Search Results

Search found 8550 results on 342 pages for 'datetime operation'.

Page 28/342 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

• Sorting records datewise in datatable.

  - by Harikrishna

  I have datatable and I am storing the records in that datatable. Now one of the column in the datatable is type of DateTime.That column I added by code Table.Columns.Add(new DataColumn("TradingDate",System.Type.GetType("System.DateTime"))); Now I want to sort the records datewise in ascending order. I have used following code but the records are not sorted. DataView view = new DataView(Table); view.Sort = "TradingDate ASC"; dataGridView1.DataSource=view.Table; But records are not sorted so how to do it ?

  Read the article

• PHP Datediff days involved

  - by user3549835

  I need to know how many days are involved in a date diff. \For example: <? $start = new DateTime('2014-06-29 14:00:00'); $ende = new DateTime('2014-07-02 05:45:00'); $diff = $start->diff($ende); echo $diff->format('%R'); echo $diff->days; ?> The above code echos +2 My desired result would be 4, because the 29th, 30th, 1st and 2nd of July are "touched". I have no idea to achieve that with the given functions. Coding a day-subtraction seems to bean open door for errors.

  Read the article

• mysql ORDER BY date_time field not sorting as expected

  - by undefined

  I have a field in my database that stores the datetime that an item was added to the database. If I want to sort the items in reverse chronological order I would expect that doing ORDER by date_added DESC would do the trick. But this seems not to work. I also tried ORDER by UNIX_TIMESTAMP(date_added) but this still did not sort the results as I would expect. I also have an auto-increment field that I can use to sort items so I will use this, but I am curious as to why ORDER by datetime was not behaving as expected. any ideas?

  Read the article

• GMLib Could not complete the operation due to error 80020101

  - by Pierrie

  I get this error "Could not complete the operation due to error 80020101." at random times when displaying a map with a marker on it. I use Delphi 2007 and GMLib [1.2.0 Final]. I have read up on the issue and some suggestions was that the problem is due to commenting or bad syntax in java code, and it was suggested that i take out all the commenting and check for errors in the java code. This i did, i recompiled and reinstalled GMLib after modifying the map.html file. I stripped it of all commenting and parsed it through ie for faults but found none, as expected. But the problem still occurs. Here is a sample of my code to show the map and add the marker : Var newmarker : TMarker; begin newmarker := GMMarker1.Add(); newmarker.Position.Lat := MarkersToPaint[i].Latitude; newmarker.Position.Lng := MarkersToPaint[i].Longitude; newmarker.Visible := True; newmarker.Title := MarkersToPaint[i].Title; GMMap1.RequiredProp.Center.Lat := midlat; GMMap1.RequiredProp.Center.Lng := midlong; GMMap1.RequiredProp.Zoom := 18; GMMarker1.ShowElements; GMMap1.Active := True; Any help in this matter will be greatly appreciated.

  Read the article

• Refresh RadGridview when Insert,Update and Delete Operation done on Database in WPF

  - by patelriki13

  WPF and C#: Problem: 1. How to Refresh Radgridview when i Insert,update and Delete Record in database anrecord. 2.when i am Insert or Update Record than in radgridview that row is selected. i am useing sql server 2005. i am use to set data source of radgridview like " radgridview1.ItemsSource = ds; " == ds is dataset. i am beginner so if possible than tel me by code it is easy to understand....... can u help me as early as possible .... i give some code which i am useing for update RadGridview con.ConnectionString = @"Data Source=(local);Initial Catalog=DigiDms;Integrated Security=True"; cmd1.Connection = con; con.Open(); cmd1.CommandType = CommandType.StoredProcedure; cmd1.CommandText = "Pro_Insurance_Master_Select"; da1.SelectCommand = cmd1; da1.Fill(ds1); con.Close(); //dataGrid.clear(); //dsGrid.Reset(); //dsGrid = dataGrid.GetData("Pro_Insurance_Master_Select"); //set datasource of gridview gridShowData.ItemsSource = null; gridShowData.ItemsSource = ds1; doing this , when i am delete or update record than folloning error generated... Error: "Object reference not set to an object" when i am doing the "gridShowData.ItemsSource = null;" and when i am doing insert operation than this error is not generated and RadGridview also updated..... so pls help me as early as possible.... i am beginer ........ my email address is [email protected]

  Read the article

• Ajax Asynchronous in IE - Error "The Data Necessary to Complete This Operation is Not Yet Available"

  - by Supernovah

  Hey there. I have a 100% valid Ajax model written in Javascript with a few inputs I use being, Get or Post method, What page to communicate with, What String to send to that page and What element on my own page I might be fiddling with when I receive my response. The problem is that, should I set the request to Asynchronous (Hence Ajax), IE returns the error "The Data Necessary to Complete This Operation is Not Yet Available" in the onreadystatechange event where all I do is check if the readystate is 4 and the status is 200. The error doesn't come up in Firefox or Chrome as I would exepect as the Ajax is Asynchronous. Heres a snippet from the Post method xmlhttp.open("POST", commPage, true); xmlhttp.setRequestHeader("Content-Type","application/x-www-form-urlencoded; charset=UTF-8"); xmlhttp.onreadystatechange = function() { if (xmlhttp.readyState == 4 && xmlhttp.status == 200) { j = xmlhttp.responseText; i.innerHTML = j; } } xmlhttp.send(str); Edit: I should point out that in IE, I'm using the ActiveX Control - Msxml2.XMLHTTP or Microsoft.XMLHTTP or whichever returns true first.

  Read the article

• WCF Ria Services Error : Load operation failed for query 'GetTranslationProgress'

  - by Manoj

  Hello, I am using WCF Ria Services beta in my silverlight application. I have a long running task on the server which keeps writing its status to a database table. I have a "GetTranslationProgress" Ria Service Query method which queries the state to get the status. This query method is called continuously at a regular interval of 5 seconds until a status = Finished or Error is retrieved. In some cases if the task on the server is running for a long duration 2-3 minutes then I receives this error:- Load operation failed for query 'GetTranslationProgress'. The server did not provide a meaningful reply; this might be caused by a contract mismatch, a premature session shutdown or an internal server error. at System.Windows.Ria.OperationBase.Complete(Exception error) at System.Windows.Ria.LoadOperation.Complete(Exception error) at System.Windows.Ria.DomainContext.CompleteLoad(IAsyncResult asyncResult) at System.Windows.Ria.DomainContext.<c_DisplayClass17.b_13(Object ) The error occurs intermittently and I have no idea what could be causing this error. I have checked most of the forums and sites but I have not been able to find out any solution to this issue. Please help.

  Read the article

• Encrypting using RSA via COM Interop = "The requested operation requires delegation to be enabled on

  - by Mr AH

  Hi Guys, So i've got this little static method in a .Net class which takes a string, uses some stored public key and returns the encrypted version of that key. This is basically so some user entered data can be saved an encrypted, then retrieved and decrypted at a later date. Pretty basic stuff and the unit test works fine. However, part of the application is in classic ASP. This then uses some COM visible version of the class to go off and invoke the method on the real class and return the same string to the COM client (classic ASP). I use this kind of stuff all the time, but in this case we have a major problem. As the method is doing something with RSA keys and has to access certain machine information to do so, we get the error: "The requested operation requires delegation to be enabled on the machine. I've searched around a lot, but can't really understand what this means. I assume I am getting this error on the COM but not the UT because the UT runs as me (Administrator) and classic ASP as IWAM. Anyone know what I need to do to enable IWAM to do this? Or indeed if this is the real problem here?

  Read the article

• Why is TransactionScope operation is not valid?

  - by Cragly

  I have a routine which uses a recursive loop to insert items into a SQL Server 2005 database The first call which initiates the loop is enclosed within a transaction using TransactionScope. When I first call ProcessItem the myItem data gets inserted into the database as expected. However when ProcessItem is called from either ProcessItemLinks or ProcessItemComments I get the following error. “The operation is not valid for the state of the transaction” I am running this in debug with VS 2008 on Windows 7 and have the MSDTC running to enable distributed transactions. The code below isn’t my production code but is set out exactly the same. The AddItemToDatabase is a method on a class I cannot modify and uses a standard ExecuteNonQuery() which creates a connection then closes and disposes once completed. I have looked at other posting on here and the internet and still cannot resolve this issue. Any help would be much appreciated. using (TransactionScope processItem = new TransactionScope()) { foreach (Item myItem in itemsList) { ProcessItem(myItem); } processItem.Complete(); } private void ProcessItem(Item myItem) { AddItemToDatabase(myItem); ProcessItemLinks(myItem); ProcessItemComments(myItem); } private void ProcessItemLinks(Item myItem) { foreach (Item link in myItem.Links) { ProcessItem(link); } } private void ProcessItemComments(Item myItem) { foreach (Item comment in myItem.Comments) { ProcessItem(comment); } } Here is top part of the stack trace. Unfortunatly I cant show the build up to this point as its company sensative information which I can not disclose. Hope this is enough information. at System.Transactions.TransactionState.EnlistPromotableSinglePhase(InternalTransaction tx, IPromotableSinglePhaseNotification promotableSinglePhaseNotification, Transaction atomicTransaction) at System.Transactions.Transaction.EnlistPromotableSinglePhase(IPromotableSinglePhaseNotification promotableSinglePhaseNotification) at System.Data.SqlClient.SqlInternalConnection.EnlistNonNull(Transaction tx) at System.Data.SqlClient.SqlInternalConnection.Enlist(Transaction tx) at System.Data.SqlClient.SqlInternalConnectionTds.Activate(Transaction transaction) at System.Data.ProviderBase.DbConnectionInternal.ActivateConnection(Transaction transaction) at System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) at System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) at System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) at System.Data.SqlClient.SqlConnection.Open()

