Search Results

Search found 8896 results on 356 pages for 'jason block'.

Page 275/356 | < Previous Page | 271 272 273 274 275 276 277 278 279 280 281 282  | Next Page >

• SAN with iSCSI-Target Performance Horrendous

  - by Justin

  We have a poor man's SAN setup in a 1U Ubuntu server running iSCSI-Target with two 300GB drives in RAID-0. We then are using it for block level storage for virtual machines. The hypervisor is connected to the SAN via gigabit on a dedicated VLAN and interfaces. We only have a single virtual machine setup and doing some benchmarks. If we run hdparm -t /dev/sda1 from the virtual machine, we get 'ok' performance of 75MB/s from the virtual machine to the SAN. Then we basically compile a package with ./configure and make. Things start ok, but then all the sudden the load average on the SAN grows to 7+ and things slow down to a crawl. When we SSH into the SAN and run top, sure the load is 7+, but the CPU usage is basically nothing, also the server has 1.5GB of memory available. When we kill the compile on the virtual machine, slowly the LOAD on the SAN goes back to sub 1 figures. What in the world is causing this? How can we diagnosis this further? Here are two screenshot from the SAN during high load. 1> Output of iotop on the SAN: 2> Output of top on the SAN:

  Read the article

• authbind, privbind or iptables REDIRECT (port 80 to 8080)?

  - by chris_l

  Hi, I'd like to run Glassfish v3 as a non-privileged user on Linux (Debian), but make it available on port 80. I'm currently doing this with iptables: iptables -t nat -I PREROUTING -p tcp -d x.x.x.x --dport 80 -j REDIRECT --to-port 8080 This works, but I wonder: If this has any significant performance impact compared to binding directly to port 80 If I could make a similar setup also work for HTTPS (or if that must run on 443) If there's a way to avoid other users from binding to port 8080 (in case my server crashes) - maybe block that port permanently to other users somehow? ...or if I should use authbind/privbind instead? Problem: I couldn't make it work with authbind or privbind so far. For authbind, I edited asadmin's last line to: exec authbind --deep "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... For privbind: exec privbind -u glassfish "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... (Only) with these settings, I can successfully perform a create-domain --domainport 80. This proves, that authbind and privbind actually work (the authbind version of the script is called by the glassfish user; the privbind version is called by root of course). However, in both cases I get the following exception, when starting the domain (start-domain): [#|2010-03-20T13:25:21.925+0100|SEVERE|glassfishv3.0|javax.enterprise.system.core.com.sun.enterprise.v3.server|_ThreadID=11;_ThreadName=FelixStartLevel;|Shutting down v3 due to startup exception : Permission denied: 80=com.sun.enterprise.v3.services.impl.monitor.MonitorableSelectorHandler@1fc25e5|#] I haven't found a solution for that yet (after searching the web, it seems, that this isn't so easy?) But maybe, the solution with iptables is good enough - what do you think? Thanks, Chris

  Read the article

• SAN performance issues storing SQL Server tempdb on a SAN that's being backed up

  - by user42724

  I'm afraid I don't know much about SAN's so please forgive my lack of detail or technical terms. As a developer I've just completed and put on an existing production system a new application but it would appear to have tipped the scales regarding the performance of the backups being taken from the SAN. As I understand it there's a mirror of the SAN being taken usually constantly at the block-level. However, there seem to be so many new writes to the disk that the SAN mirroring/backup process can no longer keep up. I believe I've narrowed this down to SQL Servers tempdb which exists on a drive that contributes the largest portion of the problem! In fact I think tempdb has be contributing the largest portion of the issues all along regardless of my application! My question therefore is whether the tempdb should ever be mirrored or backed on the SAN and whether anyone else has gone through this sort of pain already? I'm wondering whether it's a best practise to make sure that tempdb is never mirrored on a SAN simply because any writes to it don't need to be saved. This also raises a slightly connected question - is it better to rely on SQL Servers built-in database backups tools (DB in full-recovery mode with full/differential and transaction log backups) or, as is the case with our application, SQL server is in simple recovery mode and never backed up since the SAN is mirrored and backed up? Many thanks

  Read the article

• How do I get more information on a potential network freeloader?

  - by Dov

  I have a home network set up, complete with a relatively good password. I'm in Mac OS X 10.6 (Snow Leopard) and have been noticing, on occasion, a computer showing up in my Finder's Shared section, that is not one of my own (the "pe-xpjalle" box pictured below). He has a tendency to come and go. How can I figure out his MAC address or something, so I can block him? I checked my "Logs and Statistics" in the Airport Utility, and didn't see that computer under DHCP clients. I'd rather not change my password, since I have quite a few devices I'd have to update. Is there any other reason he's show up on my network besides having guessed my password? Update: I fixed the Dropbox URL above (how embarrassing, I'm new to Dropbox. Thanks for the heads up, Doug.) Update 2: I tried clicking on "Connect as..." just for the hell of it, and got the dialog below. Now I have even less an idea what's going on than before. I don't have Parallels of VMware running, just the following: Transmission, NetNewsWire, Mail, Things, Safari, iTunes, Photoshop, Pages, Yojimbo, Preferences, AppleScript Editor, Software Update, Airport Utility, and Terminal. I don't think any of those create a virtual network machine, right? And no VMware machine of mine has ever had a name resembling "pe-xpjalle". Update 3: I just changed my passwords on both my N- and G-only networks, and I'm still seeing this, so I highly doubt that it's someone who's figured out my password (twice now). I'm really stumped.

  Read the article

• CoreStore Encryption Error on Mac Lion

  - by Michael

  I am trying to encrypt an external drive using diskutil CoreStorage on Mac Lion 10.7.4. I thought the only requirements were that the drive have GUID partition scheme and Journaled HFS+ file system. I think my drive is configured accordingly but when I type the following command I get an error message back: Michaels-MacBook-Pro:~ Michael$ diskutil cs convert disk2 -passphrase TestPassword Error converting disk to CoreStorage: The given file system is not supported on Core Storage (-69756) Here are the details reported for the drive in question: Michaels-MacBook-Pro:~ Michael$ diskutil list disk2 /dev/disk2 #: TYPE NAME SIZE IDENTIFIER 0: GUID_partition_scheme *500.1 GB disk2 1: EFI 209.7 MB disk2s1 2: Apple_HFS Test1 499.8 GB disk2s2 Michaels-MacBook-Pro:~ Michael$ diskutil list disk2 /dev/disk2 #: TYPE NAME SIZE IDENTIFIER 0: GUID_partition_scheme *500.1 GB disk2 1: EFI 209.7 MB disk2s1 2: Apple_HFS Test1 499.8 GB disk2s2 Michaels-MacBook-Pro:~ Michael$ diskutil info disk2s2 Device Identifier: disk2s2 Device Node: /dev/disk2s2 Part of Whole: disk2 Device / Media Name: Test1 Volume Name: Test1 Escaped with Unicode: Test1 Mounted: Yes Mount Point: /Volumes/Test1 Escaped with Unicode: /Volumes/Test1 File System Personality: Journaled HFS+ Type (Bundle): hfs Name (User Visible): Mac OS Extended (Journaled) Journal: Journal size 40960 KB at offset 0xe8e000 Owners: Disabled Partition Type: Apple_HFS OS Can Be Installed: Yes Media Type: Generic Protocol: FireWire SMART Status: Not Supported Volume UUID: 1024D0B8-1C45-3057-B040-AE5C3841DABF Total Size: 499.8 GB (499763888128 Bytes) (exactly 976101344 512-Byte-Blocks) Volume Free Space: 499.3 GB (499315826688 Bytes) (exactly 975226224 512-Byte-Blocks) Device Block Size: 512 Bytes Read-Only Media: No Read-Only Volume: No Ejectable: Yes Whole: No Internal: No I'm a little concerned that the "Partition Type: Apple_HFS" entry is causing the problem, but I don't know how to change that. I only seem to be able to control the "File System Personality: Journaled HFS+" in Disk Utility. Can anyone shed some light on this for me?

