0, int v = 0) : key(k), value(v) { } }; int find(const std::vector<mystruct>& ref, char key) { for (std::vector<mystruct>::const_iterator i = ref.begin(); i != ref.end(); ++i) if (i->key == key) return i->value; return -1; } int main() { std::map<char, int> mymap; std::vector<mystruct> myvec; for (int i = 'a'; i < 'a' + 26; ++i) { mymap[i] = i - 'a'; myvec.push_back(mystruct(i, i - 'a')); } int pre = clock(); for (int i = 0; i < 10000000; ++i) { find(myvec, 'z'); } std::cout << "linear scan: milli " << clock() - pre << "\n"; pre = clock(); for (int i = 0; i < 10000000; ++i) { mymap['z']; } std::cout << "map scan: milli " << clock() - pre << "\n"; return 0; }

    Read the article

  • Google App Engine + AWS S3 file protection!

    - by grep
    Hi all, I have an application running on GAE/J that streams video from AWS S3. I need a solution for protecting the video from being stolen and I found that pre-signed URLs might be it (??). How can I create pre-signed URLs from GAE/J or there's a better solution to secure the videos? thanks

    Read the article

  • How can I forward ALL traffic over a site-to-site VPN on Cisco ASA?

    - by Scott Clements
    Hi There, I currently have two Cisco ASA 5100 routers. They are at different physical sites and are configured with a site-to-site VPN which is active and working. I can communicate with the subnets on either site from the other and both are connected to the internet, however I need to ensure that all the traffic at my remote site goes through this VPN to my site here. I know that the web traffic is doing so as a "tracert" confirms this, but I need to ensure that all other network traffic is being directed over this VPN to my network here. Here is my config for the ASA router at my remote site: hostname ciscoasa domain-name xxxxx enable password 78rl4MkMED8xiJ3g encrypted names ! interface Ethernet0/0 nameif NIACEDC security-level 100 ip address x.x.x.x 255.255.255.0 ! interface Ethernet0/1 description External Janet Connection nameif JANET security-level 0 ip address x.x.x.x 255.255.255.248 ! interface Ethernet0/2 shutdown no nameif security-level 100 no ip address ! interface Ethernet0/3 shutdown no nameif security-level 100 ip address dhcp setroute ! interface Management0/0 nameif management security-level 100 ip address 192.168.100.1 255.255.255.0 management-only ! passwd 2KFQnbNIdI.2KYOU encrypted ftp mode passive clock timezone GMT/BST 0 clock summer-time GMT/BDT recurring last Sun Mar 1:00 last Sun Oct 2:00 dns domain-lookup NIACEDC dns server-group DefaultDNS name-server 154.32.105.18 name-server 154.32.107.18 domain-name XXXX same-security-traffic permit inter-interface same-security-traffic permit intra-interface access-list ren_access_in extended permit ip any any access-list ren_access_in extended permit tcp any any access-list ren_nat0_outbound extended permit ip 192.168.6.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list NIACEDC_nat0_outbound extended permit ip 192.168.12.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list JANET_20_cryptomap extended permit ip 192.168.12.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list NIACEDC_access_in extended permit ip any any access-list NIACEDC_access_in extended permit tcp any any access-list JANET_access_out extended permit ip any any access-list NIACEDC_access_out extended permit ip any any pager lines 24 logging enable logging asdm informational mtu NIACEDC 1500 mtu JANET 1500 mtu management 1500 icmp unreachable rate-limit 1 burst-size 1 asdm image disk0:/asdm-522.bin no asdm history enable arp timeout 14400 nat-control global (NIACEDC) 1 interface global (JANET) 1 interface nat (NIACEDC) 0 access-list NIACEDC_nat0_outbound nat (NIACEDC) 1 192.168.12.0 255.255.255.0 access-group NIACEDC_access_in in interface NIACEDC access-group NIACEDC_access_out out interface NIACEDC access-group JANET_access_out out interface JANET route JANET 0.0.0.0 0.0.0.0 194.82.121.82 1 route JANET 0.0.0.0 0.0.0.0 192.168.3.248 tunneled timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout uauth 0:05:00 absolute http server enable http 192.168.12.0 255.255.255.0 NIACEDC http 192.168.100.0 255.255.255.0 management http 192.168.9.0 255.255.255.0 NIACEDC no snmp-server location no snmp-server contact snmp-server enable traps snmp authentication linkup linkdown coldstart crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto ipsec transform-set ESP-AES-256-SHA esp-aes-256 esp-sha-hmac crypto map JANET_map 20 match address JANET_20_cryptomap crypto map JANET_map 20 set pfs crypto map JANET_map 20 set peer X.X.X.X crypto map JANET_map 20 set transform-set ESP-AES-256-SHA crypto map JANET_map interface JANET crypto isakmp enable JANET crypto isakmp policy 10 authentication pre-share encryption aes-256 hash sha group 2 lifetime 86400 crypto isakmp policy 30 authentication pre-share encryption 3des hash sha group 2 lifetime 86400 crypto isakmp policy 50 authentication pre-share encryption aes-256 hash sha group 5 lifetime 86400 tunnel-group X.X.X.X type ipsec-l2l tunnel-group X.X.X.X ipsec-attributes pre-shared-key * telnet timeout 5 ssh timeout 5 console timeout 0 dhcpd address 192.168.100.2-192.168.100.254 management dhcpd enable management ! ! class-map inspection_default match default-inspection-traffic ! ! policy-map type inspect dns preset_dns_map parameters message-length maximum 512 policy-map global_policy class inspection_default inspect dns preset_dns_map inspect ftp inspect h323 h225 inspect h323 ras inspect rsh inspect rtsp inspect esmtp inspect sqlnet inspect skinny inspect sunrpc inspect xdmcp inspect sip inspect netbios inspect tftp inspect http ! service-policy global_policy global prompt hostname context no asdm history enable Thanks in advance, Scott

    Read the article

  • VS 2012 Code Review &ndash; Before Check In OR After Check In?