  Read the article

• Call long running operation in WSS feature OnActivated Event

  - by dirq

  More specifically - How do I reference SPContext in Web Service with [SoapDocumentMethod(OneWay=true)]? We are creating a feature that needs to run a job when a site is created. The job takes about 4 minutes to complete. So, we made a web service that we can call when the feature is activated. This works but we want it to run asynchronously now. We've found the SoapDocumentMethod's OneWay property and that would work awesomely but the SPContext is now NULL. We have our web services in the _vti_bin virtual directory so it's available in each Windows Sharepoint Services site. I was using the SPContext.Current.Web to get the site and perform the long running operation. I wanted to just fire and forget about it by returning a soap response right away and letting the process run. How can I get the current SPContext? I used to be able to do this in my web service: SPWeb mySite = SPContext.Current.Web; Can I get the same context when I have the [SoapDocumentMethod(OneWay=true)] attribute applied to my web service? Or must I recreate the SPWeb from the url? This is similar to this thread: http://stackoverflow.com/questions/340192/webservice-oneway-and-new-spsitemyurl Update: I've tried these two ways but they didn't work: SPWeb targetSite = SPControl.GetContextWeb(this.Context); SPWeb targetSite2 = SPContext.GetContext(this.Context).Web;

  Read the article

• edmx - The operation could not be completed - After adding Inheritance

  - by vdh_ant

  Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas???

  Read the article

• Asp.net Crawler Webresponse Operation Timed out.

  - by Leon

  Hi I have built a simple threadpool based web crawler within my web application. Its job is to crawl its own application space and build a Lucene index of every valid web page and their meta content. Here's the problem. When I run the crawler from a debug server instance of Visual Studio Express, and provide the starting instance as the IIS url, it works fine. However, when I do not provide the IIS instance and it takes its own url to start the crawl process(ie. crawling its own domain space), I get hit by operation timed out exception on the Webresponse statement. Could someone please guide me into what I should or should not be doing here? Here is my code for fetching the page. It is executed in the multithreaded environment. private static string GetWebText(string url) { string htmlText = ""; HttpWebRequest request = (HttpWebRequest)HttpWebRequest.Create(url); request.UserAgent = "My Crawler"; using (WebResponse response = request.GetResponse()) { using (Stream stream = response.GetResponseStream()) { using (StreamReader reader = new StreamReader(stream)) { htmlText = reader.ReadToEnd(); } } } return htmlText; } And the following is my stacktrace: at System.Net.HttpWebRequest.GetResponse() at CSharpCrawler.Crawler.GetWebText(String url) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 366 at CSharpCrawler.Crawler.CrawlPage(String url, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 105 at CSharpCrawler.Crawler.CrawlSiteBuildIndex(String hostUrl, String urlToBeginSearchFrom, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 89 at crawler_Default.threadedCrawlSiteBuildIndex(Object threadedCrawlerObj) in c:\myAppDev\myApp\site\crawler\Default.aspx.cs:line 108 at System.Threading.QueueUserWorkItemCallback.WaitCallback_Context(Object state) at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.RunInternal(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state, Boolean ignoreSyncCtx) at System.Threading.QueueUserWorkItemCallback.System.Threading.IThreadPoolWorkItem.ExecuteWorkItem() at System.Threading.ThreadPoolWorkQueue.Dispatch() at System.Threading._ThreadPoolWaitCallback.PerformWaitCallback() Thanks and cheers, Leon.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• edmx - The operation could not be completed - When adding Inheritance

  - by vdh_ant

  Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas??? this is driving me crazy...

