Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 274/302 | < Previous Page | 270 271 272 273 274 275 276 277 278 279 280 281  | Next Page >

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • Parallel Task Library WaitAny Design

    - by colithium
    I've just begun to explore the PTL and have a design question. My Scenario: I have a list of URLs that each refer to an image. I want each image to be downloaded in parallel. As soon as at least one image is downloaded, I want to execute a method that does something with the downloaded image. That method should NOT be parallelized -- it should be serial. I think the following will work but I'm not sure if this is the right way to do it. Because I have separate classes for collecting the images and for doing "something" with the collected images, I end up passing around an array of Tasks which seems wrong since it exposes the inner workings of how images are retrieved. But I don't know a way around it. In reality there is more to both of these methods but that's not important for this. Just know that they really shouldn't be lumped into one large method that both retrieves and does something with the image. Task<Image>[] downloadTasks = collector.RetrieveImages(listOfURLs); for (int i = 0; i < listOfURLs.Count; i++) { //Wait for any of the remaining downloads to complete int completedIndex = Task<Image>.WaitAny(downloadTasks); Image completedImage = downloadTasks[completedIndex].Result; //Now do something with the image (this "something" must happen serially) } /////////////////////////////////////////////////// public Task<Image>[] RetrieveImages(List<string> urls) { Task<Image>[] tasks = new Task<Image>[urls.Count]; int index = 0; foreach (string url in urls) { string lambdaVar = url; //Required... Bleh tasks[index] = Task<Image>.Factory.StartNew(() => { using (WebClient client = new WebClient()) { //TODO: Replace with live image locations string fileName = String.Format("{0}.png", i); client.DownloadFile(lambdaVar, Path.Combine(Application.StartupPath, fileName)); } return Image.FromFile(Path.Combine(Application.StartupPath, fileName)); }, TaskCreationOptions.LongRunning | TaskCreationOptions.AttachedToParent); index++; } return tasks; }

    Read the article

  • Getting error "Association references unmapped class" when using interfaces in model

    - by Bjarke
    I'm trying to use the automap functionality in fluent to generate a DDL for the following model and program, but somehow I keep getting the error "Association references unmapped class: IRole" when I call the GenerateSchemaCreationScript method in NHibernate. When I replace the type of the ILists with the implementation of the interfaces (User and Role) everything works fine. What am I doing wrong here? How can I make fluent use the implemented versions of IUser and IRole as defined in Unity? public interface IRole { string Title { get; set; } IList<IUser> Users { get; set; } } public interface IUser { string Email { get; set; } IList<IRole> Roles { get; set; } } public class Role : IRole { public virtual string Title { get; set; } public virtual IList<IUser> Users { get; set; } } public class User : IUser { public virtual string Email { get; set; } public virtual IList<IRole> Roles { get; set; } } I use the following program to generate the DDL using the GenerateSchemaCreationScript in NHibernate: class Program { static void Main(string[] args) { var ddl = new NHibernateSessionManager(); ddl.BuildConfiguration(); } } public class NHibernateSessionManager { private ISessionFactory _sessionFactory; private static IUnityContainer _container; private static void InitContainer() { _container = new UnityContainer(); _container.RegisterType(typeof(IUser), typeof(User)); _container.RegisterType(typeof(IRole), typeof(Role)); } public ISessionFactory BuildConfiguration() { InitContainer(); return Fluently.Configure().Database(MsSqlConfiguration.MsSql2008 .ConnectionString("ConnectionString")) .Mappings(m => m.AutoMappings.Add( AutoMap.AssemblyOf<IUser>())) .ExposeConfiguration(BuildSchema) .BuildSessionFactory(); } private void BuildSchema(Configuration cfg) { var ddl = cfg.GenerateSchemaCreationScript(new NHibernate.Dialect.MsSql2008Dialect()); System.IO.File.WriteAllLines("Filename", ddl); } }