    - by Tarun Arora
    “Is Code Review Important and Effective?” There is a consensus across the industry that code review is an effective and practical way to collar code inconsistency and possible defects early in the software development life cycle. Among others some of the advantages of code reviews are, Bugs are found faster Forces developers to write readable code (code that can be read without explanation or introduction!) Optimization methods/tricks/productive programs spread faster Programmers as specialists "evolve" faster It's fun “Code review is systematic examination (often known as peer review) of computer source code. It is intended to find and fix mistakes overlooked in the initial development phase, improving both the overall quality of software and the developers' skills. Reviews are done in various forms such as pair programming, informal walkthroughs, and formal inspections.” Wikipedia No where does the definition mention whether its better to review code before the code has been committed to version control or after the commit has been performed. No matter which side you favour, Visual Studio 2012 allows you to request for a code review both before check in and also request for a review after check in. Let’s weigh the pros and cons of the approaches independently. Code Review Before Check In or Code Review After Check In? Approach 1 – Code Review before Check in Developer completes the code and feels the code quality is appropriate for check in to TFS. The developer raises a code review request to have a second pair of eyes validate if the code abides to the recommended best practices, will not result in any defects due to common coding mistakes and whether any optimizations can be made to improve the code quality.                                             Image 1 – code review before check in Pros Everything that gets committed to source control is reviewed. Minimizes the chances of smelly code making its way into the code base. Decreases the cost of fixing bugs, remember, the earlier you find them, the lesser the pain in fixing them. Cons Development Code Freeze – Since the changes aren’t in the source control yet. Further development can only be done off-line. The changes have not been through a CI build, hard to say whether the code abides to all build quality standards. Inconsistent! Cumbersome to track the actual code review process.  Not every change to the code base is worth reviewing, a lot of effort is invested for very little gain. Approach 2 – Code Review after Check in Developer checks in, random code reviews are performed on the checked in code.                                                      Image 2 – Code review after check in Pros The code has already passed the CI build and run through any code analysis plug ins you may have running on the build server. Instruct the developer to ensure ZERO fx cop, style cop and static code analysis before check in. Code is cleaner and smell free even before the code review. No Offline development, developers can continue to develop against the source control. Cons Bad code can easily make its way into the code base. Since the review take place much later in the cycle, the cost of fixing issues can prove to be much higher. Approach 3 – Hybrid Approach The community advocates a more hybrid approach, a blend of tooling and human accountability quotient.                                                               Image 3 – Hybrid Approach 1. Code review high impact check ins. It is not possible to review everything, by setting up code review check in policies you can end up slowing your team. More over, the code that you are reviewing before check in hasn't even been through a green CI build either. 2. Tooling. Let the tooling work for you. By running static analysis, fx cop, style cop and other plug ins on the build agent, you can identify the real issues that in my opinion can't possibly be identified using human reviews. Configure the tooling to report back top 10 issues every day. Mandate the manual code review of individuals who keep making it to this list of shame more often. 3. During Merge. I would prefer eliminating some of the other code issues during merge from Main branch to the release branch. In a scrum project this is still easier because cheery picking the merges is a possibility and the size of code being reviewed is still limited. Let the tooling work for you, if some one breaks the CI build often, put them on a gated check in build course until you see improvement. If some one appears on the top 10 list of shame generated via the build then ensure that all their code is reviewed till you see improvement. At the end of the day, the goal is to ensure that the code being delivered is top quality. By enforcing a code review before any check in, you force the developer to work offline or stay put till the review is complete. What do the experts say? So I asked a few expects what they thought of “Code Review quality gate before Checking in code?" Terje Sandstrom | Microsoft ALM MVP You mean a review quality gate BEFORE checking in code????? That would mean a lot of code staying either local or in shelvesets, and not even been through a CI build, and a green CI build being the main criteria for going further, f.e. to the review state. I would not like code laying around with no checkin’s. Having a requirement that code is checked in small pieces, 4-8 hours work max, and AT LEAST daily checkins, a manual code review comes second down the lane. I would expect review quality gates to happen before merging back to main, or before merging to release.  But that would all be on checked-in code.  Branching is absolutely one way to ease the pain.   Another way we are using is automatic quality builds, running metrics, coverage, static code analysis.  Unfortunately it takes some time, would be great to be on CI’s – but…., so it’s done scheduled every night. Based on this we get, among other stuff,  top 10 lists of suspicious code, which is then subjected to reviews.  If a person seems to be very popular on these top 10 lists, we subject every check in from that person to a review for a period. That normally helps.   None of the clients I have can afford to have every checkin reviewed, so we need to find ways around it. I don’t disagree with the nicety of having all the code reviewed, but I find it hard to find those resources in today’s enterprises. David V. Corbin | Visual Studio ALM Ranger I tend to agree with both sides. I hate having code that is not checked in, but at the same time hate having “bad” code in the repository. I have found that branching is one approach to solving this dilemma. Code is checked into the private/feature branch before the review, but is not merged over to the “official” branch until after the review. I advocate both, depending on circumstance (especially team dynamics)   - The “pre-checkin” is usually for elements that may impact the project as a whole. Think of it as another “gate” along with passing unit tests. - The “post-checkin” may very well not be at the changeset level, but correlates to a review at the “user story” level.   Again, this depends on team dynamics in play…. Robert MacLean | Microsoft ALM MVP I do not think there is no right answer for the industry as a whole. In short the question is why do you do reviews? Your question implies risk mitigation, so in low risk areas you can get away with it after check in while in high risk you need to do it before check in. An example is those new to a team or juniors need it much earlier (maybe that is before checkin, maybe that is soon after) than seniors who have shipped twenty sprints on the team. Abhimanyu Singhal | Visual Studio ALM Ranger Depends on per scenario basis. We recommend post check-in reviews when: 1. We don't want to block other checks and processes on manual code reviews. Manual reviews take time, and some pieces may not require manual reviews at all. 2. We need to trace all changes and track history. 