  Read the article

• "Windows detected a hard drive" issue in Windows 7 x64

  - by Jasiu

  I upgraded to the OCZ-Agility3 120GB from a 60 OCZ Vertex2 SSD. I cloned the drive from the Vertex to the new Agility. Everything seemed to have gone well and have not had any problems. Recently in the passed month I have gotten this error: I downloaded teh OCZToolboxMP and ran the SMART utility and don't see anything wrong: SMART READ DATA ModelNumber : OCZ-AGILITY3 Serial Number : OCZ-Y1945X77438P4NU6 WWN : 5-e8-3a-97 ebea5ba76 Revision: 10 Attributes List 1: SSD Raw Read Error Rate Normalized Rate: 70 total ECC and RAISE errors 5: SSD Retired Block Count Reserve blocks remaining: 100% 9: SSD Power-On Hours Total hours power on: 968 12: SSD Power Cycle Count Count of power on/off cycles: 28 171: SSD Program Fail Count Total number of Flash program operation failures: 0 172: SSD Erase Fail Count Total number of Flash erase operation failures: 0 174: SSD Unexpected power loss count Total number of unexpected power loss: 11 177: SSD Wear Range Delta Delta between most-worn and least-worn Flash blocks: 0 181: SSD Program Fail Count Total number of Flash program operation failures: 0 182: SSD Erase Fail Count Total number of Flash erase operation failures: 0 187: SSD Reported Uncorrectable Errors Uncorrectable RAISE errors reported to the host for all data access: 4145 194: SSD Temperature Monitoring Current: 30 High: 30 Low: 30 195: SSD ECC On-the-fly Count Normalized Rate: 120 196: SSD Reallocation Event Count Total number of reallocated Flash blocks: 100 201: SSD Uncorrectable Soft Read Error Rate Normalized Rate: 120 204: SSD Soft ECC Correction Rate (RAISE) Normalized Rate: 120 230: SSD Life Curve Status Current state of drive operation based upon the Life Curve: 100 231: SSD Life Left Approximate SDD life Remaining: 100% 241: SSD Lifetime writes from host lifetime writes 893 GB 242: SSD Lifetime reads from host lifetime reads 968 GB Does anyone have any ideas of what might be wrong and or how I can go about fixing this? Please let me know if there is other information I can provide. Thanks for your help Windows 7 x64 SP1 AMD Phenom II X4 940 8GB RAM

  Read the article

• Finding all IP ranges blelonging to a specific ISP

  - by Jim Jim

  I'm having an issue with a certain individual who keeps scraping my site in an aggressive manner; wasting bandwidth and CPU resources. I've already implemented a system which tails my web server access logs, adds each new IP to a database, keeps track of the number of requests made from that IP, and then, if the same IP goes over a certain threshold of requests within a certain time period, it's blocked via iptables. It may sound elaborate, but as far as I know, there exists no pre-made solution designed to limit a certain IP to a certain amount of bandwidth/requests. This works fine for most crawlers, but an extremely persistent individual is getting a new IP from his/her ISP pool each time they're blocked. I would like to block the ISP entirely, but don't know how to go about it. Doing a whois on a few sample IPs, I can see that they all share the same "netname", "mnt-by", and "origin/AS". Is there a way I can query the ARIN/RIPE database for all subnets using the same mnt-by/AS/netname? If not, how else could I go about getting every IP belonging to this ISP? Thanks.

  Read the article

• How to diagnose frequent segfaults

  - by Andreas Gohr

  My server is logging frequent segmentation faults to /var/log/kern.log in different tools. So far I've seen them in Perl, PHP and rsync. All installed software is up-to-date Debian packages. Here's an exerpt from the log file: Mar 2 01:07:54 gaz kernel: [ 5316.246303] imapsync[4533]: segfault at 8b ip 00007fb448c98fe6 sp 00007ffff571dd68 error 4 in libperl.so.5.10.1[7fb448bd7000+164000] Mar 2 01:17:42 gaz kernel: [ 5904.354307] php5-cgi[4441]: segfault at 2bb3dc8 ip 0000000002bb3dc8 sp 00007fffbeeaae48 error 15 Mar 2 02:54:05 gaz kernel: [11687.922316] php5-cgi[4495]: segfault at 2d7acf9 ip 0000000002d7acf9 sp 00007fff60c6eb18 error 15 Mar 2 10:50:08 gaz kernel: [40250.390322] BUG: unable to handle kernel paging request at 00000000024b03f0 Mar 2 10:50:08 gaz kernel: [40250.390341] IP: [<00000000024b03f0>] 0x24b03f0 Mar 2 10:50:08 gaz kernel: [40250.390353] PGD 208c71067 PUD 21c811067 PMD 209329067 PTE 8000000211c88067 Mar 2 10:50:08 gaz kernel: [40250.390365] Oops: 0011 [#1] SMP Mar 2 10:50:08 gaz kernel: [40250.390373] last sysfs file: /sys/devices/pci0000:00/0000:00:12.0/host4/target4:0:0/4:0:0:0/block/sdb/stat Mar 2 10:50:08 gaz kernel: [40250.390386] CPU 1 Mar 2 10:50:08 gaz kernel: [40250.390392] Modules linked in: cpufreq_userspace cpufreq_stats cpufreq_powersave cpufreq_conservative xt_recent xt_tcpudp iptable_nat nf_nat nf_conntrack_ipv4 nf_defrag_ ipv4 ip6table_filter ip6_tables xt_DSCP xt_TCPMSS ipt_LOG ipt_REJECT iptable_mangle iptable_filter xt_multiport xt_state xt_limit xt_conntrack nf_conntrack_ftp nf_conntrack ip_tables x_tables loop snd _hda_codec_atihdmi snd_hda_intel snd_hda_codec snd_hwdep snd_pcm radeon snd_timer ttm snd drm_kms_helper soundcore drm snd_page_alloc i2c_algo_bit shpchp i2c_piix4 edac_core pcspkr k8temp evdev edac_m ce_amd pci_hotplug i2c_core button ext3 jbd mbcache dm_mod powernow_k8 aacraid 3w_9xxx 3w_xxxx raid10 raid456 async_raid6_recov async_pq raid6_pq async_xor xor async_memcpy async_tx raid1 raid0 md_mod sata_nv sata_sil sata_via sd_mod crc_t10dif ata_generic ahci pata_atiixp ohci_hcd libata r8169 mii thermal ehci_hcd processor thermal_sys scsi_mod usbcore nls_base [last unloaded: scsi_wait_scan] Mar 2 10:50:08 gaz kernel: [40250.390566] Pid: 11482, comm: munin-limits Not tainted 2.6.32-5-amd64 #1 MS-7368 Mar 2 10:50:08 gaz kernel: [40250.390576] RIP: 0010:[<00000000024b03f0>] [<00000000024b03f0>] 0x24b03f0 Mar 2 10:50:08 gaz kernel: [40250.390586] RSP: 0018:ffff88021cc8dec0 EFLAGS: 00010286 Mar 2 10:50:08 gaz kernel: [40250.390593] RAX: 000000001ddc1000 RBX: 0000000000000010 RCX: ffffffff810f9904 Mar 2 10:50:08 gaz kernel: [40250.390600] RDX: 0000000000000000 RSI: ffffea0007688200 RDI: 0000000000000286 Mar 2 10:50:08 gaz kernel: [40250.390608] RBP: 00000000ffffffea R08: 0000000000000025 R09: 7865542f30312e35 Mar 2 10:50:08 gaz kernel: [40250.390615] R10: 000000d01cc8ddf8 R11: 0000000000000246 R12: ffff88021cc8def8 Mar 2 10:50:08 gaz kernel: [40250.390622] R13: 0000000002295010 R14: 00000000022c9db0 R15: 0000000002488d78 Mar 2 10:50:08 gaz kernel: [40250.390630] FS: 00007f3b3c8b2700(0000) GS:ffff880008d00000(0000) knlGS:0000000000000000 Mar 2 10:50:08 gaz kernel: [40250.390641] CS: 0010 DS: 0000 ES: 0000 CR0: 0000000080050033 Mar 2 10:50:08 gaz kernel: [40250.390648] CR2: 00000000024b03f0 CR3: 000000021c5d1000 CR4: 00000000000006e0 Mar 2 10:50:08 gaz kernel: [40250.390656] DR0: 0000000000000000 DR1: 0000000000000000 DR2: 0000000000000000 Mar 2 10:50:08 gaz kernel: [40250.390663] DR3: 0000000000000000 DR6: 00000000ffff0ff0 DR7: 0000000000000400 Mar 2 10:50:08 gaz kernel: [40250.390671] Process munin-limits (pid: 11482, threadinfo ffff88021cc8c000, task ffff88021bf59530) Mar 2 10:50:08 gaz kernel: [40250.390681] Stack: Mar 2 10:50:08 gaz kernel: [40250.390687] ffffffff810f1d4a ffff880208c63228 0000000000000000 00007fffc2dcecc0 Mar 2 10:50:08 gaz kernel: [40250.390697] <0> 00000000024ba2b0 0000000002295010 ffffffff810f1e3d 0000000000000004 Mar 2 10:50:08 gaz kernel: [40250.390712] <0> ffff88021bf59530 ffff88021c4edc00 ffffffff812fe0b6 ffff88021c4edc60 Mar 2 10:50:08 gaz kernel: [40250.390732] Call Trace: Mar 2 10:50:08 gaz kernel: [40250.390742] [<ffffffff810f1d4a>] ? vfs_fstatat+0x2c/0x57 Mar 2 10:50:08 gaz kernel: [40250.390750] [<ffffffff810f1e3d>] ? sys_newstat+0x11/0x30 Mar 2 10:50:08 gaz kernel: [40250.390760] [<ffffffff812fe0b6>] ? do_page_fault+0x2e0/0x2fc Mar 2 10:50:08 gaz kernel: [40250.390768] [<ffffffff812fbf55>] ? page_fault+0x25/0x30 Mar 2 10:50:08 gaz kernel: [40250.390777] [<ffffffff81010b42>] ? system_call_fastpath+0x16/0x1b Mar 2 10:50:08 gaz kernel: [40250.390783] Code: Bad RIP value. Mar 2 10:50:08 gaz kernel: [40250.390791] RIP [<00000000024b03f0>] 0x24b03f0 Mar 2 10:50:08 gaz kernel: [40250.390799] RSP <ffff88021cc8dec0> Mar 2 10:50:08 gaz kernel: [40250.390805] CR2: 00000000024b03f0 Mar 2 10:50:08 gaz kernel: [40250.391051] ---[ end trace 1cc1473b539c7f6e ]--- Mar 2 11:42:20 gaz kernel: [43382.242301] php5-cgi[10963]: segfault at d81160 ip 0000000000d81160 sp 00007fff3adcb058 error 15 Mar 2 21:51:14 gaz kernel: [79916.418302] php5-cgi[20089]: segfault at 1c59dc8 ip 0000000001c59dc8 sp 00007fff9b877fb8 error 15 Mar 3 03:45:01 gaz kernel: [101143.334305] munin-update[22519] general protection ip:7f516dce204c sp:7fff6049a978 error:0 in libperl.so.5.10.1[7f516dc7d000+164000] Mar 3 11:22:37 gaz kernel: [128599.570307] php5-cgi[22888]: segfault at 36485a8 ip 00000000036485a8 sp 00007fff2d56e1c8 error 15 Mar 4 08:32:17 gaz kernel: [204779.842304] php5-cgi[22090]: segfault at 18 ip 0000000000689e5e sp 00007fff677a6a48 error 6 in php5-cgi[400000+6f9000] Mar 4 10:01:02 gaz kernel: [210104.434706] rsync[22236] general protection ip:7f14a07137f9 sp:7fff88f940b8 error:0 in libc-2.11.2.so[7f14a069d000+158000] Mar 4 11:32:22 gaz kernel: [215584.262316] BUG: unable to handle kernel paging request at 00000000ffffff9c Mar 4 11:32:22 gaz kernel: [215584.262331] IP: [<00000000ffffff9c>] 0xffffff9c Mar 4 11:32:22 gaz kernel: [215584.262343] PGD 0 Mar 4 11:32:22 gaz kernel: [215584.262350] Oops: 0010 [#2] SMP Mar 4 11:32:22 gaz kernel: [215584.262359] last sysfs file: /sys/devices/pci0000:00/0000:00:12.0/host4/target4:0:0/4:0:0:0/block/sdb/stat Mar 4 11:32:22 gaz kernel: [215584.262371] CPU 1 Mar 4 11:32:22 gaz kernel: [215584.262378] Modules linked in: cpufreq_userspace cpufreq_stats cpufreq_powersave cpufreq_conservative xt_recent xt_tcpudp iptable_nat nf_nat nf_conntrack_ipv4 nf_defrag_ipv4 ip6table_filter ip6_tables xt_DSCP xt_TCPMSS ipt_LOG ipt_REJECT iptable_mangle iptable_filter xt_multiport xt_state xt_limit xt_conntrack nf_conntrack_ftp nf_conntrack ip_tables x_tables loop snd_hda_codec_atihdmi snd_hda_intel snd_hda_codec snd_hwdep snd_pcm radeon snd_timer ttm snd drm_kms_helper soundcore drm snd_page_alloc i2c_algo_bit shpchp i2c_piix4 edac_core pcspkr k8temp evdev edac_mce_amd pci_hotplug i2c_core button ext3 jbd mbcache dm_mod powernow_k8 aacraid 3w_9xxx 3w_xxxx raid10 raid456 async_raid6_recov async_pq raid6_pq async_xor xor async_memcpy async_tx raid1 raid0 md_mod sata_nv sata_sil sata_via sd_mod crc_t10dif ata_generic ahci pata_atiixp ohci_hcd libata r8169 mii thermal ehci_hcd processor thermal_sys scsi_mod usbcore nls_base [last unloaded: scsi_wait_scan] Mar 4 11:32:22 gaz kernel: [215584.262552] Pid: 1960, comm: proxymap Tainted: G D 2.6.32-5-amd64 #1 MS-7368 Mar 4 11:32:22 gaz kernel: [215584.262563] RIP: 0010:[<00000000ffffff9c>] [<00000000ffffff9c>] 0xffffff9c Mar 4 11:32:22 gaz kernel: [215584.262573] RSP: 0018:ffff880209257e00 EFLAGS: 00010212 Mar 4 11:32:22 gaz kernel: [215584.262580] RAX: ffff8801514eb780 RBX: ffffffff810efb2d RCX: 0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262590] RDX: 0000000000000020 RSI: 0000000000000001 RDI: ffff8801514eb780 Mar 4 11:32:22 gaz kernel: [215584.262600] RBP: 00000000ffffffe9 R08: 0000000000000000 R09: 0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262611] R10: ffff880209257e78 R11: ffffffff81152c7c R12: 0000000000000001 Mar 4 11:32:22 gaz kernel: [215584.262622] R13: 0000000000008001 R14: 0000000000000024 R15: 00000000ffffff9c Mar 4 11:32:22 gaz kernel: [215584.262633] FS: 00007fca4de35700(0000) GS:ffff880008d00000(0000) knlGS:0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262644] CS: 0010 DS: 0000 ES: 0000 CR0: 0000000080050033 Mar 4 11:32:22 gaz kernel: [215584.262650] CR2: 00000000ffffff9c CR3: 00000001c9cbb000 CR4: 00000000000006e0 Mar 4 11:32:22 gaz kernel: [215584.262661] DR0: 0000000000000000 DR1: 0000000000000000 DR2: 0000000000000000 Mar 4 11:32:22 gaz kernel: [215584.262671] DR3: 0000000000000000 DR6: 00000000ffff0ff0 DR7: 0000000000000400 Mar 4 11:32:22 gaz kernel: [215584.262682] Process proxymap (pid: 1960, threadinfo ffff880209256000, task ffff88021c4b1c40) Mar 4 11:32:22 gaz kernel: [215584.262693] Stack: Mar 4 11:32:22 gaz kernel: [215584.262698] ffffffff810f8566 ffff880209257e78 ffff88021c7bf000 ffff88021c7bf0c8 Mar 4 11:32:22 gaz kernel: [215584.262709] <0> 0000800000000000 ffff88021fc0f000 ffff880209257e78 00000000fffffffe Mar 4 11:32:22 gaz kernel: [215584.262724] <0> ffffffff810e5881 ffff880209257f48 0000000000000286 ffff88021fc0f000 Mar 4 11:32:22 gaz kernel: [215584.262743] Call Trace: Mar 4 11:32:22 gaz kernel: [215584.262753] [<ffffffff810f8566>] ? do_filp_open+0xa7/0x94b Mar 4 11:32:22 gaz kernel: [215584.262763] [<ffffffff810e5881>] ? virt_to_head_page+0x9/0x2a Mar 4 11:32:22 gaz kernel: [215584.262771] [<ffffffff810f9904>] ? user_path_at+0x52/0x79 Mar 4 11:32:22 gaz kernel: [215584.262779] [<ffffffff810cfec1>] ? get_unmapped_area+0xd7/0x139 Mar 4 11:32:22 gaz kernel: [215584.262787] [<ffffffff811019d5>] ? alloc_fd+0x67/0x10c Mar 4 11:32:22 gaz kernel: [215584.262795] [<ffffffff810eceaf>] ? do_sys_open+0x55/0xfc Mar 4 11:32:22 gaz kernel: [215584.262804] [<ffffffff81010b42>] ? system_call_fastpath+0x16/0x1b Mar 4 11:32:22 gaz kernel: [215584.262811] Code: Bad RIP value. Mar 4 11:32:22 gaz kernel: [215584.262819] RIP [<00000000ffffff9c>] 0xffffff9c Mar 4 11:32:22 gaz kernel: [215584.262828] RSP <ffff880209257e00> Mar 4 11:32:22 gaz kernel: [215584.262833] CR2: 00000000ffffff9c Mar 4 11:32:22 gaz kernel: [215584.263077] ---[ end trace 1cc1473b539c7f6f ]--- As you can see there are segfaults, a general protection fault and a Kernel Oops. My first guess was that there's a Hardware problem of some sort and I asked my Hoster (it's a rented root server) to do a full hardwarecheck - they did, but couldn't find any problem. I don't know what and how they checked but their support team is usually quite good. I ran memtester and cpuburn myself and couldn't find any error either. Unfortunately I have no reliable way to reproduce these segfaults, they seem to be more or less random. On a hunch I disabled the firewall of the system and ran one of the programs that segfaulted regularily (imapsync) and it seemed to take longer to segfault than before, so the problem might be related to the network stack. Or could just be a random thing. Here are the kernel specs: # uname -a Linux gaz 2.6.32-5-amd64 #1 SMP Wed Jan 12 03:40:32 UTC 2011 x86_64 GNU/Linux # cat /etc/debian_version 6.0 # lsmod Module Size Used by cpufreq_userspace 1992 0 cpufreq_stats 2659 0 cpufreq_powersave 902 0 cpufreq_conservative 5162 0 xt_recent 5977 0 xt_tcpudp 2319 0 iptable_nat 4299 0 nf_nat 13388 1 iptable_nat nf_conntrack_ipv4 9833 3 iptable_nat,nf_nat nf_defrag_ipv4 1139 1 nf_conntrack_ipv4 ip6table_filter 2384 0 ip6_tables 15075 1 ip6table_filter xt_DSCP 1995 0 xt_TCPMSS 2919 0 ipt_LOG 4518 0 ipt_REJECT 1953 0 iptable_mangle 2817 0 iptable_filter 2258 0 xt_multiport 2267 0 xt_state 1303 0 xt_limit 1782 0 xt_conntrack 2407 0 nf_conntrack_ftp 5537 0 nf_conntrack 46535 6 iptable_nat,nf_nat,nf_conntrack_ipv4,xt_state,xt_conntrack,nf_conntrack_ftp ip_tables 13899 3 iptable_nat,iptable_mangle,iptable_filter x_tables 12845 13 xt_recent,xt_tcpudp,iptable_nat,ip6_tables,xt_DSCP,xt_TCPMSS,ipt_LOG,ipt_REJECT,xt_multiport,xt_state,xt_limit,xt_conntrack,ip_tables loop 11799 0 radeon 573996 0 ttm 39986 1 radeon drm_kms_helper 20065 1 radeon snd_hda_codec_atihdmi 2251 1 drm 142359 3 radeon,ttm,drm_kms_helper snd_hda_intel 20019 0 i2c_algo_bit 4225 1 radeon pcspkr 1699 0 i2c_piix4 8328 0 snd_hda_codec 54244 2 snd_hda_codec_atihdmi,snd_hda_intel i2c_core 15712 5 radeon,drm_kms_helper,drm,i2c_algo_bit,i2c_piix4 snd_hwdep 5380 1 snd_hda_codec snd_pcm 60503 2 snd_hda_intel,snd_hda_codec snd_timer 15582 1 snd_pcm snd 46446 5 snd_hda_intel,snd_hda_codec,snd_hwdep,snd_pcm,snd_timer soundcore 4598 1 snd evdev 7352 3 snd_page_alloc 6249 2 snd_hda_intel,snd_pcm k8temp 3283 0 edac_core 29261 0 edac_mce_amd 6433 0 shpchp 26264 0 pci_hotplug 21203 1 shpchp button 4650 0 ext3 106518 2 jbd 37085 1 ext3 mbcache 5050 1 ext3 dm_mod 53754 0 powernow_k8 10978 1 aacraid 59779 0 3w_9xxx 28684 0 3w_xxxx 20569 0 raid10 17809 0 raid456 44500 0 async_raid6_recov 5170 1 raid456 async_pq 3479 2 raid456,async_raid6_recov raid6_pq 77179 2 async_raid6_recov,async_pq async_xor 2478 3 raid456,async_raid6_recov,async_pq xor 4380 1 async_xor async_memcpy 1198 2 raid456,async_raid6_recov async_tx 1734 5 raid456,async_raid6_recov,async_pq,async_xor,async_memcpy raid1 18431 3 raid0 5517 0 md_mod 73824 7 raid10,raid456,raid1,raid0 sata_nv 19166 0 sata_sil 7412 0 sata_via 7928 0 sd_mod 29889 8 crc_t10dif 1276 1 sd_mod ata_generic 3047 0 ahci 32374 6 r8169 29229 0 mii 3210 1 r8169 thermal 11674 0 pata_atiixp 3489 0 libata 133632 6 sata_nv,sata_sil,sata_via,ata_generic,ahci,pata_atiixp ohci_hcd 19212 0 ehci_hcd 31151 0 processor 29935 1 powernow_k8 thermal_sys 11942 2 thermal,processor scsi_mod 122149 5 aacraid,3w_9xxx,3w_xxxx,sd_mod,libata usbcore 122034 3 ohci_hcd,ehci_hcd nls_base 6377 1 usbcore # free total used free shared buffers cached Mem: 8166128 1228036 6938092 0 140412 782060 -/+ buffers/cache: 305564 7860564 Swap: 2102456 0 2102456 So, basically my questions are: How can I diagnose this further? Is there any data in the log above that could help me to isolate the troublemaker? Are there any known problems with the above hardware/software I overlooked when googling for it? Is there a way to prevent the kernel from autoloading modules (I probably don't need all these modules and one of them might be the culprit)

  Read the article

• I get a 502 bad gateway ONLY with a specific combination of domain/root folders - NGINX

  - by Patrick De Amorim

  I have a VPS running NGINX and virtual hosts, with a configuration such as this: Domains directing to it: lolpics.no smscloud.no idmag.no Root folders: /home/vds/www/lolpics /home/vds/www/smscloud /home/vds/www/idmag SMSCloud.no is the site that keeps getting 502 errors, but if I make the domain direct to any of the other folders, the site works, or if I make any other domain name direct to the /home/vds/www/smscloud folder, it works. Only smscloud.no with /home/vds/www/smscloud breaks I tried putting this between the http{} in my nginx.conf and no help: proxy_buffer_size 128k; proxy_buffers 4 256k; proxy_busy_buffers_size 256k; EDIT: Well, that was slightly silly, if anyone from Google stumbles on this, here's how I fixed it, I just added this to the http{}: fastcgi_buffer_size 16k; fastcgi_buffers 16 16k; So that the start of my http block is: http { include /etc/nginx/mime.types; proxy_buffer_size 128k; proxy_buffers 4 256k; proxy_busy_buffers_size 256k; fastcgi_buffer_size 16k; fastcgi_buffers 16 16k;

  Read the article

• Slow VM on esxi 4.1

  - by user57432

  We have a FreeBSD 64bit running on a esxi 4.1, the hardware platform is a DELL R710 with 2 x 56xx (intel 6core cpu) and 48 GB ram. The FreeBSD vm is very slow, when we compiles/builds something on it, it takes 5 minuts and it says "build time 18 seconds.". There's no vmtools installed on the vm. The same vm is installaed on another R710 running esxi 4.0 for dell and there's no problems with that one. Does anyone have any idea about what to look for? the VMs on the second server (ESXi 4.1) is a clone of the VMs running on the first VMserver (ESXi 4.0 Dell edition). It's not possible for me to move the VM back to the first server since the file contaning the vm is too big. We installed the new esxi with a datasore with 8mb blocks because 1mb blocks dident allow for the file size we needed. It looks like the www server on the new ESXi 4.1 works fine, but I havent really tested it. There's not installed vmtools on any of the VMs (FreeBSD). The block size on the second VM (ESXi 4.1) datastorage is 8mb and 1mb on the first (ESXi 4.0)

  Read the article

• How to get the permissions right for /dev/raw1394

  - by Mark0978

  I recently upgraded one of my ubuntu machines to Karmic and I'm having trouble getting the permissions of /dev/raw1394 set to 0666. They only thing this machine is used for is recording audio from a firepod which uses /dev/raw1394 via jackd and there are no other FireWire devices connected, so security around this device is not really an issue. If I run as root, everything works as expected, but I have some folks that run the recorder that I don't want to have root access. However, I can't figure out which lines setup the perms I've tied this: /etc/udev/permissions.d/raw1394.rules:raw1394:root:root:0666 And I have this setup (default install) /lib/udev/rules.d/75-persistent-net-generator.rules:SUBSYSTEMS=="ieee1394", ENV{COMMENT}="Firewire device $attr{host_id})" /lib/udev/rules.d/75-cd-aliases-generator.rules:# the "path" of usb/ieee1394 devices changes frequently, use "id" /lib/udev/rules.d/75-cd-aliases-generator.rules:ACTION=="add", SUBSYSTEM=="block", SUBSYSTEMS=="usb|ieee1394", ENV{ID_CDROM}=="?*", ENV{GENERATED}!="?*", \ /lib/udev/rules.d/60-persistent-storage-tape.rules:KERNEL=="st*[0-9]|nst*[0-9]", ATTRS{ieee1394_id}=="?*", ENV{ID_SERIAL}="$attr{ieee1394_id}", ENV{ID_BUS}="ieee1394" /lib/udev/rules.d/50-udev-default.rules:# FireWire (deprecated dv1394 and video1394 drivers) /lib/udev/rules.d/50-udev-default.rules:KERNEL=="dv1394-[0-9]*", NAME="dv1394/%n", GROUP="video" /lib/udev/rules.d/50-udev-default.rules:KERNEL=="video1394-[0-9]*", NAME="video1394/%n", GROUP="video" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[!0-9]|sr*", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[0-9]", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}-part%n" And I find these lines in /var/log/syslog Apr 30 09:11:30 record kernel: [ 3.284010] ieee1394: Node added: ID:BUS[0-00:1023] GUID[000a9200c7062266] Apr 30 09:11:30 record kernel: [ 3.284195] ieee1394: Host added: ID:BUS[0-01:1023] GUID[00d0035600a97b9f] Apr 30 09:11:30 record kernel: [ 18.372791] ieee1394: raw1394: /dev/raw1394 device initialized What I can't figure out, is which line actually creates that raw1394 device in the first place. How do you get /dev/raw1394 to have permissions 0666?

  Read the article

• Solaris 10 invalid ARP requests from 0.0.0.0?

  - by JWD

  The guys at the data center where I'm hosting a server running Solaris 10 are telling me that my server is making a lot of invalid arp requests. This is an example of a portion of what was sent to me from the logs (with Mac addresses and IP addresses changed). xxxx:xxxx:xxxx/0.0.0.0/0000.0000.0000/[myipaddress]/[Datestamp]) I don't see anything in the arp tables (arp -a) or routing tables (netstat -r) and I don't see anything relating to 0.0.0.0 when snoping the arp requests. The only place I see any reference to 0.0.0.0 is if I do netstat -a for the SCTP SCTP: Local Address Remote Address Swind Send-Q Rwind Recv-Q StrsI/O State ------------------------------- ------------------------------- ------ ------ ------ ------ ------- ----------- 0.0.0.0 0.0.0.0 0 0 102400 0 32/32 CLOSED But not really sure what that means. Doesn't seem like I can disable SCTP. Does anyone have any idea what might be causing this and how to stop it? I think the switch I'm connected to doesn't like it and momentarily drops the connection. Is there anyway to at least block those requests using ipfilter or something else?

  Read the article

• When using procmail with maildir, it returns error with code I found

  - by bradlis7

  I'm not an expert at procmail, but I have this code: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user, sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Thanks for the help.

  Read the article

• Time drift in Cloud Server - need to mainpulate GRUB config

  - by Aditya Advani

  We are hosting a VPS on a popular host and are experiencing a regular time drift of several minutes a day forward (approx 7). Linux Kernel: 2.6.18-164.11.1.el5 GNU/Linux Distro: CentOS release 5.4 (Final) We reached out to our hosting provider and their support advised us " This is a known issue with Cloud Servers. To fix this you will need to add one line to your grub config located at: /boot/grub/menu.lst The line you need to add is: noapic nolapic divider=10 nolapic_timer This should correct this issue. You will need to restart after this is added in. " Because I am wary of manipulating grub, mostly I'm terrified that our server may fail to restart - I ask you guys, the pro *nix admins - where exactly in this file does the recommended insertion below: # line from 1&1 for time syncing issue (Case 5163) noapic nolapic divider=10 nolapic_timer go? Please specify where exactly, and whether the order of commands is or is not important. Why is the block below "title CentOS ..." indented? If someone could give me an overview of how this works or point me to a resource that's easy to follow, that's what I'm looking for immediately, a light overview or basic understanding of what I;m doing. If GRUB and bootloaders are a deep dark treasure trove of kernel hacking or something, that's great well-recommended in-depth resources are also very welcome. This is my current /boot/grub/menu.lst # grub.conf generated by anaconda # # Note that you do not have to rerun grub after making changes to this file #boot=/dev/sda # serial --unit=0 --speed=57600 terminal --timeout=5 serial console timeout=5 title CentOS (2.6.18-164.11.1.el5) root (hd0,0) kernel /boot/vmlinuz-2.6.18-164.11.1.el5 ro root=/dev/hda1 console=tty0 console=tty initrd /boot/initrd-2.6.18-164.11.1.el5.img MOST IMPORTANT: I need to know where in the file above it is appropriate to paste the suggested line so I can confidently restart my VPS after manipulating GRUB config

  Read the article

• MS SQL Server slows down over time?

  - by Dave Holland

  Have any of you experienced the following, and have you found a solution: A large part of our website's back-end is MS SQL Server 2005. Every week or two weeks the site begins running slower - and I see queries taking longer and longer to complete in SQL. I have a query that I like to use: USE master select text,wait_time,blocking_session_id AS "Block", percent_complete, * from sys.dm_exec_requests CROSS APPLY sys.dm_exec_sql_text(sql_handle) AS s2 order by start_time asc Which is fairly useful... it gives a snapshot of everything that's running right at that moment against your SQL server. What's nice is that even if your CPU is pegged at 100% for some reason and Activity Monitor is refusing to load (I'm sure some of you have been there) this query still returns and you can see what query is killing your DB. When I run this, or Activity Monitor during the times that SQL has begun to slow down I don't see any specific queries causing the issue - they are ALL running slower across the board. If I restart the MS SQL Service then everything is fine, it speeds right up - for a week or two until it happens again. Nothing that I can think of has changed, but this just started a few months ago... Ideas? --Added Please note that when this database slowdown happens it doesn't matter if we are getting 100K page views an hour (busier time of day) or 10K page views an hour (slow time) the queries all take a longer time to complete than normal. The server isn't really under stress - the CPU isn't high, the disk usage doesn't seem to be out of control... it feels like index fragmentation or something of the sort but that doesn't seem to be the case. As far as pasting results of the query I pasted above I really can't do that. The Query above lists the login of the user performing the task, the entire query, etc etc.. and I'd really not like to hand out the names of my databases, tables, columns and the logins online :)... I can tell you that the queries running at that time are normal, standard queries for our site that run all the time, nothing out of the norm.

  Read the article

• Adding Static IP's to the NIC

  - by Brett Powell

  We are currently working on migrating a lot of new machines to our network, and my job this morning was to setup all of the IP Addresses. I worked on this all morning, and when I got back tonight I was informed that they had all been setup incorrectly, and had to be removed and re-added. I am quite confused as I have been setting up IP's on machines for a long time and I am curious as to what the issue is. Just taking into account this example... 72.26.196.160/29 255.255.255.248 A /29 block is 5 usable IP's. With the script I wrote and used, the IP Addresses .162 - .166 were added to the NIC. I can't remember now what the name for .161 was, but isn't it the broadcast address or something which isn't assigned to the NIC when adding additional IP Blocks? I am curious as to where my logic is failing me. Not to mention even if .161 was to be added, there is no reason why all of the IPs would have to be removed, as .161 could just be added in addition to these.

  Read the article

• iSCSI, failover and XenServer

  - by jemmille

  I have an iSCSI fail over implementation setup so if one of my storage units fails the other takes over immediately (it also runs the NFS shares). When fail over occurs, volumes are exported, the IP is switched to the other machine and the targets are reconfigured. The fail over of the storage system itself works just fine. I use NexentaStor for my filer. When I do a test (manual) fail over of my storage the following occurs: Note: I run the admin VM's on NFS and customer based VM's on iSCSI All NFS based VM's remain up and working perfectly through the failover and after All VM 's running on iSCSI eventually report the following: An error about not being able to write to a particular block An error about journaling not working Then the file system goes RO To get the VM's working again I have to do the following: Force shutdown of the "broken" VM's. Detach the iSCSI SR Re-attach the iSCSI SR Boot the VM on a different server (5 in my pool) If I don't boot on a different server I get this error "Internal error: Failure("The VDI <uuid&gt; is already attached in RW mode; it can't be attached in RO mode!")" The only way I have found to fix that error is to reboot the entire server it was running on previously which is obviously a huge pain. Currently multipathing is NOT enabled (but can be and the same thing still occurs). I have edited much of the /etc/iscsid.conf file to work with the timeout settings but to no avail. In short, my storage fails over properly but XenServer does not keep the connection alive. As a thought, the error that shows up in #4 above might be the ultimate cause and fixing that would fix everything? Any help would be appreciated more than you know.

  Read the article

• Identifying mail account used in CRAM-MD5 transaction

  - by ManiacZX

  I suppose this is one of those where the tool for identifying the problem is also the tool used for taking advantage of it. I have a mail server that I am seeing emails that spam is being sent through it. It is not an open relay, the messages in question are being sent by someone authenticating to the smtp with CRAM-MD5. However, the logs only capture the actual data passed, which has been hashed so I cannot see what user account is being used. My suspicion is a simple username/password combo or a user account's password has otherwise been compromised, but I cannot do much about it without knowing what user it is. Of course I can block the IP that is doing it, but that doesn't fix the real problem. I have both the CRAM-MD5 Base64 challenge string and the hashed client auth string containing the username, password and challenge string. I am looking for a way to either reverse this (which I haven't been able to find any information on) or otherwise I suppose I need a dictionary attack tool designed for CRAM-MD5 to run through two lists, one for username and one for password and the constant of the challenge string until it finds a matching result of the authentication string I have logged. Any information on reversing using the data I have logged, a tool to identify it or any alternative methods you have used for this situation would be greatly appreciated.

  Read the article

• Sticky connection and HTTPS support for HAProxy

  - by Saif

  We have 2 HTTP Load balancer with HAproxy and heartbeat. There are 4 apache nodes in this cluster. It's doing round robin load balancing. The HTTP cluster working fine. We are having problem with our portal because it uses SSO. We need sticky connection support in our HAproxy. Also we need load balancing for HTTPS traffic. Here's our HAproxy conf file. global # to have these messages end up in /var/log/haproxy.log you will # need to: # # 1) configure syslog to accept network log events. This is done # by adding the '-r' option to the SYSLOGD_OPTIONS in # /etc/sysconfig/syslog # # 2) configure local2 events to go to the /var/log/haproxy.log # file. A line like the following can be added to # /etc/sysconfig/syslog # # local2.* /var/log/haproxy.log # log 127.0.0.1 local0 log 127.0.0.1 local1 notice chroot /var/lib/haproxy pidfile /var/run/haproxy.pid maxconn 4000 user haproxy group haproxy daemon # turn on stats unix socket stats socket /var/lib/haproxy/stats #--------------------------------------------------------------------- # common defaults that all the 'listen' and 'backend' sections will # use if not designated in their block #--------------------------------------------------------------------- defaults mode http log global option httplog option dontlognull option http-server-close option forwardfor except 127.0.0.0/8 option redispatch retries 3 timeout http-request 10s timeout queue 1m timeout connect 10s timeout client 1m timeout server 1m timeout http-keep-alive 10s timeout check 10s maxconn 3000 #--------------------------------------------------------------------- # main frontend which proxys to the backends #--------------------------------------------------------------------- frontend main *:5000 acl url_static path_beg -i /static /images /javascript /stylesheets acl url_static path_end -i .jpg .gif .png .css .js use_backend static if url_static default_backend app #--------------------------------------------------------------------- # static backend for serving up images, stylesheets and such #--------------------------------------------------------------------- backend static balance roundrobin server static 127.0.0.1:4331 check #--------------------------------------------------------------------- # round robin balancing between the various backends #--------------------------------------------------------------------- backend app listen ha-http 10.190.1.28:80 mode http stats enable stats auth admin:xxxxxx balance roundrobin cookie JSESSIONID prefix option httpclose option forwardfor option httpchk HEAD /haproxy.txt HTTP/1.0 server apache1 portal-04:80 cookie A check server apache2 im-01:80 cookie B check server apache3 im-02:80 cookie B check server apache4 im-03:80 cookie B check Please advice. Thanks for your help in advance.

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Backing up VMs to a tape drive

  - by Aljoscha Vollmerhaus

  I've got myself one of these fancy tape drives, HP LTO2 with 200/400 GB cartridges. The st driver reports it like this: scsi 1:0:0:0: Sequential-Access HP Ultrium 2-SCSI T65D I can store and retrieve files like a charm using tar, both tar cf /dev/st0 somedirectory and tar xf /dev/st0 work flawless. However, what I really would like to backup are LVM LVs. They contain entire virtual machines with varying partition layouts, so using mount and tar is not an option. I've tried using something like dd if=/dev/VG/LV bs=64k of=/dev/st0 to achieve this, but there seem to be various problems associated with this approach. Firstly, I would like to be able to store more than 1 LV on a single tape. Now I guess I could seek to concatenate the data on the tape, but I think this would not work very well in an automated scenario with many different LVs of various sizes. Secondly, I would like to store a small XML file along with the raw data that contains some information about the VM contained in the LV. I could dump everything to a directory and tar it up - not very desirable, I would have to set aside huge amounts of scratch space. Is there an easier way to achieve this? Thirdly, from googling around it seems like it would be wise to use something like mbuffer when writing to the tape, to prevent what wikipedia calls "shoe-shining" the tape. However, I can't get anything useful done with mbuffer. The mbuffer man page suggests this for writing to a tape device: mbuffer -t -m 10M -p 80 -f -o $TAPE So I've tried this: dd if=/dev/VG/LV | mbuffer -t -m 10M -p 80 -f -d 64k -o /dev/st0 Note the added "-d 64k" to account for the 64k block size of the tape. However, reading data back from a tape written in this way never seems to yield any useful results - dd has been running for ages now, and managed to transfer only 361M of data from the tape. What's wrong here?

  Read the article

• Convert HTACCESS mod_rewrite directives to nginx format?

  - by Chris

  I'm brand new to nginx and I am trying to convert the app I wrote over from Apache as I need the ability to serve a lot of clients at once without a lot of overhead! I'm getting the hang of setting up nginx and FastCGI PHP but I can't wrap my head around nginx's rewrite format just yet. I know you have to write some simple script that goes in the server {} block in the nginx config but I'm not yet familiar with the syntax. Could anyone with experience with both Apache and nginx help me convert this to nginx format? Thanks! # ------------------------------------------------------ # # Rewrite from canonical domain (remove www.) # # ------------------------------------------------------ # RewriteCond %{HTTP_HOST} ^www.domain.com RewriteRule (.*) http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # This redirects index.php to / # # ------------------------------------------------------ # RewriteCond %{THE_REQUEST} ^[A-Z]+\ /(index|index\.php)\ HTTP/ RewriteRule ^(index|index\.php)$ http://domain.com/ [R=301,L] # ------------------------------------------------------ # # This rewrites 'directories' to their PHP files, # # fixes trailing-slash issues, and redirects .php # # to 'directory' to avoid duplicate content. # # ------------------------------------------------------ # RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)$ $1.php [L] RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)/$ http://domain.com/$1 [R=301,L] RewriteCond %{THE_REQUEST} ^[A-Z]+\ /[^.]+\.php\ HTTP/ RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^([^.]+)\.php$ http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # If it wasn't redirected previously and is not # # a file on the server, rewrite to image generation # # ------------------------------------------------------ # RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^([a-z0-9_\-@#\ "'\+]+)/?([a-z0-9_\-]+)?(\.png|/)?$ generation/image.php?user=${escapemap:$1}&template=${escapemap:$2} [NC,L]

  Read the article

• client flips between internal and external IP addresses??

  - by jmiller-miramontes

  I have what seems like a not-particularly-complicated home network, all things considered: a DSL line comes in to a modem/router, which goes off to a switch, which supports a bunch of machines. My machines live in a 192.168.0.x address space; however, I'm running some public servers on the network, so I have a block of 8 (5, really) static IP addresses that are mapped to the servers by the router. The non-servers get 192.168.0.x addresses via NAT; some machines have static addresses and some get addresses from DHCP. Locally, I'm running a DNS server (named) to map between the domain names and the 192.168 address space. Somewhat messy, but everything basically works. Except: One of my local non-server clients occasionally switches from its internal address to its external address. That is, if I check the logs of a website I'm running internally, the hits coming from this client sometimes show up with the internal 192.168 address, and sometimes with the external (216.103...) address. It will flip back and forth for no apparent reason, without my doing anything. This can be a problem in terms of how the clients interact with the way I have some of the clients' SSH systems configured (e.g., allowing access from the internal network but not the external network), but it also Just Seems Wrong. I will confess that I'm kinda skating on the very edge of my networking competence here, but I can't for the life of me figure out what's going on. If it helps, the client in question is running Mac OS X / 10.6; its address is statically assigned, is not one of the five externally-accessible addresses, and gets its DNS from (first) the internal DNS server and (second) my ISP's DNS servers. I can't swear that none of the other NAT clients are also showing this problem; the one I'm dealing with is my everyday machine, so this is where I run into it. Does anybody out there have any advice? This is driving me crazy...

  Read the article

• How can I erase the traces of Folder Redirection from the Default Domain Policy

  - by bruor

  I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

  Read the article

• Chef: nested data bag data to template file returns "can't convert String into Integer"

  - by Dalho Park

  I'm creating simple test recipe with a template and data bag. What I'm trying to do is creating a config file from data bag that has simple nested information, but I receive error "can't convert String into Integer" Here are my setting file 1) recipe/default.rb data1 = data_bag_item( 'mytest', 'qa' )['test'] data2 = data_bag_item( 'mytest', 'qa' ) template "/opt/env/test.cfg" do source "test.erb" action :create_if_missing mode 0664 owner "root" group "root" variables({ :pepe1 = data1['part.name'], :pepe2 = data2['transport.tcp.ip2'] }) end 2)my data bag named "mytest" $knife data bag show mytest qa id: qa test: part.name: L12 transport.tcp.ip: 111.111.111.111 transport.tcp.port: 9199 transport.tcp.ip2: 222.222.222.222 3)template file test.erb part.name=<%= @pepe1 % transport.tcp.binding=<%= @pepe2 % Error reurns when I run chef-client on my server, [2013-06-24T19:50:38+00:00] DEBUG: filtered backtrace of compile error: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in []',/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:inblock in from_file',/var/chef/cache/cookbooks/config_test/recipes/default.rb:12:in from_file' [2013-06-24T19:50:38+00:00] DEBUG: filtered backtrace of compile error: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in[]',/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in block in from_file',/var/chef/cache/cookbooks/config_test/recipes/default.rb:12:infrom_file' [2013-06-24T19:50:38+00:00] DEBUG: backtrace entry for compile error: '/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in `[]'' [2013-06-24T19:50:38+00:00] DEBUG: Line number of compile error: '19' Recipe Compile Error in /var/chef/cache/cookbooks/config_test/recipes/default.rb TypeError can't convert String into Integer Cookbook Trace: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in []' /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:inblock in from_file' /var/chef/cache/cookbooks/config_test/recipes/default.rb:12:in `from_file' Relevant File Content: /var/chef/cache/cookbooks/config_test/recipes/default.rb: 12: template "/opt/env/test.cfg" do 13: source "test.erb" 14: action :create_if_missing 15: mode 0664 16: owner "root" 17: group "root" 18: variables({ 19 :pepe1 = data1['part.name'], 20: :pepe2 = data2['transport.tcp.ip2'] 21: }) 22: end 23: I tried many things and if I comment out "pepe1 = data1['part.name'],", then :pepe2 = data2['transport.tcp.ip2'] works fine. only nested data "part.name" cannot be set to @pepe1. Does anyone knows why I receive the errors? thanks,

  Read the article

< Previous Page | 271 272 273 274 275 276 277 278 279 280 281 282  | Next Page >