Search Results

Search found 8344 results on 334 pages for 'count'.

Page 279/334 | < Previous Page | 275 276 277 278 279 280 281 282 283 284 285 286  | Next Page >

  • NSTableView don't display data

    - by Tomas Svoboda
    HI, I have data in NSMutableArray and I want to display it in NSTableView, but only the number of cols has changed. This use of NSTableView is based on tutorial: http://www.youtube.com/watch?v=5teN5pMf-rs FinalImageBrowser is IBOutlet to NSTableView @implementation AppController NSMutableArray *listData; - (void)awakeFromNib { [FinalImageBrowser setDataSource:self]; } - (IBAction)StartReconstruction:(id)sender { NSMutableArray *ArrayOfFinals = [[NSMutableArray alloc] init]; //Array of list with final images NSString *FinalPicture; NSString *PicNum; int FromLine = [TextFieldFrom intValue]; //read number of start line int ToLine = [TextFieldTo intValue]; //read number of finish line int RecLine; for (RecLine = FromLine; RecLine < ToLine; RecLine++) //reconstruct from line to line { Start(RecLine); //start reconstruction //Create path of final image FinalPicture = @"FIN/final"; PicNum = [NSString stringWithFormat: @"%d", RecLine]; FinalPicture = [FinalPicture stringByAppendingString:PicNum]; FinalPicture = [FinalPicture stringByAppendingString:@".bmp"]; [ArrayOfFinals addObject:FinalPicture]; // add path to array } listData = [[NSMutableArray alloc] init]; [listData autorelease]; [listData addObjectsFromArray:ArrayOfFinals]; [FinalImageBrowser reloadData]; NSBeep(); //make some noise NSImage *fin = [[NSImage alloc] initWithContentsOfFile:FinalPicture]; [FinalImage setImage:fin]; } - (int)numberOfRowsInTableView:(NSTableView *)tv { return [listData count]; } - (id)tableView:(NSTableView *)tv objectValueFromTableColumn:(NSTableColumn *)tableColumn row:(int)row { return (NSString *)[listData objectAtIndex:row]; } @end when the StartReconstruction end the number of cols have changed right, but they're empty. When I debug app, items in listData is rigth. Thanks

    Read the article

  • Adding the sum of numbers using a loop statement

    - by Deonna
    I need serious help dividing the positive numbers and the negative numbers. I am to accumulate the total of the negative values and separately accumulate the total of the positive values. After the loop, you are then to display the sum of the negative values and the sum of the positive values. The data is suppose to look like this: -2.3 -1.9 -1.5 -1.1 -0.7 -0.3 0.1 0.5 0.9 1.3 1.7 2.1 2.5 2.9 Sum of negative values: -7.8 Sum of positive values: 12 So far I have this: int main () { int num, num2, num3, num4, num5, sum, count, sum1; int tempVariable = 0; int numCount = 100; int newlineCount = 0, newlineCount1 = 0; float numCount1 = -2.3; while (numCount <= 150) { cout << numCount << " "; numCount += 2; newlineCount ++; if(newlineCount == 6) { cout<< " " << endl; newlineCount = 0; } } **cout << "" << endl; while (numCount1 <=2.9 ) { cout << numCount1 << " "; numCount1 += 0.4; newlineCount1 ++; } while ( newlineCount1 <= 0 && newlineCount >= -2.3 ); cout << "The sum is " << newlineCount1 << endl;** return 0; }

    Read the article

  • ASP.NET enum dropdownlist validation

    - by Arun Kumar
    I have got a enum public enum TypeDesc { [Description("Please Specify")] PleaseSpecify, Auckland, Wellington, [Description("Palmerston North")] PalmerstonNorth, Christchurch } I am binding this enum to drop down list using the following code on page_Load protected void Page_Load(object sender, EventArgs e) { if (TypeDropDownList.Items.Count == 0) { foreach (TypeDesc newPatient in EnumToDropDown.EnumToList<TypeDesc>()) { TypeDropDownList.Items.Add(EnumToDropDown.GetEnumDescription(newPatient)); } } } public static string GetEnumDescription(Enum value) { FieldInfo fi = value.GetType().GetField(value.ToString()); DescriptionAttribute[] attributes = (DescriptionAttribute[])fi.GetCustomAttributes(typeof(DescriptionAttribute), false); if (attributes != null && attributes.Length > 0) return attributes[0].Description; else return value.ToString(); } public static IEnumerable<T> EnumToList<T>() { Type enumType = typeof(T); // Can't use generic type constraints on value types, // so have to do check like this if (enumType.BaseType != typeof(Enum)) throw new ArgumentException("T must be of type System.Enum"); Array enumValArray = Enum.GetValues(enumType); List<T> enumValList = new List<T>(enumValArray.Length); foreach (int val in enumValArray) { enumValList.Add((T)Enum.Parse(enumType, val.ToString())); } return enumValList; } and my aspx page use the following code to validate <asp:DropDownList ID="TypeDropDownList" runat="server" > </asp:DropDownList> <asp:RequiredFieldValidator ID="TypeRequiredValidator" runat="server" ControlToValidate="TypeDropDownList" ErrorMessage="Please Select a City" Text="<img src='Styles/images/Exclamation.gif' />" ValidationGroup="city"></asp:RequiredFieldValidator> But my validation is accepting "Please Specify" as city name. I want to stop user to submit if the city is not selected.

    Read the article

  • scanf a byte then print it out?

    - by Sarah
    I've searched around to see if I can find this answer but I can't seem to (please let me know if I'm wrong). I am trying to use scanf to read in a byte, an unsigned int and a char in one .c file and I am trying to access this byte in a different .c file and print it out. (I have already checked to make sure I have included all the appropriate parameters everywhere) But I keep getting errors. The warnings are: database.c: In function ‘addCitizen’: database.c:23:2: warning: format ‘%hhu’ expects argument of type ‘int’, but argument 2 has type ‘byte *’ [-Wformat] database.c:24:2: warning: format ‘%u’ expects argument of type ‘unsigned int’, but argument 2 has type ‘int *’ [-Wformat] database.c:25:2: warning: format ‘%c’ expects argument of type ‘int’, but argument 2 has type ‘char *’ [-Wformat] where I'm scanf'ing: // Request loop while (count-- != 0) { while (1){ // Get values from the user int error = scanf ("%79s %hhu %u %c", tname, &tdist, &tyear, &tgender); addCitizen(db, tname, &tdist, &tyear, &tgender); where I'm printing: void addCitizen(Database *db, char *tname, byte *tdist, int *tyear, char *tgender){ //needs to find the right place in memory to put this stuff and then put it there printf("\nName is: %79s\n", tname); printf("District is: %hhu\n", tdist); printf("Year of birth is: %u\n", tyear); printf("Gender is:%c\n", tgender); I'm not sure where I'm going wrong?

    Read the article

  • creating arrays in for loops.... without creating an endless loop that ruins my day!

    - by Peter
    Hey Guys, Im starting with a csv varible of column names. This is then exploded into an array, then counted and tossed into a for loop that is supposed to create another array. Every time I run it, it goes into this endless loop that just hammers away at my browser...until it dies. :( Here is the code.. $columns = 'id, name, phone, blood_type'; <code> $column_array = explode(',',$columns); $column_length = count($column_array); //loop through the column length, create post vars and set default for($i = 0; $i <= $column_length; $i++) { //create the array iSortCol_1 => $column_array[1]... $array[] = 'iSortCol_'.$i = $column_array[0]; } </code> What I would like to get out of all this is a new array that looks like so.. <code> $goal = array( "iSortCol_1" => "id", "iSortCol_2" => "name", "iSortCol_3" => "phone", "iSortCol_4" => "blood_type" ); </code>

    Read the article

  • Help with SQL query (Calculate a ratio between two entitiess)

    - by Mestika
    Hi, I’m going to calculate a ratio between two entities but are having some trouble with the query. The principal is the same to, say a forum, where you say: A user gets points for every new thread. Then, calculate the ratio of points for the number of threads. Example: User A has 300 points. User A has started 6 thread. The point ratio is: 50:6 My schemas look as following: student(studentid, name, class, major) course(courseid, coursename, department) courseoffering(courseid, semester, year, instructor) faculty(name, office, salary) gradereport(studentid, courseid, semester, year, grade) The relations is a following: Faculity(name) = courseoffering(instructor) Student(studentid) = gradereport (studentid) Courseoffering(courseid) = course(courseid) Gradereport(courseid) = courseoffering(courseid) I have this query to select the faculty names there is teaching one or more students: SELECT COUNT(faculty.name) FROM faculty, courseoffering, gradereport, student WHERE faculty.name = courseoffering.instructor AND courseoffering.courseid = gradereport.courseid AND gradereport.studentid = student.studentid My problem is to find the ratio between the faculty members salary in regarding to the number of students they are teaching. Say, a teacher get 10.000 in salary and teaches 5 students, then his ratio should be 1:5. I hope that someone has an answer to my problem and understand what I'm having trouble with. Thanks Mestika

    Read the article

  • Django Aggregation Across Reverse Relationship

    - by Tom
    Given these two models: class Profile(models.Model): user = models.ForeignKey(User, unique=True, verbose_name=_('user')) about = models.TextField(_('about'), blank=True) zip = models.CharField(max_length=10, verbose_name='zip code', blank=True) website = models.URLField(_('website'), blank=True, verify_exists=False) class ProfileView(models.Model): profile = models.ForeignKey(Profile) viewer = models.ForeignKey(User, blank=True, null=True) created = models.DateTimeField(auto_now_add=True) I want to get all profiles sorted by total views. I can get a list of profile ids sorted by total views with: ProfileView.objects.values('profile').annotate(Count('profile')).order_by('-profile__count') But that's just a dictionary of profile ids, which means I then have to loop over it and put together a list of profile objects. Which is a number of additional queries and still doesn't result in a QuerySet. At that point, I might as well drop to raw SQL. Before I do, is there a way to do this from the Profile model? ProfileViews are related via a ForeignKey field, but it's not as though the Profile model knows that, so I'm not sure how to tie the two together. As an aside, I realize I could just store views as a property on the Profile model and that may turn out to be what I do here, but I'm still interested in learning how to better use the Aggregation functions.

    Read the article

  • How to select LI except first and second ?

    - by Wazdesign
    Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

    Read the article

  • Listview not being populated

    - by Luke
    I have put some console.writeline code in to test, but they arent appearing in the output box? public static ArrayList myDeliveries = new ArrayList(); public mainForm() { InitializeComponent(); } private void mainForm_Load(object sender, EventArgs e) { if (!File.Exists("../../MealDeliveries.txt")) { MessageBox.Show("File not found!"); return; } using (StreamReader sr = new StreamReader("../../MealDeliveries.txt")) { //first line is delivery name string strDeliveryName = sr.ReadLine(); Console.WriteLine("some tetttttttttt23423423423423423ttttttttttttttttttttttt"); while (strDeliveryName != null) { //other lines Delivery d = new Delivery(strDeliveryName, sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine()); mainForm.myDeliveries.Add(d); //check for further values strDeliveryName = sr.ReadLine(); } } displayDeliveries(); } private void displayDeliveries() { lstDeliveryDetails.Items.Clear(); Console.WriteLine("some tettttttttttttttttttttttttttttttttt"); Console.WriteLine(mainForm.myDeliveries.Count); foreach (Delivery d in mainForm.myDeliveries) { lstDeliveryDetails.Items.Add(d.DeliveryName); } } Can anyone help??

    Read the article

  • Saving a form using autocomplete instead of select field

    - by Jason Swett
    I have a form that looks like this: <%= form_for(@appointment) do |f| %> <% if @appointment.errors.any? %> <div id="error_explanation"> <h2><%= pluralize(@appointment.errors.count, "error") %> prohibited this appointment from being saved:</h2> <ul> <% @appointment.errors.full_messages.each do |msg| %> <li><%= msg %></li> <% end %> </ul> </div> <% end %> <%= f.fields_for @client do |client_form| %> <div class="field"> <%= client_form.label :name, "Client Name" %><br /> <%= client_form.text_field :name %> </div> <% end %> As you can see, the field for @client is a text field as opposed to select field. When I try to save my form, I get this error: Client(#23852094658120) expected, got ActiveSupport::HashWithIndifferentAccess(#23852079773520) That's not surprising. It seems to me that it was expecting a select field, which it could translate into a Client object, but instead it just got a string. I know I can do Client.find( :first, :conditions => { :name => params[:name] } ) to find a Client with that name, but how do I tell my form that that's what's going on?