3. We have a code promotion strategy/process in place. For risk mitigation, post checkin code can be promoted to Accepted branches. Or can be rejected. Pre Checkin Reviews are used when 1. There is a high risk factor associated 2. Reviewers are generally (most of times) have immediate availability. 3. Team does not have strict tracking needs. Simply speaking, no single process fits all scenarios. You need to select what works best for your team/project. Thomas Schissler | Visual Studio ALM Ranger This is an interesting discussion, I’m right now discussing details about executing code reviews with my teams. I see and understand the aspects you brought in, but there is another side as well, I’d like to point out. 1.) If you do reviews per check in this is not very practical as a hard rule because this will disturb the flow of the team very often or it will lead to reduce the checkin frequency of the devs which I would not accept. 2.) If you do later reviews, for example if you review PBIs, it is not easy to find out which code you should review. Either you review all changesets associate with the PBI, but then you might review code which has been changed with a later checkin and the dev maybe has already fixed the issue. Or you review the diff of the latest changeset of the PBI with the first but then you might also review changes of other PBIs. Jakob Leander | Sr. Director, Avanade In my experience, manual code review: 1. Does not get done and at the very least does not get redone after changes (regardless of intentions at start of project) 2. When a project actually do it, they often do not do it right away = errors pile up 3. Requires a lot of time discussing/defining the standard and for the team to learn it However code review is very important since e.g. even small memory leaks in a high volume web solution have big consequences In the last years I have advocated following approach for code review - Architects up front do “at least one best practice example” of each type of component and tell the team. Copy from this one. This should include error handling, logging, security etc. - Dev lead on project continuously browse code to validate that the best practices are used. Especially that patterns etc. are not broken. You can do this formally after each sprint/iteration if you want. Once this is validated it is unlikely to “go bad” even during later code changes Agree with customer to rely on static code analysis from Visual Studio as the one and only coding standard. This has HUUGE benefits - You can easily tweak to reach the level you desire together with customer - It is easy to measure for both developers/management - It is 100% consistent across code base - It gets validated all the time so you never end up getting hammered by a customer review in the end - It is easy to tell the developer that you do not want code back unless it has zero errors = minimize communication You need to track this at least during nightly builds and make sure team sees total # issues. Do not allow #issues it to grow uncontrolled. On the project I run I require code analysis to have run on code before checkin (checkin rule). This means -  You have to have clean compile (or CA wont run) so this is extra benefit = very few broken builds - You can change a few of the rules to compile as errors instead of warnings. I often do this for “missing dispose” issues which you REALLY do not want in your app Tip: Place your custom CA rules files as part of solution. That  way it works when you do branching etc. (path to CA file is relative in VS) Some may argue that CA is not as good as manual inspection. But since manual inspection in reality suffers from the 3 issues in start it is IMO a MUCH better (and much cheaper) approach from helicopter perspective Tirthankar Dutta | Director, Avanade I think code review should be run both before and after check ins. There are some code metrics that are meant to be run on the entire codebase … Also, especially on multi-site projects, one should strive to architect in a way that lets men manage the framework while boys write the repetitive code… scales very well with the need to review less by containment and imposing architectural restrictions to emphasise the design. Bruno Capuano | Microsoft ALM MVP For code reviews (means peer reviews) in distributed team I use http://www.vsanywhere.com/default.aspx  David Jobling | Global Sr. Director, Avanade Peer review is the only way to scale and its a great practice for all in the team to learn to perform and accept. In my experience you soon learn who's code to watch more than others and tune the attention. Mikkel Toudal Kristiansen | Manager, Avanade If you have several branches in your code base, you will need to merge often. This requires manual merging, when a file has been changed in both branches. It offers a good opportunity to actually review to changed code. So my advice is: Merging between branches should be done as often as possible, it should be done by a senior developer, and he/she should perform a full code review of the code being merged. As for detecting architectural smells and code smells creeping into the code base, one really good third party tools exist: Ndepend (http://www.ndepend.com/, for static code analysis of the current state of the code base). You could also consider adding StyleCop to the solution. Jesse Houwing | Visual Studio ALM Ranger I gave a presentation on this subject on the TechDays conference in NL last year. See my presentation and slides here (talk in Dutch, but English presentation): http://blog.jessehouwing.nl/2012/03/did-you-miss-my-techdaysnl-talk-on-code.html  I’d like to add a few more points: - Before/After checking is mostly a trust issue. If you have a team that does diligent peer reviews and regularly talk/sit together or peer review, there’s no need to enforce a before-checkin policy. The peer peer-programming and regular feedback during development can take care of most of the review requirements as long as the team isn’t under stress. - Under stress, enforce pre-checkin reviews, it might sound strange, if you’re already under time or budgetary constraints, but it is under such conditions most real issues start to be created or pile up. - Use tools to catch most common errors, Code Analysis/FxCop was already mentioned. HP Fortify, Resharper, Coderush etc can help you there. There are also a lot of 3rd party rules you can add to Code Analysis. I’ve written a few myself (http://fccopcontrib.codeplex.com) and various teams from Microsoft have added their own rules (MSOCAF for SharePoint, WSSF for WCF). For common errors that keep cropping up, see if you can define a rule. It’s much easier. But more importantly make sure you have a good help page explaining *WHY* it's wrong. If you have small feature or developer branches/shelvesets, you might want to review pre-merge. It’s still better to do peer reviews and peer programming, but the most important thing is that bad quality code doesn’t make it into the important branch. So my philosophy: - Use tooling as much as possible. - Make sure the team understands the tooling and the importance of the things it flags. It’s too easy to just click suppress all to ignore the warnings. - Under stress, tighten process, it’s under stress that the problems of late reviews will really surface - Most importantly if you do reviews do them as early as possible, but never later than needed. In other words, pre-checkin/post checking doesn’t really matter, as long as the review is done before the code is released. It’ll just be much more expensive to fix any review outcomes the later you find them. --- I would love to hear what you think!