  Read the article

• Invalid Pointer Operation, advice requested with debugging

  - by Xanyx

  I appear to have created code that is trashing memory. Having never had such problems before, i am now settign an Invalid Pointer Operation. In the following the value of the const string sFilename gets trashed after my call to PromptForXYZPropertiesSettings. // Allow the user to quickly display the properties of XYZ without needing to display the full Editor function PromptForXYZProperties(const sFilename:string; var AXYZProperties: TXYZProperties): boolean; var PropEditor: TdlgEditor; begin PropEditor:= TdlgEditor.create(nil); try PropEditor.LoadFromFile(sFilename); Other Details: Delphi 2007, Windows 7 64 bit, but can reproduce when testing EXE on XP REMOVING CONST STOPS PROBLEM FROM EXHIBITING (but presumably the problem is thus just lurking) PropEditor.PromptForXYZPropertiesSettings creates and shows a form. If I disable the ShowModal call then the memory is not trashed. Even though i have REMOVED ALL CONTROLS AND CODE from the form So I would like some advice on how to debug the issue. I was thinking perhaps watching the memory pointer where the sFilename var exists to see where it gets trashed, but not sure how i would do that (obviously needs to be done within the app so is owned memory). Thanks

  Read the article

• question about siftdown operation on heap

  - by davit-datuashvili

  i have following pseudo code which execute siftdown operation on heap array suppose is x void siftdown(int n) pre heap(2,n) && n>=0 post heap(1,n) i=1; loop /*invariant heap(1,n) except perhaps between i and it's (0,1,or 2) children*/ c=2*i; if (c>n) break; // c is left child of i if (c+1)<=n /* c+1 is rigth child of i if (x[c+1]<x[c]) c++ /* c is lesser child of i if (x[i]<=x[c]) break; swap(c,i) i=c; i have wrote following code is it correct? public class siftdown{ public static void main(String[]args){ int c; int n=9; int a[]=new int[]{19,100,17,2,7,3,36,1,25}; int i=1; while (i<n){ c=2*i; if (c>n) break; //c is the left child of i if (c+1<=n) //c+1 ir rigth child of i if (a[c+1]<a[c]) c++; if (a[i]<=a[c]) break; int t=a[c]; a[c]=a[i]; a[i]=t; i=c; } for (int j=0;j<a.length;j++){ System.out.println(a[j]); } } } // result is 19 2 17 1 7 3 36 100 25

  Read the article

• How can solve "Cross-thread operation not valid"?

  - by Phsika

  i try to start multi Thread but i can not it returns to me error: Cross-thread operation not valid: 'listBox1' thread was created to control outside access from another thread was. MyCodes: public DataTable dTable; public DataTable dtRowsCount; Thread t1; ThreadStart ts1; void ExcelToSql() { // SelectDataFromExcel(); ts1 = new ThreadStart(SelectDataFromExcel); t1 = new Thread(ts1); t1.Start(); } void SelectDataFromExcel() { string connectionString = @"Provider=Microsoft.ACE.OLEDB.12.0;Data Source=C:\Source\Addresses.xlsx;Extended Properties=""Excel 12.0;HDR=YES;"""; OleDbConnection excelConnection = new OleDbConnection(connectionString); string[] Sheets = new string[] { "Sayfa1"}; excelConnection.Open(); // This code will open excel file. OleDbCommand dbCommand; OleDbDataAdapter dataAdapter; // progressBar1.Minimum = 1; foreach (var sheet in Sheets) { dbCommand = new OleDbCommand("select * From[" + sheet + "$]", excelConnection); //progressBar1.Maximum = CountRowsExcel(sheet).Rows.Count; // progressBar2.Value = i + 1; System.Threading.Thread.Sleep(1000); **listBox1.Items.Add("Tablo ismi: "+sheet.ToUpper()+"Satir Adeti: "+CountRowsExcel(sheet).Rows.Count.ToString()+" ");** dataAdapter = new OleDbDataAdapter(dbCommand); dTable = new DataTable(); dataAdapter.Fill(dTable); dTable.TableName = sheet.ToUpper(); dTable.Dispose(); dataAdapter.Dispose(); dbCommand.Dispose(); ArrangedDataList(dTable); FillSqlTable(dTable, dTable.TableName); } excelConnection.Close(); excelConnection.Dispose(); }

  Read the article

• Is it possible to either abort or interrupt and later continue a lvconvert -m1 operation?

  - by SLi

  I have run the command lvconvert -m1 rootvg/newroot /dev/sdb to convert a linear logical volume to a mirrored one. The operation has not yet finished; I interrupted the command with ctrl-c at around 10% mark, but the operation seems to be running in the background anyway. Is it possible to either 1) Abort the lvconvert operation and revert to the state before it? (This would be my preferred option) 2) To safely interrupt the operation and resume it later?

  Read the article

• Clear OS always showing "Operation too slow. Less than 1 bytes/sec"

  - by Blue Gene

  Have been trying to install clear os addon but nothing is working as i am facing this error on every mirror in the .repo file. Yum install squid http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'O*peration too slow. Less than 1 bytes/sec transfered the last 30 seconds'*) Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. Error: failure: repodata/primary.sqlite.bz2 from clearos-core: [Errno 256] No more mirrors to try. How can i fix this.i am able to access repo through web,and it seems nothing wrong with the repo.Where can be the problem. Tried yum clean all but it also didnt help. Is there a way to fix it as i am not able to install any package in it.

  Read the article

• IronRuby System.DateTime NilClass

  - by Sergey Mirvoda

  Why comparing to null is so unstable? Just code. IronRuby 0.9.4.0 on .NET 2.0.50727.4927 Copyright (c) Microsoft Corporation. All rights reserved. >>> require 'System' => true >>> i = System::Int32.MinValue => -2147483648 >>> i==nil => false >>> d = System::DateTime.Now => 11.02.2010 14:15:02 >>> d==nil (ir):1: can't convert NilClass into System::DateTime (TypeError) >>> In 9.1 this code works as expected. EDIT: workaround: >>> i.nil? => false >>> d.nil? => false >>> nil => nil >>> nil.nil? => true >>>

  Read the article

• Object Reference with TimeSpan/DateTime

  - by user1732039

  When creating an appointment i want to send an email out to the patient with details like Time, Date etc. I know the email service i have created works (i have tested it by hardcoding strings into the method with the problem. The Problem is that i am getting Object reference issues with converting the Time and Date to a string. It does create the appointment data in the database correctly (time and date). User_Doctor thisDoc = user_DoctorComboBox.SelectedItem as User_Doctor; User_Patient thisPatient = appointment_Patient_autoComplete.SelectedItem as User_Patient; Appointment App = AppointmentSlots.SelectedItem as Appointment; DateTime date = (DateTime)datePickerAppointment.SelectedDate; TimeSpan timeslot = App.Time; //For Emailing Patients string fullname = thisPatient.PatientName + " " + thisPatient.PatientSurname; string mestime = timeslot.ToString("HH:mm"); string mesdate = date.ToString("MM/dd/yyyy"); string email = thisPatient.aspnet_Users.aspnet_Membership.LoweredEmail; EmailServiceClient em = new EmailServiceClient(); em.createMessageAsync(email, "Upcomming Appointment", fullname, mestime, mesdate, thisDoc.aspnet_Users.UserName, true); The problem occures with the strings mestime and mesdate, as well as with getting the email of the user from the database (again this exists in the db, as a nvar)

  Read the article

• I keep on getting "save operation failure" after any change on my XCode Data Model

  - by Philip Schoch

  I started using Core Data for iPhone development. I started out by creating a very simple entity (called Evaluation) with just one string property (called evaluationTopic). I had following code for inserting a fresh string: - (void)insertNewObject { // Create a new instance of the entity managed by the fetched results controller. NSManagedObjectContext *context = [fetchedResultsController managedObjectContext]; NSEntityDescription *entity = [[fetchedResultsController fetchRequest] entity]; NSManagedObject *newManagedObject = [NSEntityDescription insertNewObjectForEntityForName:[entity name] inManagedObjectContext:context]; // If appropriate, configure the new managed object. [newManagedObject setValue:@"My Repeating String" forKey:@"evaluationTopic"]; // Save the context. NSError *error; if (![context save:&error]) { // Handle the error... } [self.tableView reloadData]; } This worked perfectly fine and by pushing the +button a new "My Repeating String" would be added to the table view and be in persistent store. I then pressed "Design - Add Model Version" in XCode. I added three entities to the existing entity and also added new properties to the existing "Evaluation" entity. Then, I created new files off the entities by pressing "File - New File - Managed Object Classes" and created a new .h and .m file for my four entities, including the "Evaluation" entity with Evaluation.h and Evaluation.m. Now I changed the model version by setting "Design - Data Model - Set Current Version". After having done all this, I changed my insertMethod: - (void)insertNewObject { // Create a new instance of the entity managed by the fetched results controller. NSManagedObjectContext *context = [fetchedResultsController managedObjectContext]; NSEntityDescription *entity = [[fetchedResultsController fetchRequest] entity]; Evaluation *evaluation = (Evaluation *) [NSEntityDescription insertNewObjectForEntityForName:[entity name] inManagedObjectContext:context]; // If appropriate, configure the new managed object. [evaluation setValue:@"My even new string" forKey:@"evaluationSpeechTopic"]; // Save the context. NSError *error; if (![context save:&error]) { // Handle the error... } [self.tableView reloadData]; } This does not work though! Every time I want to add a row the simulator crashes and I get the following: "NSInternalInconsistencyException', reason: 'This NSPersistentStoreCoordinator has no persistent stores. It cannot perform a save operation.'" I had this error before I knew about creating new version after changing anything on the datamodel, but why is this still coming up? Do I need to do any mapping (even though I just added entities and properties that did not exist before?). In the Apple Dev tutorial it sounds very easy but I have been struggling with this for long time, never worked after changing model version.

  Read the article

• infix operation to postfix using stacks

  - by Chris De La O

  We are writing a program that needs to convert an infix operation (4 5/3) to postfix (4 5 3 / ) using stacks. however my convert to postfix does not work as it doesnt not output the postFix array that is supposed to store the conversion from infix notation to postfix notation. here is the code for the convertToPostix fuction. //converts infix expression to postfix expression void ArithmeticExpression::convertToPostfix(char *const inFix, char *const postFix) { //create a stack2 object named cow Stack2<char> cow; cout<<postFix; char thing = '('; //push a left parenthesis onto the stack cow.push(thing); //append a right parenthesis to the end of inFix array strcat(inFix, ")"); int i = 0;//declare an int that will control posFix position //if the stack is not empty if (!cow.isEmpty()) { //loop to run until the last character in inFix array for (int x = 0; inFix[x]!= '\0'; x++ ) { //if the inFix element is a digit if (isdigit(inFix[x])) { postFix[i]=inFix[x];//it is assigned to the next element in postFix array i++;//move on to next element in postFix } //if the inFix element is a left parenthesis else if (inFix[x]=='(') { cow.push(inFix[x]);//push it unto the stack } //if the inFix element is an operator else if (isOperator(inFix[x])) { char oper2 = inFix[x];//char variable holds inFix operator if (isOperator(cow.stackTop()))//if the top node in the stack is an operator { while (isOperator(cow.stackTop()))//and while the top node in the stack is an operator { char oper1 = cow.stackTop();//char variable holds node operator if(precedence( oper1, oper2))//if the node operator has higher presedence than node operator { postFix[i] = cow.pop();//we pop such operator and insert it in postFix array's next element cow.push(inFix[x]);//and push inFix operator unto the stack i++;//move to the next element in posFix } } } //if the top node is not an operator //we push the current inFix operator unto the top of the stack else cow.push(inFix[x]); } //if the inFix element is a right parenthesis else if (inFix[x]==')') { //we pop everything in the stack and insert it in postFix //until we arrive at a left paranthesis while (cow.stackTop()!='(') { postFix[i] = cow.pop(); i++; } //we then pop and discard left parenthesis cow.pop(); } } postFix[i]='\0'; //print !!postFix array!! (not stack) print();//code for this is just cout<<postFix; }

  Read the article

• manuplating matrix operation(transpose, negation, addition, and mutipication) using functions in c

  - by user292489

  i was trying to manuplate matrices in my input file using functions. my input file is, A 3 3 1 2 3 4 5 6 7 8 9 B 3 3 1 0 0 0 1 0 0 0 1 C 2 3 3 5 8 -1 -2 -3 D 3 5 0 0 0 1 0 1 0 1 0 1 0 1 0 0 1 E 1 1 10 F 3 10 1 0 2 0 3 0 4 0 5 0 0 2 3 -1 -3 -4 -3 8 3 7 0 0 0 4 6 5 8 2 -1 10 i am having trouble in impementing the funcitons that i declared. i assumed my program will perform those operations: transpose, negate, add, and mutiply matices according to the users choise: /* once this program is compliled and excuted, it will perform the basic matrix operations: negation, transpose,a\ ddition, and multiplication. */ #include <stdio.h> #include <stdlib.h> #define MAX 10 int readmatrix(FILE *input, char martixname[6],int , mat[10][10], int i, int j); void printmatrix(char matrixname[6], int mat[10][10], int i, int j); void Negate(char matrixname[6], int mat[10][10], int i, int j); void add(char matrixname[6], int mat[10][10],int i, int k); void multiply(char matrixname[], int mat[][10], char A[], int i, int k); void transpose (char matrixname[], int mat[][10], char A[], int); void printT(int mat[][10], int); int selctoption(); char selectmatrix(); int main(int argc, char *argv[]) { char matrixtype[6]; int mat[][10]; FILE *filein; int size; int optionop; int matrixop; int option; if (argc != 2) { printf("Usage: excutable input.\n"); exit (0); } filein = fopen(argv[1], "r"); if (!filein) { printf("ERROR: input file not found.\n"); exit (0); } size = readmatrix (filein, matrixtype); printmatrix(matrix[][10], size); option = selectoption(); matrixtype = selectmatrix(); //printf("You have: %5.2f ", deposit); optionop = readmatrix(option, matrix[][10], size); if (choiceop == 6) { printf("Thanks for using the matrix operation program.\n"); exit(0); } printf("Please select from the following matrix operations:\n") printf("\t1. Print matrix\n"); printf("\t2. Negate matrix\n"); printf("\t3. Transpose matrix\n"); printf("\t4. Add matrices\n"); printf("\t5. Multiply matrices\n"); printf("\t6. Quit\n"); fclose(filein); return 0; } do { printf("Please select option(1-%d):", optionop); scanf("%d", &matrixop); }while(matrixop <= 0 || matrixop > optionop); void readmatrix (FILE *in, int mat[][10], char A[], int i, int j) { int i=0,j = 0; while (fscanf(in, "%d", &mat[i][j]) != EOF) return 0; } // i would apprtaite anyones feedback. //thank you!

  Read the article

• INSERT INTO in MS Access 2010 SOMETIMES GETS ERROR: 3073 Operation must use an updateable query

  - by Gary

  I get the ERROR: 3073 Operation must use an updateable query SOMETIMES, while performing an INSERT statment. I have no problem on my windows 7 PC, but the person I am writing this for sometimes gets the error. She also has MS Access 2010 on Windows 7. As I said I have never got it on my PC, and she only gets it sometimes. The code will insert a number of rows and then through the error, and other times not through the erro at all. The error occurs if I have the code and data in one .mdb file or seperate files. Here a snippet of code: OrderHdrInsertStmnt = " INSERT INTO ORDER_HDR " _ & "(ORDER_ID, SOURCE_CODE, ORDER_DATE, SHIP_FNAME, SHIP_LNAME, SHIP_EMAIL, SHIP_COMP, SHIP_PHONE, SHIP_ADDR, SHIP_CITY, SHIP_STATE, SHIP_ZIP, SHIP_CNTRY, " _ & " BILL_FNAME, BILL_LNAME, BILL_EMAIL, BILL_COMP, BILL_PHONE, BILL_ADDR, BILL_CITY, BILL_STATE, BILL_ZIP, BILL_CNTRY, " _ & " TAX, SHIPPING, TOTAL, MOD_DATE, INSERT_DATE) " _ & " VALUES (" _ & "'" & OrderId & "','" & SourceCode & "','" & Orderdate & "','" & ShipFName & "','" & ShipLName & "','" & ShipEmail & "','" & ShipComp & "','" & ShipPhone & "','" & ShipAddr & "','" & ShipCity & "','" & ShipState & "','" & ShipZip & "','" & ShipCntry _ & "','" & BillFName & "','" & BillLName & "','" & BillEmail & "','" & BillComp & "','" & BillPhone & "','" & BillAddr & "','" & BillCity & "','" & BillState & "','" & BillZip & "','" & BillCntry _ & "','" & OrderTax & "','" & OrderShipping & "','" & OrderTotal & "','" & ImportDate & "','" & ImportDate & "');" then I use dbsCurrent.Execute OrderHdrInsertStmnt, dbFailOnError Any assistance would be great!

  Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >