Search Results

Search found 34280 results on 1372 pages for 'image search'.

Page 272/1372 | < Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >

  • Setting UIImage dimensions on UITableViewCell image

    - by bbrown
    I've got a standard UITableViewCell where I'm using the text and image properties to display a favicon.ico and a label. For the most part, this works really well since UIImage supports the ICO format. However, some sites (like Amazon.com say) have favicon.icos that make use of the ICO format's ability to store multiple sizes in the same file. Amazon stores four different sizes, all the way up to 48x48. This results in most images being 16x16 except for a few that come in at 32x32 or 48x48 and make everything look terrible. I have searched here, the official forum, the documentation, and elsewhere without success. I have tried everything that I could think of to constrain the image size. The only thing that worked was an undocumented method, which I'm not about to use. This is my first app and my first experience with Cocoa (came from C#). In case I wasn't clear in what I'm looking for, ideally the advice would center around setting the dimensions of the UIImage so that the 48x48 version would scale down to 16x16 or a method to tell UIImage to use the 16x16 version present in the ICO file. I don't necessarily need code: just a suggestion of an approach would do me fine. Does anyone have any suggestions? (I asked in the official forum as well because I've sunk more than a day into this already. If a solution is posted there, I'll put it here as well.)

    Read the article

  • Change virtual QEMU image location

    - by dallasclark
    I've got an existing QEMU Virtual Server running on Fedora 11. Having troubles trying to find out how to change the location of where the Virtual Images are stored. Can anybody provide any help please? Thanks in advance! I'm also new to Linux Server Administration - n00b in other words - so this might seem lazy but I need to know commands or where to look

    Read the article

  • CSS background image being downloaded more than once

    - by Nick Clarke
    I noticed in my current project that Firefox (3.5.4) downloads the background image (set in CSS) for my divs more than once. I've checked with both firebug and wireshark and it really does appear that it does not wait for the first request to finish and then simply use the cached version. Wireshark also confirms that Chrome and IE8 do as expected and only request the image once. Any ideas what might be causing this? Here is a small test: Sample Page or <html> <head> <style> #one { height: 300px; width:100%; background: #FFF url('random.jpg'); } #two { height: 300px; width:100%; background: #FFF url('random.jpg'); } #three { height: 300px; width:100%; background: #FFF url('random.jpg'); } </style> </head> <body> <div id="one"></div> <div id="two"></div> <div id="three"></div> </body> EDIT I opened up a bug request as I could not find one already on bugzilla, but it turns out to be an old bug with 3.5. https://bugzilla.mozilla.org/show_bug.cgi?id=497665

    Read the article

  • newbie: how to upload images from a form with PHP and mySQL

    - by paracaudex
    I'm creating a web app (locally, so security doesn't matter) in PHP where the user uploads a set of information and a small .jpeg, which is then inserted into a mySQL table. I can do this no problem with all the text data, but I'm not sure how to cause the image to upload alongside it. I assume I will have to use the blob data type and input type="file", but I fooled around with that a little bit and the solution doesn't seem to be an intuitive extension of how input type="text" works. Do I need to do a lot more PHP scripting to get this to work? Is it possible to upload an image with a form, or is there a necessary intermediate step?

    Read the article

  • browser blocking image download when nginx was placed infront of apache to serve static content

    - by railscoder
    I was tying to place nginx infront of apache to server static content. This set up was performing better than just having apache. but suddenly some change caused images getting blocked for like 2-3sec before actually downloading with apache+nginx setup. It doesnt happen with apache only set up? Any idea why it is happening with nginx? this was happening even i removed all external js from the page

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Hosting solution for images for website written in PHP

    - by tomaszs
    I've written a website in PHP and it will have ability for users to upload images. My website will have more than 100.000 users. Aprox. 1k users will upload image about 50 KB. And every image will be displayed on this website 5k times so it's transfer of: 1k x 50 KB x 5k = 250 GB per month. So my question is: Do you know any good solution (hosting or CDN network or else) that: will be payed for transfer not space used and no entrance fee will have API to upload images easily with PHP is extremely easy to use will be good for low budget will not require any special, complicated registration and formal things will allow commercial use will allow using this images in website layout ?