    Read the article

  • CodePlex Daily Summary for Sunday, April 08, 2012

    CodePlex Daily Summary for Sunday, April 08, 2012Popular ReleasesExtAspNet: ExtAspNet v3.1.3: ExtAspNet - ?? ExtJS ??? ASP.NET 2.0 ???,????? AJAX ?????????? ExtAspNet ????? ExtJS ??? ASP.NET 2.0 ???,????? AJAX ??????????。 ExtAspNet ??????? JavaScript,?? CSS,?? UpdatePanel,?? ViewState,?? WebServices ???????。 ??????: IE 7.0, Firefox 3.6, Chrome 3.0, Opera 10.5, Safari 3.0+ ????:Apache License 2.0 (Apache) ??:http://extasp.net/ ??:http://bbs.extasp.net/ ??:http://extaspnet.codeplex.com/ ??:http://sanshi.cnblogs.com/ ????: +2012-04-08 v3.1.3 -??Language="zh_TW"?JS???BUG(??)。 +?D...Coding4Fun Tools: Coding4Fun.Phone.Toolkit v1.5.5: New Controls ChatBubble ChatBubbleTextBox OpacityToggleButton New Stuff TimeSpan languages added: RU, SK, CS Expose the physics math from TimeSpanPicker Image Stretch now on buttons Bug Fixes Layout fix so RoundToggleButton and RoundButton are exactly the same Fix for ColorPicker when set via code behind ToastPrompt bug fix with OnNavigatedTo Toast now adjusts its layout if the SIP is up Fixed some issues with Expression Blend supportHarness - Internet Explorer Automation: Harness 2.0.3: support the operation fo frameset, frame and iframe Add commands SwitchFrame GetUrl GoBack GoForward Refresh SetTimeout GetTimeout Rename commands GetActiveWindow to GetActiveBrowser SetActiveWindow to SetActiveBrowser FindWindowAll to FindBrowser NewWindow to NewBrowser GetMajorVersion to GetVersionBetter Explorer: Better Explorer 2.0.0.861 Alpha: - fixed new folder button operation not work well in some situations - removed some unnecessary code like subclassing that is not needed anymore - Added option to make Better Exlorer default (at least for WIN+E operations) - Added option to enable file operation replacements (like Terracopy) to work with Better Explorer - Added some basic usability to "Share" button - Other fixesText Designer Outline Text: Version 2 Preview 2: Added Fake 3D demos for C++ MFC, C# Winform and C# WPFLightFarsiDictionary - ??????? ??? ?????/???????: LightFarsiDictionary - v1: LightFarsiDictionary - v1WPF Application Framework (WAF): WPF Application Framework (WAF) 2.5.0.3: Version: 2.5.0.3 (Milestone 3): This release contains the source code of the WPF Application Framework (WAF) and the sample applications. Requirements .NET Framework 4.0 (The package contains a solution file for Visual Studio 2010) The unit test projects require Visual Studio 2010 Professional Changelog Legend: [B] Breaking change; [O] Marked member as obsolete [O] WAF: Mark the StringBuilderExtensions class as obsolete because the AppendInNewLine method can be replaced with string.Jo...GeoMedia PostGIS data server: PostGIS GDO 1.0.1.2: This is a new version of GeoMeda PostGIS data server which supports user rights. It means that only those feature classes, which the current user has rights to select, are visible in GeoMedia. Issues fixed in this release Fixed problem with renaming and deleting feature classes - IMPORTANT! - the gfeatures view must be recreated so that this issue is completely fixed. The attached script "GFeaturesView2.sql" can be used to accomplish this task. Another way is to drop and recreate the metadat...SkyDrive Connector for SharePoint: SkyDrive Connector for SharePoint: Fixed a few bugs pertaining to live authentication Removed dependency on Shared Documents Removed CallBack web part propertyClosedXML - The easy way to OpenXML: ClosedXML 0.65.2: Aside from many bug fixes we now have Conditional Formatting The conditional formatting was sponsored by http://www.bewing.nl (big thanks) New on v0.65.1 Fixed issue when loading conditional formatting with default values for icon sets New on v0.65.2 Fixed issue loading conditional formatting Improved inserts performanceLiberty: v3.2.0.0 Release 4th April 2012: Change Log-Added -Halo 3 support (invincibility, ammo editing) -Halo 3: ODST support (invincibility, ammo editing) -The file transfer page now shows its progress in the Windows 7 taskbar -"About this build" settings page -Reach Change what an object is carrying -Reach Change which node a carried object is attached to -Reach Object node viewer and exporter -Reach Change which weapons you are carrying from the object editor -Reach Edit the weapon controller of vehicles and turrets -An error dia...MSBuild Extension Pack: April 2012: Release Blog Post The MSBuild Extension Pack April 2012 release provides a collection of over 435 MSBuild tasks. A high level summary of what the tasks currently cover includes the following: System Items: Active Directory, Certificates, COM+, Console, Date and Time, Drives, Environment Variables, Event Logs, Files and Folders, FTP, GAC, Network, Performance Counters, Registry, Services, Sound Code: Assemblies, AsyncExec, CAB Files, Code Signing, DynamicExecute, File Detokenisation, GUID’...DotNetNuke® Community Edition CMS: 06.01.05: Major Highlights Fixed issue that stopped users from creating vocabularies when the portal ID was not zero Fixed issue that caused modules configured to be displayed on all pages to be added to the wrong container in new pages Fixed page quota restriction issue in the Ribbon Bar Removed restriction that would not allow users to use a dash in page names. Now users can create pages with names like "site-map" Fixed issue that was causing the wrong container to be loaded in modules wh...51Degrees.mobi - Mobile Device Detection and Redirection: 2.1.3.1: One Click Install from NuGet Changes to Version 2.1.3.11. [assembly: AllowPartiallyTrustedCallers] has been added back into the AssemblyInfo.cs file to prevent failures with other assemblies in Medium trust environments. 2. The Lite data embedded into the assembly has been updated to include devices from December 2011. The 42 new RingMark properties will return Unknown if RingMark data is not available. Changes to Version 2.1.2.11Code Changes 1. The project is now licenced under the Mozilla...MVC Controls Toolkit: Mvc Controls Toolkit 2.0.0: Added Support for Mvc4 beta and WebApi The SafeqQuery and HttpSafeQuery IQueryable implementations that works as wrappers aroung any IQueryable to protect it from unwished queries. "Client Side" pager specialized in paging javascript data coming either from a remote data source, or from local data. LinQ like fluent javascript api to build queries either against remote data sources, or against local javascript data, with exactly the same interface. There are 3 different query objects exp...nopCommerce. Open source shopping cart (ASP.NET MVC): nopcommerce 2.50: Highlight features & improvements: • Significant performance optimization. • Allow store owners to create several shipments per order. Added a new shipping status: “Partially shipped”. • Pre-order support added. Enables your customers to place a Pre-Order and pay for the item in advance. Displays “Pre-order” button instead of “Buy Now” on the appropriate pages. Makes it possible for customer to buy available goods and Pre-Order items during one session. It can be managed on a product variant ...WiX Toolset: WiX v3.6 RC0: WiX v3.6 RC0 (3.6.2803.0) provides support for VS11 and a more stable Burn engine. For more information see Rob's blog post about the release: http://robmensching.com/blog/posts/2012/4/3/WiX-v3.6-Release-Candidate-Zero-availableSageFrame: SageFrame 2.0: Sageframe is an open source ASP.NET web development framework developed using ASP.NET 3.5 with service pack 1 (sp1) technology. It is designed specifically to help developers build dynamic website by providing core functionality common to most web applications.iTuner - The iTunes Companion: iTuner 1.5.4475: Fix to parse empty playlists in iTunes LibraryDocument.Editor: 2012.2: Whats New for Document.Editor 2012.2: New Save Copy support New Page Setup support Minor Bug Fix's, improvements and speed upsNew ProjectsCameraSudokuSolver: Sudoku solver through camera for AndroidCardboardBox: This is a WPF based client application for the danbooru.donmai.us image board.Cloud in Net: Cloud in NetDataStoreCleaner: DataStoreCleaner clears "DataStore" folder which manages Windows Update History. It is useful for fixing WU error, or tune up Windows start-up. It's developed in C#.E-Ticaret - Sanal Magaza: Temel olarak gelismis e-ticaret sistemlerinin temel özelliklerini bulundurucak ve yönetecek bir sistem olacaktir. Sonrasinda ek gelistirmeler için özel çalismalar yapilacaktir.Finding all factors: this is a simple Winform application for finding all factors or divisors of a given number. i think is a simple example for learning how to work with essential backgroundWorker class .FlashGraphicBuilder: Simple graphic builder on AS3IpPbxImportRR: Command-line tool to import or export routing records to/from a SwyxWare VoIP PBX. This is a sample application showing how to use the SwyxWare Configuration API (CDS API). Use it at your own risk.KNX.net: KNX.net provides a KNX API for C#LevelDesigner: LevelDesignerN2F Yverdon Sanitizers: A system to help ease the pain of sanitizing data. The system comes with some basic sanitizers as well as the framework necessary to enable easy development of custom sanitizers.nAPI for Windows Phone: Windows Phone library for using Naver(R)'s open API service. (This project is 3rd party library project, NOT a NHN/Naver's official project) For more info about Naver Open API: http://dev.naver.com/openapi/NJena (Semantic Web Framework for .NET): A .NET source-level port of the Jena frameworkNWTCompiler: NWTCompiler is for those interested in creating their own compiled database of the New World Translation of the Holy Scriptures from the watchtower.org sources. Formats such as e-Sword are supported.Odin Game Engine: Odin is an attempt at mixing Windows Forms and XNA in the goal of making a game engine.qq: qqRanmal MVC Work: It is my Knowledge Exchange projectRichCode: RichCode is a UserControl that is easy to use, allows the custom syntax highlighting without much effortRUPSY Download manager: RUPSY Download managerSDCBCWEB: This is a web application for a class project. The goal is to create a content management system to be used for educational purposes by a nonprofit.Snake Game: Kursinis darbasSpec Pattern: Spec Pattern is a simple yet powerful implementation of specification pattern in C#. Relying in IQueryable it covers the three requirements this patterns aims to solve - Validation - Querying - BuildingSteel Brain: An open source project which aims to implement a neural net framework in unmanaged C++. The longer term describes why I chose C++ over the phenomenal C# which is creating a neural net that can harness the power of GPGPU's by using the OpenCL library. (I'm not a beleiver of projects that tries to provide solutions to developers who dont want to come out of the managed, cozy C# context) Sunday: Another Web Content Management System.TO7 License Plate Recognition: This project is part of a college assignment.ts: tsUnofficial RunUO: This project is a fork of the popular Ultima Online emulation software RunUO ( http://www.runuo.com ) The main difference between this repository and the official RunUO is that this project is fully set up and ready to launch in Visual Studio 2010, with full .NET 4.0 support!VibroStudio: Application for edit, view and process vibrosignalsWindows Phone AR.Drone controller: The Windows Phone AR.Drone controller is a controller library and client application for Windows Phone 7.1. It is written in C#.XamlImageConverter: A tool to convert Xaml to images. - It implements an MSBuild task that can be imported in any project to convert xaml to images in a project - It implements a HttpHandler that converts xaml to images on the fly. XEFFEX: XEFFEX is a play off the piano gadget. The shapes were manipulated and the sounds are set to different effects. The end goal was too have the pads play a sound and execute a program the user can pre-choose. The options menu allows quit access to your files. XiaMiRingtone: ?????windows phone??。 ???????,????????,???????????。