    Read the article

  • Stored Procedure: Reducing Table Data

    - by SumGuy
    Hi Guys, A simple question about Stored Procedures. I have one stored procedure collecting a whole bunch of data in a table. I then call this procedure from within another stored procedure. I can copy the data into a new table created in the calling procedure but as far as I can see the tables have to be identical. Is this right? Or is there a way to insert only the data I want? For example.... I have one procedure which returns this: SELECT @batch as Batch, @Count as Qty, pd.Location, cast(pd.GL as decimal(10,3)) as [Length], cast(pd.GW as decimal(10,3)) as Width, cast(pd.GT as decimal(10,3)) as Thickness FROM propertydata pd GROUP BY pd.Location, pd.GL, pd.GW, pd.GT I then call this procedure but only want the following data: DECLARE @BatchTable TABLE ( Batch varchar(50), [Length] decimal(10,3), Width decimal(10,3), Thickness decimal(10,3), ) INSERT @BatchTable (Batch, [Length], Width, Thickness) EXEC dbo.batch_drawings_NEW @batch So in the second command I don't want the Qty and Location values. However the code above keeps returning the error: "Insert Error: Column name or number of supplied values does not match table"

    Read the article

  • Why am I getting a EXC_BAD_ACCESS in a NSTimer selector?

    - by AngeDeLaMort
    I've got quite a weird problem. To make it short, i'll write some pseudo-code: init: create a dictionary and insert n elements. create a "repeat timer" and add it to the currentRunLoop using the timerRefresh selector. timerRefresh: using a list of keys, find the items in the dictionary if the item exists -> call a function So, for an unknown reason, I get an EXC_BAD_ACCESS when I do: [item function]; But I traced the address I got from the dictionary items and it's ok. The ref count of the items in the dictionary is still 1. The {release, dealloc} of the items in the dictionary aren't called. Everything seems fine. Also, to make it worst, it works for some items. So, I'm wondering if there is a threading problem? or something else obscure? The callstack is quite simple: #0 0x93e0604b in objc_msgSend_fpret #1 0x00f3e6b0 in ?? #2 0x0001cfca in -[myObject functionm:] at myObject.m:000 #3 0x305355cd in __NSFireTimer #4 0x302454a0 in CFRunLoopRunSpecific #5 0x30244628 in CFRunLoopRunInMode #6 0x32044c31 in GSEventRunModal #7 0x32044cf6 in GSEventRun #8 0x309021ee in UIApplicationMain #9 0x000027e0 in main at main.m:14 So, any suggestion where to look would be appreciated.

    Read the article

  • Constructor initializer list: code from the C++ Primer, chapter 16

    - by Alexandros Gezerlis
    Toward the end of Chapter 16 of the "C++ Primer" I encountered the following code (I've removed a bunch of lines): class Sales_item { public: // default constructor: unbound handle Sales_item(): h() { } private: Handle<Item_base> h; // use-counted handle }; My problem is with the Sales_item(): h() { } line. For the sake of completeness, let me also quote the parts of the Handle class template that I think are relevant to my question (I think I don't need to show the Item_base class): template <class T> class Handle { public: // unbound handle Handle(T *p = 0): ptr(p), use(new size_t(1)) { } private: T* ptr; // shared object size_t *use; // count of how many Handles point to *ptr }; I would have expected something like either: a) Sales_item(): h(0) { } which is a convention the authors have used repeatedly in earlier chapters, or b) Handle<Item_base>() if the intention was to invoke the default constructor of the Handle class. Instead, what the book has is Sales_item(): h() { }. My gut reaction is that this is a typo, since h() looks suspiciously similar to a function declaration. On the other hand, I just tried compiling under g++ and running the example code that uses this class and it seems to be working correctly. Any thoughts?

    Read the article

  • How Optimize sql query make it faster

    - by user502083
    Hello every one : I have a very simple small database, 2 of tables are: Node (Node_ID, Node_name, Node_Date) : Node_ID is primary key Citation (Origin_Id, Target_Id) : PRIMARY KEY (Origin_Id, Target_Id) each is FK in Node Now I write a query that first find all citations that their Origin_Id has a specific date and then I want to know what are the target dates of these records. I'm using sqlite in python the Node table has 3000 record and Citation has 9000 records, and my query is like this in a function: def cited_years_list(self, date): c=self.cur try: c.execute("""select n.Node_Date,count(*) from Node n INNER JOIN (select c.Origin_Id AS Origin_Id, c.Target_Id AS Target_Id, n.Node_Date AS Date from CITATION c INNER JOIN NODE n ON c.Origin_Id=n.Node_Id where CAST(n.Node_Date as INT)={0}) VW ON VW.Target_Id=n.Node_Id GROUP BY n.Node_Date;""".format(date)) cited_years=c.fetchall() self.conn.commit() print('Cited Years are : \n ',str(cited_years)) except Exception as e: print('Cited Years retrival failed ',e) return cited_years Then I call this function for some specific years, But it's crazy slowwwwwwwww :( (around 1 min for a specific year) Although my query works fine, it is slow. would you please give me a suggestion to make it faster? I'd appreciate any idea about optimizing this query :) I also should mention that I have indices on Origin_Id and Target_Id, so the inner join should be pretty fast, but it's not!!!

    Read the article

  • "Thread was being aborted" 0n large dataset

    - by Donaldinio
    I am trying to process 114,000 rows in a dataset (populated from an oracle database). I am hitting an error at around the 600 mark - "Thread was being aborted". All I am doing is reading the dataset, and I still hit the issue. Is this too much data for a dataset? It seems to load into the dataset ok though. I welcome any better ways to process this amount of data. rootTermsTable = entKw.GetRootKeywordsByCategory(catID); for (int k = 0; k < rootTermsTable.Rows.Count; k++) { string keywordID = rootTermsTable.Rows[k]["IK_DBKEY"].ToString(); ... } public DataTable GetKeywordsByCategory(string categoryID) { DbProviderFactory provider = DbProviderFactories.GetFactory(connectionProvider); DbConnection con = provider.CreateConnection(); con.ConnectionString = connectionString; DbCommand com = provider.CreateCommand(); com.Connection = con; com.CommandText = string.Format("Select * From icm_keyword WHERE (IK_IC_DBKEY = {0})",categoryID); com.CommandType = CommandType.Text; DataSet ds = new DataSet(); DbDataAdapter ad = provider.CreateDataAdapter(); ad.SelectCommand = com; con.Open(); ad.Fill(ds); con.Close(); DataTable dt = new DataTable(); dt = ds.Tables[0]; return dt; //return ds.Tables[0].DefaultView; }

    Read the article

  • What is the rationale to not allow overloading of C++ conversions operator with non-member function

    - by Vicente Botet Escriba
    C++0x has added explicit conversion operators, but they must always be defined as members of the Source class. The same applies to the assignment operator, it must be defined on the Target class. When the Source and Target classes of the needed conversion are independent of each other, neither the Source can define a conversion operator, neither the Target can define a constructor from a Source. Usually we get it by defining a specific function such as Target ConvertToTarget(Source& v); If C++0x allowed to overload conversion operator by non member functions we could for example define the conversion implicitly or explicitly between unrelated types. template < typename To, typename From > operator To(const From& val); For example we could specialize the conversion from chrono::time_point to posix_time::ptime as follows template < class Clock, class Duration> operator boost::posix_time::ptime( const boost::chrono::time_point<Clock, Duration>& from) { using namespace boost; typedef chrono::time_point<Clock, Duration> time_point_t; typedef chrono::nanoseconds duration_t; typedef duration_t::rep rep_t; rep_t d = chrono::duration_cast<duration_t>( from.time_since_epoch()).count(); rep_t sec = d/1000000000; rep_t nsec = d%1000000000; return posix_time::from_time_t(0)+ posix_time::seconds(static_cast<long>(sec))+ posix_time::nanoseconds(nsec); } And use the conversion as any other conversion. For a more complete description of the problem, see here or on my Boost.Conversion library.. So the question is: What is the rationale to non allow overloading of C++ conversions operator with non-member functions?

    Read the article

  • Display two array's in the same table

    - by Naeem Ahmed
    $row = $query->fetchAll(PDO::FETCH_ASSOC); $num_rows = count($row); for ($i = 0; $i < $num_rows; $i++) { $title = htmlspecialchars($row[$i]['title']); $author =htmlspecialchars($row[$i]['author']); $school =htmlspecialchars($row[$i]['school']); $solution = $row[$i]['solution']; $notes = $row[$i]['notes']; $ad = array($title, $price, $author, $school, $contact, $content, $date); $inlcude = array($solutions, $notes); $field = 0; echo "<table border='1'>"; // foreach($inlcude as $in) This failled miserably foreach ($ad as $post) { if ($field < 3) //The first three values are placed in the first row { echo "<td>$post</td>"; } if ($field >= 3) { echo "<tr><td>$post</td><td>$in</td></tr>"; } $field++; } echo '</table>'; } I have two arrays and I would like to display them in different columns in my table. $ad displays perfectly fine but I'm having trouble displaying the contents in $inlcude in the second column. I've tried putting another foreach loop to iterate through contents of the second array but that really screws up my table by placing random values in different places on the table. Besides the foreach loop, I don't know of any other way to iterate through the array. Any suggestions would be appreciated.Thanks!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to exclude rows where matching join is in an SQL tree

    - by Greg K
    Sorry for the poor title, I couldn't think how to concisely describe this problem. I have a set of items that should have a 1-to-1 relationship with an attribute. I have a query to return those rows where the data is wrong and this relationship has been broken (1-to-many). I'm gathering these rows to fix them and restore this 1-to-1 relationship. This is a theoretical simplification of my actual problem but I'll post example table schema here as it was requested. item table: +------------+------------+-----------+ | item_id | name | attr_id | +------------+------------+-----------+ | 1 | BMW 320d | 20 | | 1 | BMW 320d | 21 | | 2 | BMW 335i | 23 | | 2 | BMW 335i | 34 | +------------+------------+-----------+ attribute table: +---------+-----------------+------------+ | attr_id | value | parent_id | +---------+-----------------+------------+ | 20 | SE | 21 | | 21 | M Sport | 0 | | 23 | AC | 24 | | 24 | Climate control | 0 | .... | 34 | Leather seats | 0 | +---------+-----------------+------------+ A simple query to return items with more than one attribute. SELECT item_id, COUNT(DISTINCT(attr_id)) AS attributes FROM item GROUP BY item_id HAVING attributes > 1 This gets me a result set like so: +-----------+------------+ | item_id | attributes | +-----------+------------+ | 1 | 2 | | 2 | 2 | | 3 | 2 | -- etc. -- However, there's an exception. The attribute table can hold a tree structure, via parent links in the table. For certain rows, parent_id can hold the ID of another attribute. There's only one level to this tree. Example: +---------+-----------------+------------+ | attr_id | value | parent_id | +---------+-----------------+------------+ | 20 | SE | 21 | | 21 | M Sport | 0 | .... I do not want to retrieve items in my original query where, for a pair of associated attributes, they related like attributes 20 & 21. I do want to retrieve items where: the attributes have no parent for two or more attributes they are not related (e.g. attributes 23 & 34) Example result desired, just the item ID: +------------+ | item_id | +------------+ | 2 | +------------+ How can I join against attributes from items and exclude these rows? Do I use a temporary table or can I achieve this from a single query? Thanks.

    Read the article

  • Testing ActionMailer's receive method (Rails)

    - by Brian Armstrong
    There is good documentation out there on testing ActionMailer send methods which deliver mail. But I'm unable to figure out how to test a receive method that is used to parse incoming mail. I want to do something like this: require 'test_helper' class ReceiverTest < ActionMailer::TestCase test "parse incoming mail" do email = TMail::Mail.parse(File.open("test/fixtures/emails/example1.txt",'r').read) assert_difference "ProcessedMail.count" do Receiver.receive email end end end But I get the following error on the line which calls Receiver.receive NoMethodError: undefined method `index' for #<TMail::Mail:0x102c4a6f0> /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/stringio.rb:128:in `gets' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:392:in `parse_header' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:139:in `initialize' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/stringio.rb:43:in `open' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/port.rb:340:in `ropen' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:138:in `initialize' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:123:in `new' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:123:in `parse' /Library/Ruby/Gems/1.8/gems/actionmailer-2.3.4/lib/action_mailer/base.rb:417:in `receive' Tmail is parsing the test file I have correctly. So that's not it. Thanks!

    Read the article

  • pulling a value from NSMutableDictionary

    - by Jared Gross
    I have a dictionary array with a key:@"titleLabel". I am trying to load a pickerView with ONE instance of each @"titleLabel" key so that if there are multiple objects with the same @"titleLabel" only one title will be displayed. I've done some research on this forum and looked at apples docs but haven't been able to put the puzzle together. Below is my code but I am having trouble pulling the values. Right now when I run this code it throws an error Incompatible pointer types sending 'PFObject *' to parameter of type 'NSString' which i understand but am just not sure how to remedy. Cheers! else { // found messages! self.objectsArray = objects; NSMutableDictionary *dict = [[NSMutableDictionary alloc] init]; for(id obj in self.objectsArray){ PFObject *key = [self.objectsArray valueForKey:@"titleLabel"]; if(![dict objectForKey:@"titleLabel"]){ [dict setValue:obj forKey:key]; } } for (id key in dict) { NSLog(@"Objects array is %d", [self.objectsArray count]); NSLog(@"key: %@, value: %@ \n", key, [dict objectForKey:key]); } [self.pickerView reloadComponent:0]; } }];` Here is where I define the PFObject and keys: PFObject *image = [PFObject objectWithClassName:@"Images"]; [image setObject:file forKey:@"file"]; [image setObject:fileType forKey:@"fileType"]; [image setObject:title forKey:@"titleLabel"]; [image setObject:self.recipients forKey:@"recipientIds"]; [image setObject:[[PFUser currentUser] objectId] forKey:@"senderId"]; [image setObject:[[PFUser currentUser] username] forKey:@"senderName"]; [image saveInBackground];

    Read the article

  • How to find whole graph coverage path in dynamic state-flow diagram?

    - by joseph
    Hello, As I've been researching algorithms for path finding in graph, I found interesting problem. Definition of situation: 1)State diagram can have p states, and s Boolean Fields, and z Int Fields 2)Every state can have q ingoing and r outgoing transitions, and h Int fields (h belongs to z - see above) 3)Every transition can have only 1 event, and only 1 action 4)every action can change n Boolean Fields, and x Int Fields 5)every event can have one trigger from combination of any count of Boolean Fields in diagram 6)Transition can be in OPEN/CLOSED form. If the transition is open/closed depends on trigger2 compounded from 0..c Boolean fields. 7) I KNOW algorithm for finding shortest paths from state A to state B. 8) I KNOW algorithm for finding path that covers all states and transitions of whole state diagram, if all transitions are OPEN. Now, what is the goal: I need to find shortest path that covers all states and transitions in dynamically changing state diagram described above. When an action changes some int field, the algorithm should go through all states that have changed int field. The algorithm should also be able to open and close transition (by going through transitions that open and close another transitions by action) in the way that the founded path will be shortest and covers all transitions and states. Any idea how to solve it? I will be really pleased for ANY idea. Thanks for answers.

    Read the article

  • php - create columns from mysql list

    - by user271619
    I have a long list generated from a simple mysql select query. Currently (shown in the code below) I am simply creating list of table rows with each record. So, nothing complicated. However, I want to divide it into more than one column, depending on the number of returned results. I've been wrapping my brain around how to count this in the php, and I'm not getting the results I need. <table> <? $query = mysql_query("SELECT * FROM `sometable`"); while($rows = mysql_fetch_array($query)){ ?> <tr> <td><?php echo $rows['someRecord']; ?></td> </tr> <? } ?> </table> Obviously there's one column generated. So if the records returned reach 10, then I want to create a new column. In other words, if the returned results are 12, I have 2 columns. If I have 22 results, I'll have 3 columns, and so on.

    Read the article

  • Eliminate full table scan due to BETWEEN (and GROUP BY)

    - by Dave Jarvis
    Description According to the explain command, there is a range that is causing a query to perform a full table scan (160k rows). How do I keep the range condition and reduce the scanning? I expect the culprit to be: Y.YEAR BETWEEN 1900 AND 2009 AND Code Here is the code that has the range condition (the STATION_DISTRICT is likely superfluous). SELECT COUNT(1) as MEASUREMENTS, AVG(D.AMOUNT) as AMOUNT, Y.YEAR as YEAR, MAKEDATE(Y.YEAR,1) as AMOUNT_DATE FROM CITY C, STATION S, STATION_DISTRICT SD, YEAR_REF Y FORCE INDEX(YEAR_IDX), MONTH_REF M, DAILY D WHERE -- For a specific city ... -- C.ID = 10663 AND -- Find all the stations within a specific unit radius ... -- 6371.009 * SQRT( POW(RADIANS(C.LATITUDE_DECIMAL - S.LATITUDE_DECIMAL), 2) + (COS(RADIANS(C.LATITUDE_DECIMAL + S.LATITUDE_DECIMAL) / 2) * POW(RADIANS(C.LONGITUDE_DECIMAL - S.LONGITUDE_DECIMAL), 2)) ) <= 50 AND -- Get the station district identification for the matching station. -- S.STATION_DISTRICT_ID = SD.ID AND -- Gather all known years for that station ... -- Y.STATION_DISTRICT_ID = SD.ID AND -- The data before 1900 is shaky; insufficient after 2009. -- Y.YEAR BETWEEN 1900 AND 2009 AND -- Filtered by all known months ... -- M.YEAR_REF_ID = Y.ID AND -- Whittled down by category ... -- M.CATEGORY_ID = '003' AND -- Into the valid daily climate data. -- M.ID = D.MONTH_REF_ID AND D.DAILY_FLAG_ID <> 'M' GROUP BY Y.YEAR Update The SQL is performing a full table scan, which results in MySQL performing a "copy to tmp table", as shown here: +----+-------------+-------+--------+-----------------------------------+--------------+---------+-------------------------------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+-------+--------+-----------------------------------+--------------+---------+-------------------------------+--------+-------------+ | 1 | SIMPLE | C | const | PRIMARY | PRIMARY | 4 | const | 1 | | | 1 | SIMPLE | Y | range | YEAR_IDX | YEAR_IDX | 4 | NULL | 160422 | Using where | | 1 | SIMPLE | SD | eq_ref | PRIMARY | PRIMARY | 4 | climate.Y.STATION_DISTRICT_ID | 1 | Using index | | 1 | SIMPLE | S | eq_ref | PRIMARY | PRIMARY | 4 | climate.SD.ID | 1 | Using where | | 1 | SIMPLE | M | ref | PRIMARY,YEAR_REF_IDX,CATEGORY_IDX | YEAR_REF_IDX | 8 | climate.Y.ID | 54 | Using where | | 1 | SIMPLE | D | ref | INDEX | INDEX | 8 | climate.M.ID | 11 | Using where | +----+-------------+-------+--------+-----------------------------------+--------------+---------+-------------------------------+--------+-------------+ Related http://dev.mysql.com/doc/refman/5.0/en/how-to-avoid-table-scan.html http://dev.mysql.com/doc/refman/5.0/en/where-optimizations.html http://stackoverflow.com/questions/557425/optimize-sql-that-uses-between-clause Thank you!

    Read the article

  • XNA: What can cause SpriteBatch.End() to throw a NRE?

    - by Rosarch
    I don't understand what I'm doing wrong here: public void Draw(GameTime gameTime) // in ScreenManager { SpriteBatch.Begin(SpriteBlendMode.AlphaBlend); for (int i = 0; i < Screens.Count; i++) { if (Screens[i].State == Screen.ScreenState.HIDDEN) continue; Screens[i].Draw(gameTime); } SpriteBatch.End(); // null ref exception } SpriteBatch itself is not null. Some more context: public class MasterEngine : Microsoft.Xna.Framework.Game { public MasterEngine() { graphicsDeviceManager = new GraphicsDeviceManager(this); Components.Add(new GamerServicesComponent(this)); // ... spriteBatch = new SpriteBatch(graphicsDeviceManager.GraphicsDevice); screenManager = new ScreenManager(assets, gameEngine, graphicsDeviceManager.GraphicsDevice, spriteBatch); } //... protected override void Draw(GameTime gameTime) { screenManager.Draw(gameTime); // calls the problematic method base.Draw(gameTime); } } Am I failing to initialize something properly? UPDATE: As an experiment, I tried this to the constructor of MasterEngine: spriteBatch = new SpriteBatch(graphicsDeviceManager.GraphicsDevice); spriteBatch.Begin(); spriteBatch.DrawString(assets.GetAsset<SpriteFont>("calibri"), "ftw", new Vector2(), Color.White); spriteBatch.End(); This does not cause a NRE. hmm.... UPDATE 2: This does cause an NRE: protected override void Draw(GameTime gameTime) { spriteBatch.Begin(); spriteBatch.End(); // boned here //screenManager.Draw(gameTime); base.Draw(gameTime); }

    Read the article

< Previous Page | 275 276 277 278 279 280 281 282 283 284 285 286  | Next Page >