    Read the article

  • jquery image hover popup cant detect browser edge and change its direction

    - by Salman
    hi guys i am trying to implement jquery image hover popup but facing a problem when the popup is closer to browser edge it goes beyond its edge i want it to change its direction when it finds that space is not enough to show that popup, i have see this effect in many plugins where popups, tooltips and drop down menus change their direction if they are close to browser window edge can any one guide me in right direction here is the screen shot for reference http://img512.imageshack.us/img512/4990/browseredge.png here is the jquery hover code function imagePreview(){ /* CONFIG */ xOffset = 10; yOffset = 30; // these 2 variable determine popup's distance from the cursor // you might want to adjust to get the right result /* END CONFIG */ $("a.preview").hover(function(e){ this.t = this.title; this.title = ""; var c = (this.t != "") ? "<br>" + this.t : ""; var newName = this.name; //console.log(this.name); newName=newName.replace("/l/","/o/"); //console.log(newName); $("body").append("<p id='preview'><img src='"+ this.name +"' alt='Image preview' style='margin-bottom:5px;'>"+ c +"</p>"); $("#preview img").error(function () { $("#preview img").attr("src" ,newName).css({'width': '400px', 'height': 'auto'}); }); $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px") .fadeIn("fast"); }, function(){ this.title = this.t; $("#preview").remove(); }); $("a.preview").mousemove(function(e){ $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px"); }); }; any help will be appriciated Thanks Salman

    Read the article

  • Printing images in Flex

    - by TERACytE
    In s Flex 3 app, I have canvas with a PNG image for a background. The image is the same width & height as the canvas. I also have some other controls in the canvas: <mx:Canvas id="form" backgroundImage="@Embed(source='images/formBkg.png')" width="640" height="480" > <mx:label .../> <mx:label .../> I print the canvas using the following code: var printJob:FlexPrintJob = new FlexPrintJob(); if (printJob.start()) { printJob.addObject(form, FlexPrintJobScaleType.SHOW_ALL); printJob.send(); } On screen it looks great, but when I print it the quality of the png degrades. It is not terrible, but not as sharp as what is shown on screen. Is there anything I can do to improve the quality of the printed png?

    Read the article

  • How to refresh jasper image without flickering?

    - by Aru
    Hi, I am using jasper reports to generate graph. I am refresheing the graph. But the problem is while refreshing the graph it is flickering. Code is- PrintWriter out = response.getWriter(); response.setContentType("text/html"); JRDataSource dataSource = createReportDataSource(perfArrayListSample.toArray()); ServletContext context = this.getServletConfig().getServletContext(); File reportFile = new File(context.getRealPath("/cpuUsageGraph.jasper")); if (!reportFile.exists()) throw new JRRuntimeException("File cpuUsageGraph.jasper not found. The report design must be compiled first."); JasperReport jasperReport = (JasperReport)JRLoader.loadObject(reportFile.getPath()); JasperPrint print = JasperFillManager.fillReport(jasperReport, new HashMap(), dataSource); JRHtmlExporter exporter = new JRHtmlExporter(); request.getSession().setAttribute(ImageServlet.DEFAULT_JASPER_PRINT_SESSION_ATTRIBUTE, print); exporter.setParameter(JRExporterParameter.JASPER_PRINT, print); exporter.setParameter(JRExporterParameter.OUTPUT_WRITER, out); exporter.setParameter(JRHtmlExporterParameter.IMAGES_URI, "image?ver="+new Date().getTime() +"&image="); exporter.exportReport(); perfArrayListSample.clear(); So how to refresh the graph wihout flickering?

    Read the article

  • Explaining verity index and document search limits

    - by Ahmad
    As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

    Read the article

  • Attachment_fu error

    - by cswebgrl
    Hello, I am getting an error while trying to upload images on an Ubuntu machine that's running Rails 2.3.4, Ruby 1.8.6 using attachment_fu with image science. FreeImage exception for type ???: IPTC: Invalid key 'Tag 0x025C' The error seems to point to this line in the image_science_processor in the attachment_fu plugin: def with_image(file, &block) ::ImageScience.with_image file, &block end My initial thoughts are that it has something to do with meta tags and the images and maybe free image. I don't actually see this error on my dev machine - Mac Snow Leopard, Rails 2.3.5, Ruby 1.8.7. Before I start messing versions on the production boxes, has anyone else encountered this issue and have an idea to fix it? THANKS!!!!

    Read the article

  • Creating stored procedure having different WHERE clause on different search criteria without putting

    - by Muhammad Kashif Nadeem
    Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

    Read the article

  • Virtual machine image compatibility between VMware Server and VMware Player

    - by alexandrul
    I'm trying to minimize the number of different product versions used on my PC's both at work and at home. So far I have a mixture of: VMware Server 1.0.7 VMware Server 2.0.2 VMware Player 2.5.3 VMware Player 3.0.0 and I would love to upgrade each product family to the latest version. Since Virtual Machine Mobility Guide is marked as deprecated, can anyone point me to some fresh information about virtual machine compatibility between VMware Player and VMware Server, in order to still be able to move virtual machines back and forth between the mentioned products? Update What I'm looking for is an updated document with virtual machines hardware versions, and the VMware products that are able to use that specific hardware version, so I can know - given the products that are using a specific virtual machine - what is the maximum hardware version that I can update the virtual machine to.

    Read the article

  • Excel - Filling images using a reference image

    - by tjans
    I have a spreadsheet that I use to create baseball cards for a tabletop baseball game. There are about 20 cards on my sheet, and I'd like to add a spot where I can set the logo and have it reflect that logo in each card without having to update 20 different images each time I create cards for a new team (and thus, a new logo). Is there a way to automate this process similar to setting one cell equal to the value of another (=A4, for instance)? I think the images aren't part of a cell and they float on top of the sheet, but I had hoped there was a way either with a macro or other VBA function (or maybe something built-in) that would accomplish this.

    Read the article

  • What to do when GMap Satellite imagery is unavailable

    - by robstenson
    Hello-- is it possible to programmatically detect with the google maps api (javascript, v2) when satellite imagery is unavailable at a certain zoom level? I am creating some maps automatically and setting them to a certain zoom level, but in a few cases there is no satellite imagery available at that level, in which case I'd like to automatically back up a zoom level. Does the api expose some way of determining this lack of imagery? So far the only thing I can think of is trying to find out, with javascript, whether or not the image requests that the api makes are failing, and then reacting based on those failed image requests, but I can't really get it to work... and it seems a little inelegant. Thanks for your help!

    Read the article

  • Allow image upload - most efficient way?

    - by K-P
    Hey everyone, In my site, I currently only allow users to import images from other sites rather than uploading it themselves. The main reason for this is because I don't have much storage space on my host (relatively speaking). The host charges quite a bit for additional space. What are the alternatives to hosting images users upload (max 1mb size). Would it be a good idea to purchase separate cheap hosting with "unlimited space" (I know that's not true, but I'm guessing it's more than 1gb)? Or are there some caveats with this approach (e.g. security since the site should not be browsable, but accessed via another server)? Are there alternative ideas that I could employ? Thanks for any suggestions

    Read the article

  • Scribe-LinkedIn Search API

    - by Rupeshit
    Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

    Read the article

  • Search for index.php and index.html and replace string

    - by Jonas
    Hello. I recently had some sort of Malware on my computer that added to all index.php and index.html ON THE WEBSERVER! the following string(s): echo "<iframe src=\"http://fabujob.com/?click=AD4A4\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; echo "<iframe src=\"http://fabujob.com/?click=AC785\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; So the parameter after "click=" always changes. These two were only examples. Is there a way to do that quick and fast? . . EDIT: It is on my webserver, so no use of find...