    Read the article

  • custom control in DataGridTemplateColumn

    - by Johnsonlu
    Hi all, I'd like to add my custom control into a template column of data grid. The custom control is very similar to a text box, but has an icon in it. The user can click the icon, and selects an item from a prompted window, then the selected item will be filled into the text box. My problem is when the text box is filled, after I click the second column, the text will disappear. If I replace the custom control with a simple text box, the result is the same. Here is the sample code: //Employee.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace SimpleGridTest { public class Employee { public string Department { get; set; } public int ID { get; set; } public string Name { get; set; } } } Mainwindow.xaml <Window x:Class="SimpleGridTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525"> <Grid> <DataGrid x:Name="grid" Grid.Row="1" Margin="5" AutoGenerateColumns="False" RowHeight="25" RowHeaderWidth="10" ItemsSource="{Binding}" CanUserAddRows="True" CanUserSortColumns="False"> <DataGrid.Columns> <DataGridTemplateColumn Header="Department" Width="150"> <DataGridTemplateColumn.CellTemplate> <DataTemplate> <TextBox Text="{Binding Department}" /> </DataTemplate> </DataGridTemplateColumn.CellTemplate> </DataGridTemplateColumn> <DataGridTextColumn Header="ID" Binding="{Binding Path=ID}" Width="100"/> <DataGridTextColumn Header="Name" Binding="{Binding Path=Name}" Width="200"/> </DataGrid.Columns> </DataGrid> </Grid> </Window> MainWindow.xaml.cs using System.Windows; using System.Collections.ObjectModel; namespace SimpleGridTest { /// <summary> /// Interaction logic for MainWindow.xaml /// </summary> public partial class MainWindow : Window { private ObservableCollection<Employee> _employees = new ObservableCollection<Employee>(); public ObservableCollection<Employee> Employees { get { return _employees; } set { _employees = value; } } public MainWindow() { InitializeComponent(); grid.ItemsSource = Employees; } } } How can I fix this problem? Or I need to write a DataGrid***Column as DataGridTextColumn? Thanks in advance! Best Regards, Johnson

    Read the article

  • Perl: Compare and edit underlying structure in hash

    - by Mahfuzur Rahman Pallab
    I have a hash of complex structure and I want to perform a search and replace. The first hash is like the following: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"], 456 => ["as", "sd", "df"] }, mno => { 987 => ["lk", "dm", "sd"] }, } and I want to iteratively search for all '123'/'456' elements, and if a match is found, I need to do a comparison of the sublayer, i.e. of ['ab','cd','ef'] and ['as','sd','df'] and in this case, keep only the one with ['ab','cd','ef']. So the output will be as follows: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"] }, mno => { 987 => ["lk", "dm", "sd"] }, } So the deletion is based on the substructure, and not index. How can it be done? Thanks for the help!! Lets assume that I will declare the values to be kept, i.e. I will keep 456 = ["ab", "cd", "ef"] based on a predeclared value of ["ab", "cd", "ef"] and delete any other instance of 456 anywhere else. The search has to be for every key. so the code will go through the hash, first taking 123 = ["xx", "yy", "zy"] and compare it against itself throughout the rest of the hash, if no match is found, do nothing. If a match is found, like in the case of 456 = ["ab", "cd", "ef"], it will compare the two, and as I have said that in case of a match the one with ["ab", "cd", "ef"] would be kept, it will keep 456 = ["ab", "cd", "ef"] and discard any other instances of 456 anywhere else in the hash, i.e. it will delete 456 = ["as", "sd", "df"] in this case.

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • List of checkboxes

    - by Andrea Girardi
    Hi all, Happy New Year to all. I'm a newbie in VB.NET and ASP.NET. This is my problem: I retrieve a list of records from DB and, for every row, I need to show 4 checkboxes. I can use a checkboxlist for every rows, but it's not so clear how I can process the results after the submit. I've some object and some operations available for that object. From database I extract a list of object with all operations. For every operation I want to show a check box to enable or disable the operation. The result is something like that: OBJ1 - url - [] [x] [] OBJ2 - url - [] [x] [x] On url I've an href to another page created using the Id retrieved from DB. To create that I used this code: <td class="column-filename"> <strong> <asp:Label runat="server" Text='<%#DataBinder.Eval(Container.DataItem, "GroupName")%>'></asp:Label> </strong> </td> <td align="left"> <span style="vertical-align:middle"> <asp:CheckBoxList runat="server" ID="operations" RepeatDirection="Horizontal" RepeatLayout="Table"> <asp:ListItem Text="View"></asp:ListItem> <asp:ListItem Text="Upload"></asp:ListItem> <asp:ListItem Text="Move"></asp:ListItem> <asp:ListItem Text="Delete"></asp:ListItem> <asp:ListItem Text="Rename"></asp:ListItem> <asp:ListItem Text="Replace"></asp:ListItem> </asp:CheckBoxList> </span> </td> </asp> </asp> my problem is: how can I parse all checkboxes? could you help me or send me a link or any other resources to solve my issue? many thanks! Andrea

    Read the article

  • Matlab cell length

    - by AP
    Ok I seem to have got the most of the problem solved, I just need an expert eye to pick my error as I am stuck. I have a file of length [125 X 27] and I want to convert it to a file of length [144 x 27]. Now, I want to replace the missing files (time stamps) rows of zeros. (ideally its a 10 min daily average thus should have file length of 144) Here is the code I am using: fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); %//Make time a datenum of the first column time = datenum(data{1} , 'mm/dd/yyyy HH:MM') %//Find the difference in minutes from each row timeDiff = round(diff(datenum(time)*(24*60))) %//the rest of the data data = cell2mat(data(2:28)); newdata=zeros(144,27); for n=1:length(timeDiff) if timeDiff(n)==10 newdata(n,:)=data(n,:); newdata(n+1,:)=data(n+1,:); else p=timeDiff(n)/10 n=n+p; end end Can somebody please help me to find the error inside my for loop. My output file seems to miss few timestamped values. %*********************************************************************************************************** Can somebody help me to figure out the uiget to read the above file?? i am replacing fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); With [c,pathc]=uigetfile({'*.txt'},'Select the file','C:\data'); file=[pathc c]; file= textscan(c, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); And its not working % NEW ADDITION to old question p = 1; %index into destination for n = 1:length(timeDiff) % if timeDiff(n) == 10 % newfile(p,:) = file(n,:); % newfile(p+1,:)=file(n+1,:); % p = p + 1; % else % p = p + (timeDiff(n)/10); % end q=cumsum(timeDiff(n)/10); if q==1 newfile(p,:)=file(n,:); p=p+1; else p = p + (timeDiff(n)/10); end end xlswrite('testnewws11.xls',newfile); even with the cumsum command this code fails when my file has 1,2 time stamps in middle of long missing ones example 8/16/2009 0:00 5.34 8/16/2009 0:10 3.23 8/16/2009 0:20 2.23 8/16/2009 0:30 1.23 8/16/2009 0:50 70 8/16/2009 2:00 5.23 8/16/2009 2:20 544 8/16/2009 2:30 42.23 8/16/2009 3:00 71.23 8/16/2009 3:10 3.23 My output looks like 5.34 3.23 2.23 0 0 0 0 0 0 0 0 0 5.23 544. 42.23 0 0 0 3.23 Any ideas?

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • HttpWebRequest possibly slowing website

    - by Steven Smith
    Using Visual studio 2012, C#.net 4.5 , SQL Server 2008, Feefo, Nopcommerce Hey guys I have Recently implemented a new review service into a current site we have. When the change went live the first day all worked fine. Since then though the sending of sales to Feefo hasnt been working, There are no logs either of anything going wrong. In the OrderProcessingService.cs in Nop Commerce's Service, i call a HttpWebrequest when an order has been confirmed as completed. Here is the code. var email = HttpUtility.UrlEncode(order.Customer.Email.ToString()); var name = HttpUtility.UrlEncode(order.Customer.GetFullName().ToString()); var description = HttpUtility.UrlEncode(productVariant.ProductVariant.Product.MetaDescription != null ? productVariant.ProductVariant.Product.MetaDescription.ToString() : "product"); var orderRef = HttpUtility.UrlEncode(order.Id.ToString()); var productLink = HttpUtility.UrlEncode(string.Format("myurl/p/{0}/{1}", productVariant.ProductVariant.ProductId, productVariant.ProductVariant.Name.Replace(" ", "-"))); string itemRef = ""; try { itemRef = HttpUtility.UrlEncode(productVariant.ProductVariant.ProductId.ToString()); } catch { itemRef = "0"; } var url = string.Format("feefo Url", login, password,email,name,description,orderRef,productLink,itemRef); var request = (HttpWebRequest)WebRequest.Create(url); request.KeepAlive = false; request.Timeout = 5000; request.Proxy = null; using (var response = (HttpWebResponse)request.GetResponse()) { if (response.StatusDescription == "OK") { var stream = response.GetResponseStream(); if(stream != null) { using (var reader = new StreamReader(stream)) { var content = reader.ReadToEnd(); } } } } So as you can see its a simple webrequest that is processed on an order, and all product variants are sent to feefo. Now: this hasnt been happening all week since the 15th (day of the implementation) the site has been grinding to a halt recently. The stream and reader in the the var content is there for debugging. Im wondering does the code redflag anything to you that could relate to the process of website? Also note i have run some SQL statements to see if there is any deadlocks or large escalations, so far seems fine, Logs have also been fine just the usual logging of Bots. Any help would be much appreciated! EDIT: also note that this code is in a method that is called and wrapped in A try catch UPDATE: well forget about the "not sending", thats because i was just told my code was rolled back last week

    Read the article

  • Greasemonkey is getting an empty document.body on select Google pages.