    Read the article

  • Issue 15: The Benefits of Oracle Exastack

    - by rituchhibber
         SOLUTIONS FOCUS The Benefits of Oracle Exastack Paul ThompsonDirector, Alliances and Solutions Partner ProgramsOracle EMEA Alliances & Channels RESOURCES -- Oracle PartnerNetwork (OPN) Oracle Exastack Program Oracle Exastack Ready Oracle Exastack Optimized Oracle Exastack Labs and Enablement Resources Oracle Exastack Labs Video Tour SUBSCRIBE FEEDBACK PREVIOUS ISSUES Exastack is a revolutionary programme supporting Oracle independent software vendor partners across the entire Oracle technology stack. Oracle's core strategy is to engineer software and hardware together, and our ISV strategy is the same. At Oracle we design engineered systems that are pre-integrated to reduce the cost and complexity of IT infrastructures while increasing productivity and performance. Oracle innovates and optimises performance at every layer of the stack to simplify business operations, drive down costs and accelerate business innovation. Our engineered systems are optimised to achieve enterprise performance levels that are unmatched in the industry. Faster time to production is achieved by implementing pre-engineered and pre-assembled hardware and software bundles. Our strategy of delivering a single-vendor stack simplifies and reduces costs associated with purchasing, deploying, and supporting IT environments for our customers and partners. In parallel to this core engineered systems strategy, the Oracle Exastack Program enables our Oracle ISV partners to leverage a scalable, integrated infrastructure that delivers their applications tuned, tested and optimised for high-performance. Specifically, the Oracle Exastack Program helps ISVs run their solutions on the Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, and Oracle SPARC SuperCluster T4-4 - integrated systems products in which the software and hardware are engineered to work together. These products provide OPN members with a lower cost and high performance infrastructure for database and application workloads across on-premise and cloud based environments. Ready and Optimized Oracle Partners can now leverage our new Oracle Exastack Program to become Oracle Exastack Ready and Oracle Exastack Optimized. Partners can achieve Oracle Exastack Ready status through their support for Oracle Solaris, Oracle Linux, Oracle VM, Oracle Database, Oracle WebLogic Server, Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, and Oracle SPARC SuperCluster T4-4. By doing this, partners can demonstrate to their customers that their applications are available on the latest major releases of these products. The Oracle Exastack Ready programme helps customers readily differentiate Oracle partners from lesser software developers, and identify applications that support Oracle engineered systems. Achieving Oracle Exastack Optimized status demonstrates that an OPN member has proven itself against goals for performance and scalability on Oracle integrated systems. This status enables end customers to readily identify Oracle partners that have tested and tuned their solutions for optimum performance on an Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, and Oracle SPARC SuperCluster T4-4. These ISVs can display the Oracle Exadata Optimized, Oracle Exalogic Optimized or Oracle SPARC SuperCluster Optimized logos on websites and on all their collateral to show that they have tested and tuned their application for optimum performance. Deliver higher value to customers Oracle's investment in engineered systems enables ISV partners to deliver higher value to customer business processes. New innovations are enabled through extreme performance unachievable through traditional best-of-breed multi-vendor server/software approaches. Core product requirements can be launched faster, enabling ISVs to focus research and development investment on core competencies in order to bring value to market as quickly as possible. Through Exastack, partners no longer have to worry about the underlying product stack, which allows greater focus on the development of intellectual property above the stack. Partners are not burdened by platform issues and can concentrate simply on furthering their applications. The advantage to end customers is that partners can focus all efforts on business functionality, rather than bullet-proofing underlying technologies, and so will inevitably deliver application updates faster. Exastack provides ISVs with a number of flexible deployment options, such as on-premise or Cloud, while maintaining one single code base for applications regardless of customer deployment preference. Customers buying their solutions from Exastack ISVs can therefore be confident in deploying on their own networks, on private clouds or into a public cloud. The underlying platform will support all conceivable deployments, enabling a focus on the ISV's application itself that wouldn't be possible with other vendor partners. It stands to reason that Exastack accelerates time to value as well as lowering implementation costs all round. There is a big competitive advantage in partners being able to offer customers an optimised, pre-configured solution rather than an assortment of components and a suggested fit. Once a customer has decided to buy an Oracle Exastack Ready or Optimized partner solution, it will be up and running without any need for the customer to conduct testing of its own. Operational costs and complexity are also reduced, thanks to streamlined customer support through standardised configurations and pro-active monitoring. 'Engineered to Work Together' is a significant statement of Oracle strategy. It guarantees smoother deployment of a single vendor solution, clear ownership with no finger-pointing and the peace of mind of the Oracle Support Centre underpinning the entire product stack. Next steps Every OPN member with packaged applications must seriously consider taking steps to become Exastack Ready, or Exastack Optimized at the first opportunity. That first step down the track is to talk to an expert on the OPN Portal, at the Oracle Partner Business Center or to discuss the next steps with the closest Oracle account manager. Oracle Exastack lab environments and other technical enablement resources are available for OPN members wishing to further their knowledge of Oracle Exastack and qualify their applications for Oracle Exastack Optimized. New Boot Camps and Guided Learning Paths (GLPs), tailored specifically for ISVs, are available for Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, Oracle Linux, Oracle Solaris, Oracle Database, and Oracle WebLogic Server. More information about these GLPs and Boot Camps (including delivery dates and locations) are posted on the OPN Competency Center and corresponding OPN Knowledge Zones. Learn more about Oracle Exastack labs and ISV specific enablement resources. "Oracle Specialized partners are of course front-and-centre, with potential customers clearly directed to those partners and to Exadata Ready partners as a matter of priority." --More OpenWorld 2011 highlights for Oracle partners and customers Oracle Application Testing Suite 9.3 application testing solution for Web, SOA and Oracle Applications Oracle Application Express Release 4.1 improving the development of database-centric Web 2.0 applications and reports Oracle Unified Directory 11g helping customers manage the critical identity information that drives their business applications Oracle SOA Suite for healthcare integration Oracle Enterprise Pack for Eclipse 11g demonstrating continued commitment to the developer and open source communities Oracle Coherence 3.7.1, the latest release of the industry's leading distributed in-memory data grid Oracle Process Accelerators helping to simplify and accelerate time-to-value for customers' business process management initiatives Oracle's JD Edwards EnterpriseOne on the iPad meeting the increasingly mobile demands of today's workforces Oracle CRM On Demand Release 19 Innovation Pack introducing industry-leading hosted call centre and enterprise-marketing capabilities designed to drive further revenue and productivity while reducing costs and improving the customer experience Oracle's Primavera Portfolio Management 9 for businesses delivering on project portfolio goals with increased versatility, transparency and accuracy Oracle's PeopleSoft Human Capital Management (HCM) 9.1 On Demand Standard Edition helping customers manage their long-term investment in enterprise-wide business applications New versions of Oracle FLEXCUBE Universal Banking and Oracle FLEXCUBE Investor Servicing for Financial Institutions, as well as Oracle Financial Services Enterprise Case Management, Oracle Financial Services Pricing Management, Oracle Financial Management Analytics and Oracle Tax Analytics Oracle Utilities Network Management System 1.11 offering new modelling and analysis features to improve distribution-grid management for electric utilities Oracle Communications Network Charging and Control 4.4 helping communications service providers (CSPs) offer their customers more flexible charging options Plus many, many more technology announcements, enhancements, momentum news and community updates -- Oracle OpenWorld 2012 A date has already been set for Oracle OpenWorld 2012. Held once again in San Francisco, exhibitors, partners, customers and Oracle people will gather from 30 September until 4 November to meet, network and learn together with the rest of the global Oracle community. Register now for Oracle OpenWorld 2012 and save $$$! We'll reward your early planning for Oracle OpenWorld 2012 with reduced rates. Super Saver deals are now available! -- Back to the welcome page