    Read the article

  • CSS Drop-Shadows Without Images

    - by Spencer B.
    I'm trying to use Nicolas Gallagher's brilliant CSS work on applying CSS drop-shadows to elements without images and without extra markup using the :before and :after pseudo-elements. His code is provided below... .drop-shadow { position:relative; width:90%; } .drop-shadow:before, .drop-shadow:after { content:""; position:absolute; z-index:-1; bottom:15px; left:10px; width:50%; height:20%; max-width:300px; -webkit-box-shadow:0 15px 10px rgba(0, 0, 0, 0.7); -moz-box-shadow:0 15px 10px rgba(0, 0, 0, 0.7); box-shadow:0 15px 10px rgba(0, 0, 0, 0.7); -webkit-transform:rotate(-3deg); -moz-transform:rotate(-3deg); -o-transform:rotate(-3deg); transform:rotate(-3deg); } .drop-shadow:after{ right:10px; left:auto; -webkit-transform:rotate(3deg); -moz-transform:rotate(3deg); -o-transform:rotate(3deg); transform:rotate(3deg); } I'm trying to target all images wrapped with an a tag, which in Wordpress are really full-size images that have been resized to a medium height and width in the backend. When the user clicks on the smaller image in the post, it opens up a new tab with the fullsize view of the image (I'm sure you're already familiar with this if you use Wordpress). For some reason, I can't get his code to work, and I'm wondering if I'm targeting this wrong within my CSS. Can you help? In place of the .drop-shadow class that he uses, I'm target all images wrapped with an a tag within the #main-i div. So, like this... #main-i a img Does anyone know how to target it better than I have so that I can get the drop shadows to be applied for all images within the specified div? Thanks for your help! P.S. An example of the image I am wanting to target with this CSS is the picture of the Haitian boy here: http://lifebridgecypress.org/our-heart/seventy-two/help-haiti

    Read the article

  • php scandir --> search for files/directories

    - by Peter
    Hi! I searched before I ask, without lucky.. I looking for a simple script for myself, which I can search for files/folders. Found this code snippet in the php manual (I think I need this), but it is not work for me. "Was looking for a simple way to search for a file/directory using a mask. Here is such a function. By default, this function will keep in memory the scandir() result, to avoid scaning multiple time for the same directory." <?php function sdir( $path='.', $mask='*', $nocache=0 ){ static $dir = array(); // cache result in memory if ( !isset($dir[$path]) || $nocache) { $dir[$path] = scandir($path); } foreach ($dir[$path] as $i=>$entry) { if ($entry!='.' && $entry!='..' && fnmatch($mask, $entry) ) { $sdir[] = $entry; } } return ($sdir); } ?> Thank you for any help, Peter

    Read the article

  • Content search through source code in finder

    - by gf
    I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

    Read the article

  • Why won't my image display??

    - by Josh
    Hello All- Do y'all see anything wrong with my code below? I want my image to appear immediately after page opens but it only opens after the report is run. Please let me know. Thanks. <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="SelectionReport.aspx.cs" Inherits="Geocortex.Essentials.WebFramework.SelectionReportPage" Culture="auto" UICulture="auto" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head id="Head1" runat="server"> <title><asp:Literal meta:resourcekey="Title1" runat="server" /></title> </head> <body> <form id="form1" runat="server"> <p> <asp:Image ID="Image1" runat="server" ImageAlign="Left" ImageUrl="~/Images/Loading.gif" style="z-index: 1; left: 254px; top: 15px; position: absolute" /> </p> <gcx:SelectionReportViewer ID="SelectionReportViewer" runat="server" /> </form> </body>

    Read the article

  • javascript regex: replace url text link with image,but not in html tags

    Hi this is my pice of code: <div style="overflow: hidden; width: 445px;">[IMG]http://i29.tinypic.com/mydog.png[/IMG] tak si to http://i29.tinypic.com/mycat.png Lorem ipsum loremai <img width="15" border="0" align="middle" src="images/smejo.gif" valign="middle"/> <img src=http://www.example.com/index.png alt> <img src="http://www.example.com/index.png" alt>     <a href="#reakcia" title="reagovat na temu"><span class="poradna-tl-reaguj"><reaction> </span></a></div> </td> </tr><img src=http://www.example.com/index.png alt><img src="http://www.example.com/index.png" alt> and i need regex pattern to replace ONLY text image links with image without touch of inner url tags. But i can't use "Lookbehind" or possessive quantifiers because JS don't support them=/ So i want to catch only "http://i29.tinypic.com/mydog.png" and "http://i29.tinypic.com/mycat.png". I using array method to replacing (will be greasemonkey script.) Many Thanks

    Read the article

< Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >