Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 274/302 | < Previous Page | 270 271 272 273 274 275 276 277 278 279 280 281  | Next Page >

  • How to properly preload images, js and css files?

    - by Kenny Bones
    Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

    Read the article

  • Matlab cell length

    - by AP
    Ok I seem to have got the most of the problem solved, I just need an expert eye to pick my error as I am stuck. I have a file of length [125 X 27] and I want to convert it to a file of length [144 x 27]. Now, I want to replace the missing files (time stamps) rows of zeros. (ideally its a 10 min daily average thus should have file length of 144) Here is the code I am using: fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); %//Make time a datenum of the first column time = datenum(data{1} , 'mm/dd/yyyy HH:MM') %//Find the difference in minutes from each row timeDiff = round(diff(datenum(time)*(24*60))) %//the rest of the data data = cell2mat(data(2:28)); newdata=zeros(144,27); for n=1:length(timeDiff) if timeDiff(n)==10 newdata(n,:)=data(n,:); newdata(n+1,:)=data(n+1,:); else p=timeDiff(n)/10 n=n+p; end end Can somebody please help me to find the error inside my for loop. My output file seems to miss few timestamped values. %*********************************************************************************************************** Can somebody help me to figure out the uiget to read the above file?? i am replacing fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); With [c,pathc]=uigetfile({'*.txt'},'Select the file','C:\data'); file=[pathc c]; file= textscan(c, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); And its not working % NEW ADDITION to old question p = 1; %index into destination for n = 1:length(timeDiff) % if timeDiff(n) == 10 % newfile(p,:) = file(n,:); % newfile(p+1,:)=file(n+1,:); % p = p + 1; % else % p = p + (timeDiff(n)/10); % end q=cumsum(timeDiff(n)/10); if q==1 newfile(p,:)=file(n,:); p=p+1; else p = p + (timeDiff(n)/10); end end xlswrite('testnewws11.xls',newfile); even with the cumsum command this code fails when my file has 1,2 time stamps in middle of long missing ones example 8/16/2009 0:00 5.34 8/16/2009 0:10 3.23 8/16/2009 0:20 2.23 8/16/2009 0:30 1.23 8/16/2009 0:50 70 8/16/2009 2:00 5.23 8/16/2009 2:20 544 8/16/2009 2:30 42.23 8/16/2009 3:00 71.23 8/16/2009 3:10 3.23 My output looks like 5.34 3.23 2.23 0 0 0 0 0 0 0 0 0 5.23 544. 42.23 0 0 0 3.23 Any ideas?

    Read the article

  • Separate specific #ifdef branches

    - by detly
    In short: I want to generate two different source trees from the current one, based only on one preprocessor macro being defined and another being undefined, with no other changes to the source. If you are interested, here is my story... In the beginning, my code was clean. Then we made a new product, and yea, it was better. But the code saw only the same peripheral devices, so we could keep the same code. Well, almost. There was one little condition that needed to be changed, so I added: #if defined(PRODUCT_A) condition = checkCat(); #elif defined(PRODUCT_B) condition = checkCat() && checkHat(); #endif ...to one and only one source file. In the general all-source-files-include-this header file, I had: #if !(defined(PRODUCT_A)||defined(PRODUCT_B)) #error "Don't make me replace you with a small shell script. RTFM." #endif ...so that people couldn't compile it unless they explicitly defined a product type. All was well. Oh... except that modifications were made, components changed, and since the new hardware worked better we could significantly re-write the control systems. Now when I look upon the face of the code, there are more than 60 separate areas delineated by either: #ifdef PRODUCT_A ... #else ... #endif ...or the same, but for PRODUCT_B. Or even: #if defined(PRODUCT_A) ... #elif defined(PRODUCT_B) ... #endif And of course, sometimes sanity took a longer holiday and: #ifdef PRODUCT_A ... #endif #ifdef PRODUCT_B ... #endif These conditions wrap anywhere from one to two hundred lines (you'd think that the last one could be done by switching header files, but the function names need to be the same). This is insane. I would be better off maintaining two separate product-based branches in the source repo and porting any common changes. I realise this now. Is there something that can generate the two different source trees I need, based only on PRODUCT_A being defined and PRODUCT_B being undefined (and vice-versa), without touching anything else (ie. no header inclusion, no macro expansion, etc)?

    Read the article

  • When is ¦ not equal to ¦?

    - by Trey Jackson
    Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

    Read the article

  • How to overwrite an array of char pointers with a larger list of char pointers?

    - by Casey
    My function is being passed a struct containing, among other things, a NULL terminated array of pointers to words making up a command with arguments. I'm performing a glob match on the list of arguments, to expand them into a full list of files, then I want to replace the passed argument array with the new expanded one. The globbing is working fine, that is, g.gl_pathv is populated with the list of expected files. However, I am having trouble copying this array into the struct I was given. #include <glob.h> struct command { char **argv; // other fields... } void myFunction( struct command * cmd ) { char **p = cmd->argv; char* program = *p++; // save the program name (e.g 'ls', and increment to the first argument glob_t g; memset(&g, 0, sizeof(g)); g.gl_offs = 1; int res = glob(*p++, GLOB_DOOFFS, NULL, &g); glob_handle_res(res); while (*p) { res = glob(*p, GLOB_DOOFFS | GLOB_APPEND, NULL, &g); glob_handle_res(res); } if( g.gl_pathc <= 0 ) { globfree(&g); } cmd->argv = malloc((g.gl_pathc + g.gl_offs) * sizeof *cmd->argv); if (cmd->argv == NULL) { sys_fatal_error("pattern_expand: malloc failed\n");} // copy over the arguments size_t i = g.gl_offs; for (; i < g.gl_pathc + g.gl_offs; ++i) cmd->argv[i] = strdup(g.gl_pathv[i]); // insert the original program name cmd->argv[0] = strdup(program); ** cmd->argv[g.gl_pathc + g.gl_offs] = 0; ** globfree(&g); } void command_free(struct esh_command * cmd) { char ** p = cmd->argv; while (*p) { free(*p++); // Segfaults here, was it already freed? } free(cmd->argv); free(cmd); } Edit 1: Also, I realized I need to stick program back in there as cmd-argv[0] Edit 2: Added call to calloc Edit 3: Edit mem management with tips from Alok Edit 4: More tips from alok Edit 5: Almost working.. the app segfaults when freeing the command struct Finally: Seems like I was missing the terminating NULL, so adding the line: cmd->argv[g.gl_pathc + g.gl_offs] = 0; seemed to make it work.

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • List of checkboxes

    - by Andrea Girardi
    Hi all, Happy New Year to all. I'm a newbie in VB.NET and ASP.NET. This is my problem: I retrieve a list of records from DB and, for every row, I need to show 4 checkboxes. I can use a checkboxlist for every rows, but it's not so clear how I can process the results after the submit. I've some object and some operations available for that object. From database I extract a list of object with all operations. For every operation I want to show a check box to enable or disable the operation. The result is something like that: OBJ1 - url - [] [x] [] OBJ2 - url - [] [x] [x] On url I've an href to another page created using the Id retrieved from DB. To create that I used this code: <td class="column-filename"> <strong> <asp:Label runat="server" Text='<%#DataBinder.Eval(Container.DataItem, "GroupName")%>'></asp:Label> </strong> </td> <td align="left"> <span style="vertical-align:middle"> <asp:CheckBoxList runat="server" ID="operations" RepeatDirection="Horizontal" RepeatLayout="Table"> <asp:ListItem Text="View"></asp:ListItem> <asp:ListItem Text="Upload"></asp:ListItem> <asp:ListItem Text="Move"></asp:ListItem> <asp:ListItem Text="Delete"></asp:ListItem> <asp:ListItem Text="Rename"></asp:ListItem> <asp:ListItem Text="Replace"></asp:ListItem> </asp:CheckBoxList> </span> </td> </asp> </asp> my problem is: how can I parse all checkboxes? could you help me or send me a link or any other resources to solve my issue? many thanks! Andrea