    Read the article

  • T4 Template error - Assembly Directive cannot locate referenced assembly in Visual Studio 2010 proje

    - by CodeSniper
    I ran into the following error recently in Visual Studio 2010 while trying to port Phil Haack’s excellent T4CSS template which was originally built for Visual Studio 2008.   The Problem Error Compiling transformation: Metadata file 'dotless.Core' could not be found In “T4 speak”, this simply means that you have an Assembly directive in your T4 template but the T4 engine was not able to locate or load the referenced assembly. In the case of the T4CSS Template, this was a showstopper for making it work in Visual Studio 2010. On a side note: The T4CSS template is a sweet little wrapper to allow you to use DotLessCss to generate static .css files from .less files rather than using their default HttpHandler or command-line tool.    If you haven't tried DotLessCSS yet, go check it out now!  In short, it is a tool that allows you to templatize and program your CSS files so that you can use variables, expressions, and mixins within your CSS which enables rapid changes and a lot of developer-flexibility as you evolve your CSS and UI. Back to our regularly scheduled program… Anyhow, this post isn't about DotLessCss, its about the T4 Templates and the errors I ran into when converting them from Visual Studio 2008 to Visual Studio 2010. In VS2010, there were quite a few changes to the T4 Template Engine; most were excellent changes, but this one bit me with T4CSS: “Project assemblies are no longer used to resolve template assembly directives.” In VS2008, if you wanted to reference a custom assembly in your T4 Template (.tt file) you would simply right click on your project, choose Add Reference and select that assembly.  Afterwards you were allowed to use the following syntax in your T4 template to tell it to look at the local references: <#@ assembly name="dotless.Core.dll" #> This told the engine to look in the “usual place” for the assembly, which is your project references. However, this is exactly what they changed in VS2010.  They now basically sandbox the T4 Engine to keep your T4 assemblies separate from your project assemblies.  This can come in handy if you want to support different versions of an assembly referenced both by your T4 templates and your project. Who broke the build?  Oh, Microsoft Did! In our case, this change causes a problem since the templates are no longer compatible when upgrading to VS 2010 – thus its a breaking change.  So, how do we make this work in VS 2010? Luckily, Microsoft now offers several options for referencing assemblies from T4 Templates: GAC your assemblies and use Namespace Reference or Fully Qualified Type Name Use a hard-coded Fully Qualified UNC path Copy assembly to Visual Studio "Public Assemblies Folder" and use Namespace Reference or Fully Qualified Type Name.  Use or Define a Windows Environment Variable to build a Fully Qualified UNC path. Use a Visual Studio Macro to build a Fully Qualified UNC path. Option #1 & 2 were already supported in Visual Studio 2008, so if you want to keep your templates compatible with both Visual Studio versions, then you would have to adopt one of these approaches. Yakkety Yak, use the GAC! Option #1 requires an additional pre-build step to GAC the referenced assembly, which could be a pain.  But, if you go that route, then after you GAC, all you need is a simple type name or namespace reference such as: <#@ assembly name="dotless.Core" #> Hard Coding aint that hard! The other option of using hard-coded paths in Option #2 is pretty impractical in most situations since each developer would have to use the same local project folder paths, or modify this setting each time for their local machines as well as for production deployment.  However, if you want to go that route, simply use the following assembly directive style: <#@ assembly name="C:\Code\Lib\dotless.Core.dll" #> Lets go Public! Option #3, the Visual Studio Public Assemblies Folder, is the recommended place to put commonly used tools and libraries that are only needed for Visual Studio.  Think of it like a VS-only GAC.  This is likely the best place for something like dotLessCSS and is my preferred solution.  However, you will need to either use an installer or a pre-build action to copy the assembly to the right folder location.   Normally this is located at:  C:\Program Files (x86)\Microsoft Visual Studio 10.0\Common7\IDE\PublicAssemblies Once you have copied your assembly there, you use the type name or namespace syntax again: <#@ assembly name="dotless.Core" #> Save the Environment! Option #4, using a Windows Environment Variable, is interesting for enterprise use where you may have standard locations for files, but less useful for demo-code, frameworks, and products where you don't have control over the local system.  The syntax for including a environment variable in your assembly directive looks like the following, just as you would expect: <#@ assembly name="%mypath%\dotless.Core.dll" #> “mypath” is a Windows environment variable you setup that points to some fully qualified UNC path on your system.  In the right situation this can be a great solution such as one where you use a msi installer for deployment, or where you have a pre-existing environment variable you can re-use. OMG Macros! Finally, Option #5 is a very nice option if you want to keep your T4 template’s assembly reference local and relative to the project or solution without muddying-up your dev environment or GAC with extra deployments.  An example looks like this: <#@ assembly name="$(SolutionDir)lib\dotless.Core.dll" #> In this example, I’m using the “SolutionDir” VS macro so I can reference an assembly in a “/lib” folder at the root of the solution.   This is just one of the many macros you can use.  If you are familiar with creating Pre/Post-build Event scripts, you can use its dialog to look at all of the different VS macros available. This option gives the best solution for local assemblies without the hassle of extra installers or other setup before the build.   However, its still not compatible with Visual Studio 2008, so if you have a T4 Template you want to use with both, then you may have to create multiple .tt files, one for each IDE version, or require the developer to set a value in the .tt file manually.   I’m not sure if T4 Templates support any form of compiler switches like “#if (VS2010)”  statements, but it would definitely be nice in this case to switch between this option and one of the ones more compatible with VS 2008. Conclusion As you can see, we went from 3 options with Visual Studio 2008, to 5 options (plus one problem) with Visual Studio 2010.  As a whole, I think the changes are great, but the short-term growing pains during the migration may be annoying until we get used to our new found power. Hopefully this all made sense and was helpful to you.  If nothing else, I’ll just use it as a reference the next time I need to port a T4 template to Visual Studio 2010.  Happy T4 templating, and “May the fourth be with you!”

    Read the article

  • WebSocket and Java EE 7 - Getting Ready for JSR 356 (TOTD #181)

    - by arungupta
    WebSocket is developed as part of HTML 5 specification and provides a bi-directional, full-duplex communication channel over a single TCP socket. It provides dramatic improvement over the traditional approaches of Polling, Long-Polling, and Streaming for two-way communication. There is no latency from establishing new TCP connections for each HTTP message. There is a WebSocket API and the WebSocket Protocol. The Protocol defines "handshake" and "framing". The handshake defines how a normal HTTP connection can be upgraded to a WebSocket connection. The framing defines wire format of the message. The design philosophy is to keep the framing minimum to avoid the overhead. Both text and binary data can be sent using the API. WebSocket may look like a competing technology to Server-Sent Events (SSE), but they are not. Here are the key differences: WebSocket can send and receive data from a client. A typical example of WebSocket is a two-player game or a chat application. Server-Sent Events can only push data data to the client. A typical example of SSE is stock ticker or news feed. With SSE, XMLHttpRequest can be used to send data to the server. For server-only updates, WebSockets has an extra overhead and programming can be unecessarily complex. SSE provides a simple and easy-to-use model that is much better suited. SSEs are sent over traditional HTTP and so no modification is required on the server-side. WebSocket require servers that understand the protocol. SSE have several features that are missing from WebSocket such as automatic reconnection, event IDs, and the ability to send arbitrary events. The client automatically tries to reconnect if the connection is closed. The default wait before trying to reconnect is 3 seconds and can be configured by including "retry: XXXX\n" header where XXXX is the milliseconds to wait before trying to reconnect. Event stream can include a unique event identifier. This allows the server to determine which events need to be fired to each client in case the connection is dropped in between. The data can span multiple lines and can be of any text format as long as EventSource message handler can process it. WebSockets provide true real-time updates, SSE can be configured to provide close to real-time by setting appropriate timeouts. OK, so all excited about WebSocket ? Want to convert your POJOs into WebSockets endpoint ? websocket-sdk and GlassFish 4.0 is here to help! The complete source code shown in this project can be downloaded here. On the server-side, the WebSocket SDK converts a POJO into a WebSocket endpoint using simple annotations. Here is how a WebSocket endpoint will look like: @WebSocket(path="/echo")public class EchoBean { @WebSocketMessage public String echo(String message) { return message + " (from your server)"; }} In this code "@WebSocket" is a class-level annotation that declares a POJO to accept WebSocket messages. The path at which the messages are accepted is specified in this annotation. "@WebSocketMessage" indicates the Java method that is invoked when the endpoint receives a message. This method implementation echoes the received message concatenated with an additional string. The client-side HTML page looks like <div style="text-align: center;"> <form action=""> <input onclick="send_echo()" value="Press me" type="button"> <input id="textID" name="message" value="Hello WebSocket!" type="text"><br> </form></div><div id="output"></div> WebSocket allows a full-duplex communication. So the client, a browser in this case, can send a message to a server, a WebSocket endpoint in this case. And the server can send a message to the client at the same time. This is unlike HTTP which follows a "request" followed by a "response". In this code, the "send_echo" method in the JavaScript is invoked on the button click. There is also a <div> placeholder to display the response from the WebSocket endpoint. The JavaScript looks like: <script language="javascript" type="text/javascript"> var wsUri = "ws://localhost:8080/websockets/echo"; var websocket = new WebSocket(wsUri); websocket.onopen = function(evt) { onOpen(evt) }; websocket.onmessage = function(evt) { onMessage(evt) }; websocket.onerror = function(evt) { onError(evt) }; function init() { output = document.getElementById("output"); } function send_echo() { websocket.send(textID.value); writeToScreen("SENT: " + textID.value); } function onOpen(evt) { writeToScreen("CONNECTED"); } function onMessage(evt) { writeToScreen("RECEIVED: " + evt.data); } function onError(evt) { writeToScreen('<span style="color: red;">ERROR:</span> ' + evt.data); } function writeToScreen(message) { var pre = document.createElement("p"); pre.style.wordWrap = "break-word"; pre.innerHTML = message; output.appendChild(pre); } window.addEventListener("load", init, false);</script> In this code The URI to connect to on the server side is of the format ws://<HOST>:<PORT>/websockets/<PATH> "ws" is a new URI scheme introduced by the WebSocket protocol. <PATH> is the path on the endpoint where the WebSocket messages are accepted. In our case, it is ws://localhost:8080/websockets/echo WEBSOCKET_SDK-1 will ensure that context root is included in the URI as well. WebSocket is created as a global object so that the connection is created only once. This object establishes a connection with the given host, port and the path at which the endpoint is listening. The WebSocket API defines several callbacks that can be registered on specific events. The "onopen", "onmessage", and "onerror" callbacks are registered in this case. The callbacks print a message on the browser indicating which one is called and additionally also prints the data sent/received. On the button click, the WebSocket object is used to transmit text data to the endpoint. Binary data can be sent as one blob or using buffering. The HTTP request headers sent for the WebSocket call are: GET ws://localhost:8080/websockets/echo HTTP/1.1Origin: http://localhost:8080Connection: UpgradeSec-WebSocket-Extensions: x-webkit-deflate-frameHost: localhost:8080Sec-WebSocket-Key: mDbnYkAUi0b5Rnal9/cMvQ==Upgrade: websocketSec-WebSocket-Version: 13 And the response headers received are Connection:UpgradeSec-WebSocket-Accept:q4nmgFl/lEtU2ocyKZ64dtQvx10=Upgrade:websocket(Challenge Response):00:00:00:00:00:00:00:00:00:00:00:00:00:00:00:00 The headers are shown in Chrome as shown below: The complete source code shown in this project can be downloaded here. The builds from websocket-sdk are integrated in GlassFish 4.0 builds. Would you like to live on the bleeding edge ? Then follow the instructions below to check out the workspace and install the latest SDK: Check out the source code svn checkout https://svn.java.net/svn/websocket-sdk~source-code-repository Build and install the trunk in your local repository as: mvn install Copy "./bundles/websocket-osgi/target/websocket-osgi-0.3-SNAPSHOT.jar" to "glassfish3/glassfish/modules/websocket-osgi.jar" in your GlassFish 4 latest promoted build. Notice, you need to overwrite the JAR file. Anybody interested in building a cool application using WebSocket and get it running on GlassFish ? :-) This work will also feed into JSR 356 - Java API for WebSocket. On a lighter side, there seems to be less agreement on the name. Here are some of the options that are prevalent: WebSocket (W3C API, the URL is www.w3.org/TR/websockets though) Web Socket (HTML5 Demos - html5demos.com/web-socket) Websocket (Jenkins Plugin - wiki.jenkins-ci.org/display/JENKINS/Websocket%2BPlugin) WebSockets (Used by Mozilla - developer.mozilla.org/en/WebSockets, but use WebSocket as well) Web sockets (HTML5 Working Group - www.whatwg.org/specs/web-apps/current-work/multipage/network.html) Web Sockets (Chrome Blog - blog.chromium.org/2009/12/web-sockets-now-available-in-google.html) I prefer "WebSocket" as that seems to be most common usage and used by the W3C API as well. What do you use ?