    - by Brock Adams
    Hi, I have a Greasemonkey script that processes Google search results. But it's failing in a few instances, when xpath searches (and document body) appear to be empty. Running the code in Firebug's console works every time. It only fails in a Greasemonkey script. Greasemonkey sees an empty document.body. I've boiled the problem down to a test, greasemonkey script, below. I'm using Firefox 3.5.9 and Greasemonkey 0.8.20100408.6 (but earlier versions had the same problem). Problem: Greasemonkey sees an empty document.body. Recipe to Duplicate: Install the Greasemonkey script. Open a new tab or window. Navigate to Google.com (http://www.google.com/). Search on a simple term like "cats". Check Firefox's Error console (Ctrl-shift-J) or Firebug's console. The script will report that document body is empty. Hit refresh. The script will show a good result (document body found). Note that the failure only reliably appears on Google results obtained this way, and on a new tab/window. Turn javascript off globally (javascript.enabled set to false in about:config). Repeat steps 2 thru 5. Only now the Greasemonkey script will work. It seems that Google javascript is killing the DOM tree for greasemonkey, somehow. I've tried a time-delayed retest and even a programmatic refresh; the script still fails to see the document body. Test Script: // // ==UserScript== // @name TROUBLESHOOTING 2 snippets // @namespace http://www.google.com/ // @description For code that has funky misfires and defies standard debugging. // @include http://*/* // ==/UserScript== // function LocalMain (sTitle) { var sUserMessage = ''; //var sRawHtml = unsafeWindow.document.body.innerHTML; //-- unsafeWindow makes no difference. var sRawHtml = document.body.innerHTML; if (sRawHtml) { sRawHtml = sRawHtml.replace (/^\s\s*/, ''). substr (0, 60); sUserMessage = sTitle + ', Doc body = ' + sRawHtml + ' ...'; } else { sUserMessage = sTitle + ', Document body seems empty!'; } if (typeof (console) != "undefined") { console.log (sUserMessage); } else { if (typeof (GM_log) != "undefined") GM_log (sUserMessage); else if (!sRawHtml) alert (sUserMessage); } } LocalMain ('Preload'); window.addEventListener ("load", function() {LocalMain ('After load');}, false);

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • How not to abort http response c#

    - by user194076
    I need to run several methods after sending file to a user for a download. What happens is that after I send a file to a user, response is aborted and I can no longer do anything after response.end(). for example, this is my sample code: Response.Clear(); Response.AddHeader("content-disposition", "attachment; filename=test.pdf"); Response.ContentType = "application/pdf"; byte[] a = System.Text.Encoding.UTF8.GetBytes("test"); Response.BinaryWrite(a); Response.End(); StartNextMethod(); Response.Redirect(URL); So, in this example StartNextMethod and Response.Redirect are not executing. What I tried is I created a separate handler(ashx) with the following code: public void ProcessRequest(HttpContext context) { context.Response.Clear(); context.Response.AddHeader("content-disposition", "attachment; filename=test.pdf"); context.Response.ContentType = "application/pdf"; byte[] a = System.Text.Encoding.UTF8.GetBytes("test"); context.Response.BinaryWrite(a); context.Response.End(); } and call it like this: Download d = new Download(); d.ProcessRequest(HttpContext.Current); StartNextMethod(); Response.Redirect(URL); but the same error happen. I've tryied to replace Response.End with CompleteRequest but it doesn't help. I guess the problem is that I'm using HttpContext.Current but should use a separate response stream. Is that correct? how do I do that in a separate method generically (Assume that I want my handler to accept byte array of data and content type and be downloadable from a separate response. I really do not want to use a separate page for a response. UPDATE I still didn't find a good solution. I'd like to do some actions after user has downloaded a file, but without using a separate page for a response\request thing.

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • GCC problem with raw double type comparisons

    - by Monomer
    I have the following bit of code, however when compiling it with GCC 4.4 with various optimization flags I get some unexpected results when its run. #include <iostream> int main() { const unsigned int cnt = 10; double lst[cnt] = { 0.0 }; const double v[4] = { 131.313, 737.373, 979.797, 731.137 }; for(unsigned int i = 0; i < cnt; ++i) { lst[i] = v[i % 4] * i; } for(unsigned int i = 0; i < cnt; ++i) { double d = v[i % 4] * i; if(lst[i] != d) { std::cout << "error @ : " << i << std::endl; return 1; } } return 0; } when compiled with: "g++ -pedantic -Wall -Werror -O1 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O2 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O3 -o test test.cpp" I get no errors when compiled with: "g++ -pedantic -Wall -Werror -o test test.cpp" I get no errors I do not believe this to be an issue related to rounding, or epsilon difference in the comparison. I've tried this with Intel v10 and MSVC 9.0 and they all seem to work as expected. I believe this should be nothing more than a bitwise compare. If I replace the if-statement with the following: if (static_cast<long long int>(lst[i]) != static_cast<long long int>(d)), and add "-Wno-long-long" I get no errors in any of the optimization modes when run. If I add std::cout << d << std::endl; before the "return 1", I get no errors in any of the optimization modes when run. Is this a bug in my code, or is there something wrong with GCC and the way it handles the double type?

    Read the article

  • How do I make a full screen scrolling messagebox or window?

    - by chobo2
    Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

    Read the article

  • vb6 ADODB TSQL procedure call quit working after database migration

    - by phill
    This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Sanitizing DB inputs with XSLT

    - by azathoth
    Hello I've been looking for a method to strip my XML content of apostrophes (') like: <name> Jim O'Connor</name> since my DBMS is complaining of receiving those. By looking at the example described here, that is supposed to replace ' with '', I constructed the following script: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes" /> <xsl:template match="node()|@*"> <xsl:copy> <xsl:apply-templates select="node()|@*" /> </xsl:copy> </xsl:template> <xsl:template name="sqlApostrophe"> <xsl:param name="string" /> <xsl:variable name="apostrophe">'</xsl:variable> <xsl:choose> <xsl:when test="contains($string,$apostrophe)"> <xsl:value-of select="concat(substring-before($string,$apostrophe), $apostrophe,$apostrophe)" disable-output-escaping="yes" /> <xsl:call-template name="sqlApostrophe"> <xsl:with-param name="string" select="substring-after($string,$apostrophe)" /> </xsl:call-template> </xsl:when> <xsl:otherwise> <xsl:value-of select="$string" disable-output-escaping="yes" /> </xsl:otherwise> </xsl:choose> </xsl:template> <xsl:template match="node()|@*"> <xsl:apply-templates name="sqlApostrophe"/> </xsl:template> </xsl:stylesheet> However, the processor isn't accepting it. What am I missing here? Is there a better way to get rid of the apostrophes? Perhaps another approach for sanitizing DB inputs by using XSLT? Thanks for your help

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • ASP.Net MVC + Live validation - how come the flagged text are all over the place?

    - by melaos
    hi guys, this is an asp.net mvc project and <% using (Html.BeginForm("ProductAdded", "Home")) { % Register Your Product <%= ViewData["MainHeader"]% <p><%=ViewData["IntroText"]%></p> <div style="display: none;"> <div id="regionThreePane"> <table border="0" cellpadding="0" cellspacing="0" frame="void" style="width: 100%"> <tr> <td width='250px'><select name="ProdLBox1" id="ProdLBox1" class="ProdLBox1" size="8"></select></td> <td width='250px'><select name="ProdLBox2" id="ProdLBox2" class="ProdLBox2" size="8"></select></td> <td width='250px'><select name="ProdLBox3" id="ProdLBox3" class="ProdLBox3" size="8"></select></td> </tr> </table> </div> i'm using live validation for my client side validation. var v_fname = new LiveValidation('Customer_FirstName', { validMessage: " " }, { onlyOnSubmit: true }); v_fname.add(Validate.Presence, { failureMessage: enterfirstname}); var v_lname = new LiveValidation('Customer_LastName', { validMessage: " " }); v_lname.add(Validate.Presence, { failureMessage: enterlastname }); var v_email = new LiveValidation('Customer_Email', { validMessage: " " }); v_email.add(Validate.Presence, { failureMessage: enteremail, validMessage: " " }); v_email.add(Validate.Email, { failureMessage: entervalidemail}); and what i notice is that after doing some button call: $(".btnAddProduct").click(function() { //Check first to see if there's anything to be added if (parseFloat($(".tboAddProduct").val()) < 1) { //TO DO: to replace with localized text var selectProductError = "Please select a product first"; $("#validationSummary").text(selectProductError); //alert("Please select a product first"); return false; } $(".PanelProductReg").show(); addProductRow($(".tboAddProductId").val(), $("#tboAddProduct").val()); }); what will happen is that the validation tags will start to appear for the whole page for all the input which are tag for the live validation. instead of just appearing when the controls are being higlighted and onblur. i'm using some ajax calls to get data and a lot of jquery to dynamically do the gui stuff. could any of this be causing some sort of an internal conflict? thanks

    Read the article

  • How to override loading a TImage from the object inspector (at run-time)?

    - by Mawg
    Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

< Previous Page | 270 271 272 273 274 275 276 277 278 279 280 281  | Next Page >