    Read the article

  • custom control in DataGridTemplateColumn

    - by Johnsonlu
    Hi all, I'd like to add my custom control into a template column of data grid. The custom control is very similar to a text box, but has an icon in it. The user can click the icon, and selects an item from a prompted window, then the selected item will be filled into the text box. My problem is when the text box is filled, after I click the second column, the text will disappear. If I replace the custom control with a simple text box, the result is the same. Here is the sample code: //Employee.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace SimpleGridTest { public class Employee { public string Department { get; set; } public int ID { get; set; } public string Name { get; set; } } } Mainwindow.xaml <Window x:Class="SimpleGridTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525"> <Grid> <DataGrid x:Name="grid" Grid.Row="1" Margin="5" AutoGenerateColumns="False" RowHeight="25" RowHeaderWidth="10" ItemsSource="{Binding}" CanUserAddRows="True" CanUserSortColumns="False"> <DataGrid.Columns> <DataGridTemplateColumn Header="Department" Width="150"> <DataGridTemplateColumn.CellTemplate> <DataTemplate> <TextBox Text="{Binding Department}" /> </DataTemplate> </DataGridTemplateColumn.CellTemplate> </DataGridTemplateColumn> <DataGridTextColumn Header="ID" Binding="{Binding Path=ID}" Width="100"/> <DataGridTextColumn Header="Name" Binding="{Binding Path=Name}" Width="200"/> </DataGrid.Columns> </DataGrid> </Grid> </Window> MainWindow.xaml.cs using System.Windows; using System.Collections.ObjectModel; namespace SimpleGridTest { /// <summary> /// Interaction logic for MainWindow.xaml /// </summary> public partial class MainWindow : Window { private ObservableCollection<Employee> _employees = new ObservableCollection<Employee>(); public ObservableCollection<Employee> Employees { get { return _employees; } set { _employees = value; } } public MainWindow() { InitializeComponent(); grid.ItemsSource = Employees; } } } How can I fix this problem? Or I need to write a DataGrid***Column as DataGridTextColumn? Thanks in advance! Best Regards, Johnson

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • Parallel Task Library WaitAny Design

    - by colithium
    I've just begun to explore the PTL and have a design question. My Scenario: I have a list of URLs that each refer to an image. I want each image to be downloaded in parallel. As soon as at least one image is downloaded, I want to execute a method that does something with the downloaded image. That method should NOT be parallelized -- it should be serial. I think the following will work but I'm not sure if this is the right way to do it. Because I have separate classes for collecting the images and for doing "something" with the collected images, I end up passing around an array of Tasks which seems wrong since it exposes the inner workings of how images are retrieved. But I don't know a way around it. In reality there is more to both of these methods but that's not important for this. Just know that they really shouldn't be lumped into one large method that both retrieves and does something with the image. Task<Image>[] downloadTasks = collector.RetrieveImages(listOfURLs); for (int i = 0; i < listOfURLs.Count; i++) { //Wait for any of the remaining downloads to complete int completedIndex = Task<Image>.WaitAny(downloadTasks); Image completedImage = downloadTasks[completedIndex].Result; //Now do something with the image (this "something" must happen serially) } /////////////////////////////////////////////////// public Task<Image>[] RetrieveImages(List<string> urls) { Task<Image>[] tasks = new Task<Image>[urls.Count]; int index = 0; foreach (string url in urls) { string lambdaVar = url; //Required... Bleh tasks[index] = Task<Image>.Factory.StartNew(() => { using (WebClient client = new WebClient()) { //TODO: Replace with live image locations string fileName = String.Format("{0}.png", i); client.DownloadFile(lambdaVar, Path.Combine(Application.StartupPath, fileName)); } return Image.FromFile(Path.Combine(Application.StartupPath, fileName)); }, TaskCreationOptions.LongRunning | TaskCreationOptions.AttachedToParent); index++; } return tasks; }

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • vb6 ADODB TSQL procedure call quit working after database migration

    - by phill
    This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

    Read the article

  • GCC problem with raw double type comparisons

    - by Monomer
    I have the following bit of code, however when compiling it with GCC 4.4 with various optimization flags I get some unexpected results when its run. #include <iostream> int main() { const unsigned int cnt = 10; double lst[cnt] = { 0.0 }; const double v[4] = { 131.313, 737.373, 979.797, 731.137 }; for(unsigned int i = 0; i < cnt; ++i) { lst[i] = v[i % 4] * i; } for(unsigned int i = 0; i < cnt; ++i) { double d = v[i % 4] * i; if(lst[i] != d) { std::cout << "error @ : " << i << std::endl; return 1; } } return 0; } when compiled with: "g++ -pedantic -Wall -Werror -O1 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O2 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O3 -o test test.cpp" I get no errors when compiled with: "g++ -pedantic -Wall -Werror -o test test.cpp" I get no errors I do not believe this to be an issue related to rounding, or epsilon difference in the comparison. I've tried this with Intel v10 and MSVC 9.0 and they all seem to work as expected. I believe this should be nothing more than a bitwise compare. If I replace the if-statement with the following: if (static_cast<long long int>(lst[i]) != static_cast<long long int>(d)), and add "-Wno-long-long" I get no errors in any of the optimization modes when run. If I add std::cout << d << std::endl; before the "return 1", I get no errors in any of the optimization modes when run. Is this a bug in my code, or is there something wrong with GCC and the way it handles the double type?

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Greasemonkey is getting an empty document.body on select Google pages.

    - by Brock Adams
    Hi, I have a Greasemonkey script that processes Google search results. But it's failing in a few instances, when xpath searches (and document body) appear to be empty. Running the code in Firebug's console works every time. It only fails in a Greasemonkey script. Greasemonkey sees an empty document.body. I've boiled the problem down to a test, greasemonkey script, below. I'm using Firefox 3.5.9 and Greasemonkey 0.8.20100408.6 (but earlier versions had the same problem). Problem: Greasemonkey sees an empty document.body. Recipe to Duplicate: Install the Greasemonkey script. Open a new tab or window. Navigate to Google.com (http://www.google.com/). Search on a simple term like "cats". Check Firefox's Error console (Ctrl-shift-J) or Firebug's console. The script will report that document body is empty. Hit refresh. The script will show a good result (document body found). Note that the failure only reliably appears on Google results obtained this way, and on a new tab/window. Turn javascript off globally (javascript.enabled set to false in about:config). Repeat steps 2 thru 5. Only now the Greasemonkey script will work. It seems that Google javascript is killing the DOM tree for greasemonkey, somehow. I've tried a time-delayed retest and even a programmatic refresh; the script still fails to see the document body. Test Script: // // ==UserScript== // @name TROUBLESHOOTING 2 snippets // @namespace http://www.google.com/ // @description For code that has funky misfires and defies standard debugging. // @include http://*/* // ==/UserScript== // function LocalMain (sTitle) { var sUserMessage = ''; //var sRawHtml = unsafeWindow.document.body.innerHTML; //-- unsafeWindow makes no difference. var sRawHtml = document.body.innerHTML; if (sRawHtml) { sRawHtml = sRawHtml.replace (/^\s\s*/, ''). substr (0, 60); sUserMessage = sTitle + ', Doc body = ' + sRawHtml + ' ...'; } else { sUserMessage = sTitle + ', Document body seems empty!'; } if (typeof (console) != "undefined") { console.log (sUserMessage); } else { if (typeof (GM_log) != "undefined") GM_log (sUserMessage); else if (!sRawHtml) alert (sUserMessage); } } LocalMain ('Preload'); window.addEventListener ("load", function() {LocalMain ('After load');}, false);

    Read the article

  • How to override loading a TImage from the object inspector (at run-time)?

    - by Mawg
    Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • How do I make a full screen scrolling messagebox or window?

    - by chobo2
    Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

    Read the article

  • removing contents of div using Jquery "empty" doesn't work

    - by Andrew
    I'm trying to remove contents of particular div which are basically list items and a heading by using jquery empty so that I could replace with new contents. What happens when I run the code is, the whole div element blinked and flash the replaced content and then the old one reappear. Can anyone tell me what am I doing wrong? Here's an excerpt of my code - <pre> $("#msg_tab").bind("click",function(){ $("#sidebar1").remove(); var html="<ul><li><h2>test</h2><ul><li><a href='#'>Compose New Message</a></li><li><a href='#'>Inbox</a></li><li><a href='#'>Outbox</a></li><li><a href='#'>Unread</a></li><li><a href='#'>Archive</a></li></ul></li></ul>"; $("#sidebar1").append(html); }); <div id="sidebar1" class="sidebar"> <ul> <li> <h2>Messages</h2> <ul> <li><a href="#">Compose New Message</a></li> <li><a href="#">Inbox</a></li> <li><a href="#">Outbox</a></li> <li><a href="#">Unread</a></li> <li><a href="#">Archive</a></li> </ul> </li> </ul> </div> Another question is, how do I write multiple line html code string in javascript so that java would recognize as a string value? Placing forward slash at the end is ok when the string is not a html code but, in html code, I can't figure out how to escape forward slash from ending tags.I've tried escaping it with backward slash but doesn't work. I would be appreciated if anyone could shed a light on this matter as well.

    Read the article

< Previous Page | 270 271 272 273 274 275 276 277 278 279 280 281  | Next Page >