    Read the article

  • The SPARC SuperCluster

    - by Karoly Vegh
    Oracle has been providing a lead in the Engineered Systems business for quite a while now, in accordance with the motto "Hardware and Software Engineered to Work Together." Indeed it is hard to find a better definition of these systems.  Allow me to summarize the idea. It is:  Build a compute platform optimized to run your technologies Develop application aware, intelligently caching storage components Take an impressively fast network technology interconnecting it with the compute nodes Tune the application to scale with the nodes to yet unseen performance Reduce the amount of data moving via compression Provide this all in a pre-integrated single product with a single-pane management interface All these ideas have been around in IT for quite some time now. The real Oracle advantage is adding the last one to put these all together. Oracle has built quite a portfolio of Engineered Systems, to run its technologies - and run those like they never ran before. In this post I'll focus on one of them that serves as a consolidation demigod, a multi-purpose engineered system.  As you probably have guessed, I am talking about the SPARC SuperCluster. It has many great features inherited from its predecessors, and it adds several new ones. Allow me to pick out and elaborate about some of the most interesting ones from a technological point of view.  I. It is the SPARC SuperCluster T4-4. That is, as compute nodes, it includes SPARC T4-4 servers that we learned to appreciate and respect for their features: The SPARC T4 CPUs: Each CPU has 8 cores, each core runs 8 threads. The SPARC T4-4 servers have 4 sockets. That is, a single compute node can in parallel, simultaneously  execute 256 threads. Now, a full-rack SPARC SuperCluster has 4 of these servers on board. Remember the keyword demigod.  While retaining the forerunner SPARC T3's exceptional throughput, the SPARC T4 CPUs raise the bar with single performance too - a humble 5x better one than their ancestors.  actually, the SPARC T4 CPU cores run in both single-threaded and multi-threaded mode, and switch between these two on-the-fly, fulfilling not only single-threaded OR multi-threaded applications' needs, but even mixed requirements (like in database workloads!). Data security, anyone? Every SPARC T4 CPU core has a built-in encryption engine, that is, encryption algorithms cast into silicon.  A PCI controller right on the chip for customers who need I/O performance.  Built-in, no-cost Virtualization:  Oracle VM for SPARC (the former LDoms or Logical Domains) is not a server-emulation virtualization technology but rather a serverpartitioning one, the hypervisor runs in the server firmware, and all the VMs' HW resources (I/O, CPU, memory) are accessed natively, without performance overhead.  This enables customers to run a number of Solaris 10 and Solaris 11 VMs separated, independent of each other within a physical server II. For Database performance, it includes Exadata Storage Cells - one of the main reasons why the Exadata Database Machine performs at diabolic speed. What makes them important? They provide DB backend storage for your Oracle Databases to run on the SPARC SuperCluster, that is what they are built and tuned for DB performance.  These storage cells are SQL-aware.  That is, if a SPARC T4 database compute node executes a query, it doesn't simply request tons of raw datablocks from the storage, filters the received data, and throws away most of it where the statement doesn't apply, but provides the SQL query to the storage node too. The storage cell software speaks SQL, that is, it is able to prefilter and through that transfer only the relevant data. With this, the traffic between database nodes and storage cells is reduced immensely. Less I/O is a good thing - as they say, all the CPUs of the world do one thing just as fast as any other - and that is waiting for I/O.  They don't only pre-filter, but also provide data preprocessing features - e.g. if a DB-node requests an aggregate of data, they can calculate it, and handover only the results, not the whole set. Again, less data to transfer.  They support the magical HCC, (Hybrid Columnar Compression). That is, data can be stored in a precompressed form on the storage. Less data to transfer.  Of course one can't simply rely on disks for performance, there is Flash Storage included there for caching.  III. The low latency, high-speed backbone network: InfiniBand, that interconnects all the members with: Real High Speed: 40 Gbit/s. Full Duplex, of course. Oh, and a really low latency.  RDMA. Remote Direct Memory Access. This technology allows the DB nodes to do exactly that. Remotely, directly placing SQL commands into the Memory of the storage cells. Dodging all the network-stack bottlenecks, avoiding overhead, placing requests directly into the process queue.  You can also run IP over InfiniBand if you please - that's the way the compute nodes can communicate with each other.  IV. Including a general-purpose storage too: the ZFSSA, which is a unified storage, providing NAS and SAN access too, with the following features:  NFS over RDMA over InfiniBand. Nothing is faster network-filesystem-wise.  All the ZFS features onboard, hybrid storage pools, compression, deduplication, snapshot, replication, NFS and CIFS shares Storageheads in a HA-Cluster configuration providing availability of the data  DTrace Live Analytics in a web-based Administration UI Being a general purpose application data storage for your non-database applications running on the SPARC SuperCluster over whichever protocol they prefer, easily replicating, snapshotting, cloning data for them.  There's a lot of great technology included in Oracle's SPARC SuperCluster, we have talked its interior through. As for external scalability: you can start with a half- of full- rack SPARC SuperCluster, and scale out to several racks - that is, stacking not separate full-rack SPARC SuperClusters, but extending always one large instance of the size of several full-racks. Yes, over InfiniBand network. Add racks as you grow.  What technologies shall run on it? SPARC SuperCluster is a general purpose scaleout consolidation/cloud environment. You can run Oracle Databases with RAC scaling, or Oracle Weblogic (end enjoy the SPARC T4's advantages to run Java). Remember, Oracle technologies have been integrated with the Oracle Engineered Systems - this is the Oracle on Oracle advantage. But you can run other software environments such as SAP if you please too. Run any application that runs on Oracle Solaris 10 or Solaris 11. Separate them in Virtual Machines, or even Oracle Solaris Zones, monitor and manage those from a central UI. Here the key takeaways once again: The SPARC SuperCluster: Is a pre-integrated Engineered System Contains SPARC T4-4 servers with built-in virtualization, cryptography, dynamic threading Contains the Exadata storage cells that intelligently offload the burden of the DB-nodes  Contains a highly available ZFS Storage Appliance, that provides SAN/NAS storage in a unified way Combines all these elements over a high-speed, low-latency backbone network implemented with InfiniBand Can grow from a single half-rack to several full-rack size Supports the consolidation of hundreds of applications To summarize: All these technologies are great by themselves, but the real value is like in every other Oracle Engineered System: Integration. All these technologies are tuned to perform together. Together they are way more than the sum of all - and a careful and actually very time consuming integration process is necessary to orchestrate all these for performance. The SPARC SuperCluster's goal is to enable infrastructure operations and offer a pre-integrated solution that can be architected and delivered in hours instead of months of evaluations and tests. The tedious and most importantly time and resource consuming part of the work - testing and evaluating - has been done.  Now go, provide services.   -- charlie  

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >