Search Results

Search found 2776 results on 112 pages for 'overlapping matches'.

Page 28/112 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Evenly distibuted scatterViewItems that dont overlap

    - by Christo Fur
    Hi I have an app that creates a variable number of ScatterviewItems based on which tagged object is placed on the surface table. The ScatterViewItems are added programatically to the ScatterView based on info looked up in a DB The Scatterview does a good job of displaying this info However, I would like them to be evenly distributed across the table and not have any items overlapping Any ideas how to do that?

    Read the article

  • Flash Animation and Sound Loop

    - by Joseph
    ok so im having an issue with Flash CS5. I have a sound looping, and my animation is only 13 frames long, while the song is like a minute long, so each time the animation loops threw the default "Loop Playback" a new sound audio is played which os overlapping the previous over and over causing a massive echo effect. Whats the best way to loop both of them insync, or atleast copy and paste the animations frames and make it the length of the song?

    Read the article

  • Removing specific ticks from matplotlib plot

    - by Jsg91
    I'm trying to remove the origin ticks from my plot below to stop them overlapping, alternatively just moving them away from each other would also be great I tried this: xticks = ax.xaxis.get_major_ticks() xticks[0].label1.set_visible(False) yticks = ax.yaxis.get_major_ticks() yticks[0].label1.set_visible(False) However this removed the first and last ticks from the y axis like so: Does anyone have an idea about how to do this? Any help would be greatly appreciated.

    Read the article

  • How to host 50 domains/sites with common Django code base

    - by Off Rhoden
    I have 50 different websites that use the same layout and code base, but mostly non-overlapping data (regional support sites, not link farm). Is there a way to have a single installation of the code and run all 50 at the same time? When I have a bug to fix (or deploy new feature), I want to deploy ONE time + 1 restart and be done with it. Also: Code needs to know what domain the request is coming to so the appropriate data is displayed.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Tababar application in iphone

    - by Harita
    hi i am making an tabbar application in which i have 4 tabbars. tabbars are working perfectly, my problem is that the title is overlapping over other tab bar. Title are a bit long like Instructional Videos. how can i fix it.

    Read the article

  • I want to add ranges of rates for which I have a particular %

    - by happy
    My problem is I should add rates without overlapping and if a range of rates is missed while adding a new range I should display a message saying the range is missed. Example: 200 300 ----- 3% 300 400 ------5% and if I am adding new range, say 600 800 ------10% I should get a message saying the ranges 401 to 599 is missing.

    Read the article

  • Android strange behavior with listview and custom cursor adapter

    - by Michael Little
    I have a problem with a list view and a custom cursor adapter and I just can't seem to figure out what is wrong with my code. Basically, in my activity I call initalize() that does a bunch of stuff to handle getting the proper data and initializing the listview. On first run of the activity you can see from the images that one of the items is missing from the list. If I go to another activity and go back to this activity the item that was missing shows up. I believe it has something to do with setContentView(R.layout.parent). If I move that to my initialize() then the item never shows up even when returning from another activity. So, for some reason, returning from another activity bypasses setContentView(R.layout.parent) and everything works fine. I know it's impossible for me to bypass setContentView(R.layout.parent) so I need to figure out what the problem is. Also, I did not include the layout because it is nothing more then two textviews. Also, the images I have attached do not show that the missing item is the last one on the list. Custom Cursor Adapter: public class CustomCursorAdapter extends SimpleCursorAdapter { private Context context; private int layout; public CustomCursorAdapter (Context context, int layout, Cursor c, String[] from, int[] to) { super(context, layout, c, from, to); this.context = context; this.layout = layout; } public View newView(Context context, Cursor cursor, ViewGroup parent) { LayoutInflater inflater = LayoutInflater.from(context); final View view = inflater.inflate(layout, parent, false); return view; } @Override public void bindView(View v, Context context, Cursor c) { if (c.getColumnName(0).matches("section")){ int nameCol = c.getColumnIndex("section"); String section = c.getString(nameCol); TextView section_text = (TextView) v.findViewById(R.id.text1); if ((section.length() > 0)) { section_text.setText(section); } else { //so we don't have an empty spot section_text.setText(""); section_text.setVisibility(2); section_text.setHeight(1); } } else if (c.getColumnName(0).matches("code")) { int nameCol = c.getColumnIndex("code"); String mCode = c.getString(nameCol); TextView code_text = (TextView) v.findViewById(R.id.text1); if (code_text != null) { int i = 167; byte[] data = {(byte) i}; String strSymbol = EncodingUtils.getString(data, "windows-1252"); mCode = strSymbol + " " + mCode; code_text.setText(mCode); code_text.setSingleLine(); } } if (c.getColumnName(1).matches("title")){ int nameCol = c.getColumnIndex("title"); String mTitle = c.getString(nameCol); TextView title_text = (TextView) v.findViewById(R.id.text2); if (title_text != null) { title_text.setText(mTitle); } } else if (c.getColumnName(1).matches("excerpt")) { int nameCol = c.getColumnIndex("excerpt"); String mExcerpt = c.getString(nameCol); TextView excerpt_text = (TextView) v.findViewById(R.id.text2); if (excerpt_text != null) { excerpt_text.setText(mExcerpt); excerpt_text.setSingleLine(); } } } The Activity: public class parent extends ListActivity { private static String[] TITLE_FROM = { SECTION, TITLE, _ID, }; private static String[] CODE_FROM = { CODE, EXCERPT, _ID, }; private static String ORDER_BY = _ID + " ASC"; private static int[] TO = { R.id.text1, R.id.text2, }; String breadcrumb = null; private MyData data; private SQLiteDatabase db; CharSequence parent_id = ""; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); data = new MyData(this); db = data.getReadableDatabase(); setContentView(R.layout.parent); initialize(); } public void initialize() { breadcrumb = null; Bundle bun = getIntent().getExtras(); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); if (bun == null) { //this is the first run tvBreadCrumb.setText(null); tvBreadCrumb.setHeight(0); parent_id = "0"; try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else { CharSequence state = bun.getString("state"); breadcrumb = bun.getString("breadcrumb"); tvBreadCrumb.setText(breadcrumb); CharSequence code = bun.getString("code"); parent_id = code; if (state.equals("chapter")) { try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else if (state.equals("code")) { try { Cursor cursor = getCodeData(parent_id); showCodeData(cursor); } finally { data.close(); } } } } @Override public void onStart() { //initialize(); super.onResume(); } @Override public void onResume() { initialize(); super.onResume(); } private Cursor getData(CharSequence parent_id) { Cursor cTitles = db.query(TITLES_TABLE_NAME, TITLE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor cCodes = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor[] c = {cTitles, cCodes}; Cursor cursor = new MergeCursor(c); startManagingCursor(cursor); return cursor; } private Cursor getCodeData(CharSequence parent_id2) { Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); CharSequence searchtype = bun.getString("searchtype"); //SQLiteDatabase db = data.getReadableDatabase(); if (intent != null) { String sWhere = null; if(searchtype.equals("code")) { sWhere = "code LIKE '%"+parent_id2+"%'"; } else if(searchtype.equals("within")){ sWhere = "definition LIKE '%"+parent_id2+"%'"; } //This is a search request Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, sWhere, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } else { Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = "+ parent_id2, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } } private void showSectionData(Cursor cursor) { CustomCursorAdapter adapter= new CustomCursorAdapter(this, R.layout.item, cursor, TITLE_FROM, TO); setListAdapter(adapter); } private void showCodeData(Cursor cursor) { CustomCursorAdapter adapter = new CustomCursorAdapter(this, R.layout.item, cursor, CODE_FROM, TO); setListAdapter(adapter); Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); if (intent != null) { Cursor cursor1 = ((CursorAdapter)getListAdapter()).getCursor(); startManagingCursor(cursor1); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); tvBreadCrumb.setText(cursor1.getCount() + " Records Found"); //cursor1.close(); //mdl } }

    Read the article

  • Service Discovery in WCF 4.0 &ndash; Part 1

    - by Shaun
    When designing a service oriented architecture (SOA) system, there will be a lot of services with many service contracts, endpoints and behaviors. Besides the client calling the service, in a large distributed system a service may invoke other services. In this case, one service might need to know the endpoints it invokes. This might not be a problem in a small system. But when you have more than 10 services this might be a problem. For example in my current product, there are around 10 services, such as the user authentication service, UI integration service, location service, license service, device monitor service, event monitor service, schedule job service, accounting service, player management service, etc..   Benefit of Discovery Service Since almost all my services need to invoke at least one other service. This would be a difficult task to make sure all services endpoints are configured correctly in every service. And furthermore, it would be a nightmare when a service changed its endpoint at runtime. Hence, we need a discovery service to remove the dependency (configuration dependency). A discovery service plays as a service dictionary which stores the relationship between the contracts and the endpoints for every service. By using the discovery service, when service X wants to invoke service Y, it just need to ask the discovery service where is service Y, then the discovery service will return all proper endpoints of service Y, then service X can use the endpoint to send the request to service Y. And when some services changed their endpoint address, all need to do is to update its records in the discovery service then all others will know its new endpoint. In WCF 4.0 Discovery it supports both managed proxy discovery mode and ad-hoc discovery mode. In ad-hoc mode there is no standalone discovery service. When a client wanted to invoke a service, it will broadcast an message (normally in UDP protocol) to the entire network with the service match criteria. All services which enabled the discovery behavior will receive this message and only those matched services will send their endpoint back to the client. The managed proxy discovery service works as I described above. In this post I will only cover the managed proxy mode, where there’s a discovery service. For more information about the ad-hoc mode please refer to the MSDN.   Service Announcement and Probe The main functionality of discovery service should be return the proper endpoint addresses back to the service who is looking for. In most cases the consume service (as a client) will send the contract which it wanted to request to the discovery service. And then the discovery service will find the endpoint and respond. Sometimes the contract and endpoint are not enough. It also contains versioning, extensions attributes. This post I will only cover the case includes contract and endpoint. When a client (or sometimes a service who need to invoke another service) need to connect to a target service, it will firstly request the discovery service through the “Probe” method with the criteria. Basically the criteria contains the contract type name of the target service. Then the discovery service will search its endpoint repository by the criteria. The repository might be a database, a distributed cache or a flat XML file. If it matches, the discovery service will grab the endpoint information (it’s called discovery endpoint metadata in WCF) and send back. And this is called “Probe”. Finally the client received the discovery endpoint metadata and will use the endpoint to connect to the target service. Besides the probe, discovery service should take the responsible to know there is a new service available when it goes online, as well as stopped when it goes offline. This feature is named “Announcement”. When a service started and stopped, it will announce to the discovery service. So the basic functionality of a discovery service should includes: 1, An endpoint which receive the service online message, and add the service endpoint information in the discovery repository. 2, An endpoint which receive the service offline message, and remove the service endpoint information from the discovery repository. 3, An endpoint which receive the client probe message, and return the matches service endpoints, and return the discovery endpoint metadata. WCF 4.0 discovery service just covers all these features in it's infrastructure classes.   Discovery Service in WCF 4.0 WCF 4.0 introduced a new assembly named System.ServiceModel.Discovery which has all necessary classes and interfaces to build a WS-Discovery compliant discovery service. It supports ad-hoc and managed proxy modes. For the case mentioned in this post, what we need to build is a standalone discovery service, which is the managed proxy discovery service mode. To build a managed discovery service in WCF 4.0 just create a new class inherits from the abstract class System.ServiceModel.Discovery.DiscoveryProxy. This class implemented and abstracted the procedures of service announcement and probe. And it exposes 8 abstract methods where we can implement our own endpoint register, unregister and find logic. These 8 methods are asynchronized, which means all invokes to the discovery service are asynchronously, for better service capability and performance. 1, OnBeginOnlineAnnouncement, OnEndOnlineAnnouncement: Invoked when a service sent the online announcement message. We need to add the endpoint information to the repository in this method. 2, OnBeginOfflineAnnouncement, OnEndOfflineAnnouncement: Invoked when a service sent the offline announcement message. We need to remove the endpoint information from the repository in this method. 3, OnBeginFind, OnEndFind: Invoked when a client sent the probe message that want to find the service endpoint information. We need to look for the proper endpoints by matching the client’s criteria through the repository in this method. 4, OnBeginResolve, OnEndResolve: Invoked then a client sent the resolve message. Different from the find method, when using resolve method the discovery service will return the exactly one service endpoint metadata to the client. In our example we will NOT implement this method.   Let’s create our own discovery service, inherit the base System.ServiceModel.Discovery.DiscoveryProxy. We also need to specify the service behavior in this class. Since the build-in discovery service host class only support the singleton mode, we must set its instance context mode to single. 1: using System; 2: using System.Collections.Generic; 3: using System.Linq; 4: using System.Text; 5: using System.ServiceModel.Discovery; 6: using System.ServiceModel; 7:  8: namespace Phare.Service 9: { 10: [ServiceBehavior(InstanceContextMode = InstanceContextMode.Single, ConcurrencyMode = ConcurrencyMode.Multiple)] 11: public class ManagedProxyDiscoveryService : DiscoveryProxy 12: { 13: protected override IAsyncResult OnBeginFind(FindRequestContext findRequestContext, AsyncCallback callback, object state) 14: { 15: throw new NotImplementedException(); 16: } 17:  18: protected override IAsyncResult OnBeginOfflineAnnouncement(DiscoveryMessageSequence messageSequence, EndpointDiscoveryMetadata endpointDiscoveryMetadata, AsyncCallback callback, object state) 19: { 20: throw new NotImplementedException(); 21: } 22:  23: protected override IAsyncResult OnBeginOnlineAnnouncement(DiscoveryMessageSequence messageSequence, EndpointDiscoveryMetadata endpointDiscoveryMetadata, AsyncCallback callback, object state) 24: { 25: throw new NotImplementedException(); 26: } 27:  28: protected override IAsyncResult OnBeginResolve(ResolveCriteria resolveCriteria, AsyncCallback callback, object state) 29: { 30: throw new NotImplementedException(); 31: } 32:  33: protected override void OnEndFind(IAsyncResult result) 34: { 35: throw new NotImplementedException(); 36: } 37:  38: protected override void OnEndOfflineAnnouncement(IAsyncResult result) 39: { 40: throw new NotImplementedException(); 41: } 42:  43: protected override void OnEndOnlineAnnouncement(IAsyncResult result) 44: { 45: throw new NotImplementedException(); 46: } 47:  48: protected override EndpointDiscoveryMetadata OnEndResolve(IAsyncResult result) 49: { 50: throw new NotImplementedException(); 51: } 52: } 53: } Then let’s implement the online, offline and find methods one by one. WCF discovery service gives us full flexibility to implement the endpoint add, remove and find logic. For the demo purpose we will use an internal dictionary to store the services’ endpoint metadata. In the next post we will see how to serialize and store these information in database. Define a concurrent dictionary inside the service class since our it will be used in the multiple threads scenario. 1: [ServiceBehavior(InstanceContextMode = InstanceContextMode.Single, ConcurrencyMode = ConcurrencyMode.Multiple)] 2: public class ManagedProxyDiscoveryService : DiscoveryProxy 3: { 4: private ConcurrentDictionary<EndpointAddress, EndpointDiscoveryMetadata> _services; 5:  6: public ManagedProxyDiscoveryService() 7: { 8: _services = new ConcurrentDictionary<EndpointAddress, EndpointDiscoveryMetadata>(); 9: } 10: } Then we can simply implement the logic of service online and offline. 1: protected override IAsyncResult OnBeginOnlineAnnouncement(DiscoveryMessageSequence messageSequence, EndpointDiscoveryMetadata endpointDiscoveryMetadata, AsyncCallback callback, object state) 2: { 3: _services.AddOrUpdate(endpointDiscoveryMetadata.Address, endpointDiscoveryMetadata, (key, value) => endpointDiscoveryMetadata); 4: return new OnOnlineAnnouncementAsyncResult(callback, state); 5: } 6:  7: protected override void OnEndOnlineAnnouncement(IAsyncResult result) 8: { 9: OnOnlineAnnouncementAsyncResult.End(result); 10: } 11:  12: protected override IAsyncResult OnBeginOfflineAnnouncement(DiscoveryMessageSequence messageSequence, EndpointDiscoveryMetadata endpointDiscoveryMetadata, AsyncCallback callback, object state) 13: { 14: EndpointDiscoveryMetadata endpoint = null; 15: _services.TryRemove(endpointDiscoveryMetadata.Address, out endpoint); 16: return new OnOfflineAnnouncementAsyncResult(callback, state); 17: } 18:  19: protected override void OnEndOfflineAnnouncement(IAsyncResult result) 20: { 21: OnOfflineAnnouncementAsyncResult.End(result); 22: } Regards the find method, the parameter FindRequestContext.Criteria has a method named IsMatch, which can be use for us to evaluate which service metadata is satisfied with the criteria. So the implementation of find method would be like this. 1: protected override IAsyncResult OnBeginFind(FindRequestContext findRequestContext, AsyncCallback callback, object state) 2: { 3: _services.Where(s => findRequestContext.Criteria.IsMatch(s.Value)) 4: .Select(s => s.Value) 5: .All(meta => 6: { 7: findRequestContext.AddMatchingEndpoint(meta); 8: return true; 9: }); 10: return new OnFindAsyncResult(callback, state); 11: } 12:  13: protected override void OnEndFind(IAsyncResult result) 14: { 15: OnFindAsyncResult.End(result); 16: } As you can see, we checked all endpoints metadata in repository by invoking the IsMatch method. Then add all proper endpoints metadata into the parameter. Finally since all these methods are asynchronized we need some AsyncResult classes as well. Below are the base class and the inherited classes used in previous methods. 1: using System; 2: using System.Collections.Generic; 3: using System.Linq; 4: using System.Text; 5: using System.Threading; 6:  7: namespace Phare.Service 8: { 9: abstract internal class AsyncResult : IAsyncResult 10: { 11: AsyncCallback callback; 12: bool completedSynchronously; 13: bool endCalled; 14: Exception exception; 15: bool isCompleted; 16: ManualResetEvent manualResetEvent; 17: object state; 18: object thisLock; 19:  20: protected AsyncResult(AsyncCallback callback, object state) 21: { 22: this.callback = callback; 23: this.state = state; 24: this.thisLock = new object(); 25: } 26:  27: public object AsyncState 28: { 29: get 30: { 31: return state; 32: } 33: } 34:  35: public WaitHandle AsyncWaitHandle 36: { 37: get 38: { 39: if (manualResetEvent != null) 40: { 41: return manualResetEvent; 42: } 43: lock (ThisLock) 44: { 45: if (manualResetEvent == null) 46: { 47: manualResetEvent = new ManualResetEvent(isCompleted); 48: } 49: } 50: return manualResetEvent; 51: } 52: } 53:  54: public bool CompletedSynchronously 55: { 56: get 57: { 58: return completedSynchronously; 59: } 60: } 61:  62: public bool IsCompleted 63: { 64: get 65: { 66: return isCompleted; 67: } 68: } 69:  70: object ThisLock 71: { 72: get 73: { 74: return this.thisLock; 75: } 76: } 77:  78: protected static TAsyncResult End<TAsyncResult>(IAsyncResult result) 79: where TAsyncResult : AsyncResult 80: { 81: if (result == null) 82: { 83: throw new ArgumentNullException("result"); 84: } 85:  86: TAsyncResult asyncResult = result as TAsyncResult; 87:  88: if (asyncResult == null) 89: { 90: throw new ArgumentException("Invalid async result.", "result"); 91: } 92:  93: if (asyncResult.endCalled) 94: { 95: throw new InvalidOperationException("Async object already ended."); 96: } 97:  98: asyncResult.endCalled = true; 99:  100: if (!asyncResult.isCompleted) 101: { 102: asyncResult.AsyncWaitHandle.WaitOne(); 103: } 104:  105: if (asyncResult.manualResetEvent != null) 106: { 107: asyncResult.manualResetEvent.Close(); 108: } 109:  110: if (asyncResult.exception != null) 111: { 112: throw asyncResult.exception; 113: } 114:  115: return asyncResult; 116: } 117:  118: protected void Complete(bool completedSynchronously) 119: { 120: if (isCompleted) 121: { 122: throw new InvalidOperationException("This async result is already completed."); 123: } 124:  125: this.completedSynchronously = completedSynchronously; 126:  127: if (completedSynchronously) 128: { 129: this.isCompleted = true; 130: } 131: else 132: { 133: lock (ThisLock) 134: { 135: this.isCompleted = true; 136: if (this.manualResetEvent != null) 137: { 138: this.manualResetEvent.Set(); 139: } 140: } 141: } 142:  143: if (callback != null) 144: { 145: callback(this); 146: } 147: } 148:  149: protected void Complete(bool completedSynchronously, Exception exception) 150: { 151: this.exception = exception; 152: Complete(completedSynchronously); 153: } 154: } 155: } 1: using System; 2: using System.Collections.Generic; 3: using System.Linq; 4: using System.Text; 5: using System.ServiceModel.Discovery; 6: using Phare.Service; 7:  8: namespace Phare.Service 9: { 10: internal sealed class OnOnlineAnnouncementAsyncResult : AsyncResult 11: { 12: public OnOnlineAnnouncementAsyncResult(AsyncCallback callback, object state) 13: : base(callback, state) 14: { 15: this.Complete(true); 16: } 17:  18: public static void End(IAsyncResult result) 19: { 20: AsyncResult.End<OnOnlineAnnouncementAsyncResult>(result); 21: } 22:  23: } 24:  25: sealed class OnOfflineAnnouncementAsyncResult : AsyncResult 26: { 27: public OnOfflineAnnouncementAsyncResult(AsyncCallback callback, object state) 28: : base(callback, state) 29: { 30: this.Complete(true); 31: } 32:  33: public static void End(IAsyncResult result) 34: { 35: AsyncResult.End<OnOfflineAnnouncementAsyncResult>(result); 36: } 37: } 38:  39: sealed class OnFindAsyncResult : AsyncResult 40: { 41: public OnFindAsyncResult(AsyncCallback callback, object state) 42: : base(callback, state) 43: { 44: this.Complete(true); 45: } 46:  47: public static void End(IAsyncResult result) 48: { 49: AsyncResult.End<OnFindAsyncResult>(result); 50: } 51: } 52:  53: sealed class OnResolveAsyncResult : AsyncResult 54: { 55: EndpointDiscoveryMetadata matchingEndpoint; 56:  57: public OnResolveAsyncResult(EndpointDiscoveryMetadata matchingEndpoint, AsyncCallback callback, object state) 58: : base(callback, state) 59: { 60: this.matchingEndpoint = matchingEndpoint; 61: this.Complete(true); 62: } 63:  64: public static EndpointDiscoveryMetadata End(IAsyncResult result) 65: { 66: OnResolveAsyncResult thisPtr = AsyncResult.End<OnResolveAsyncResult>(result); 67: return thisPtr.matchingEndpoint; 68: } 69: } 70: } Now we have finished the discovery service. The next step is to host it. The discovery service is a standard WCF service. So we can use ServiceHost on a console application, windows service, or in IIS as usual. The following code is how to host the discovery service we had just created in a console application. 1: static void Main(string[] args) 2: { 3: using (var host = new ServiceHost(new ManagedProxyDiscoveryService())) 4: { 5: host.Opened += (sender, e) => 6: { 7: host.Description.Endpoints.All((ep) => 8: { 9: Console.WriteLine(ep.ListenUri); 10: return true; 11: }); 12: }; 13:  14: try 15: { 16: // retrieve the announcement, probe endpoint and binding from configuration 17: var announcementEndpointAddress = new EndpointAddress(ConfigurationManager.AppSettings["announcementEndpointAddress"]); 18: var probeEndpointAddress = new EndpointAddress(ConfigurationManager.AppSettings["probeEndpointAddress"]); 19: var binding = Activator.CreateInstance(Type.GetType(ConfigurationManager.AppSettings["bindingType"], true, true)) as Binding; 20: var announcementEndpoint = new AnnouncementEndpoint(binding, announcementEndpointAddress); 21: var probeEndpoint = new DiscoveryEndpoint(binding, probeEndpointAddress); 22: probeEndpoint.IsSystemEndpoint = false; 23: // append the service endpoint for announcement and probe 24: host.AddServiceEndpoint(announcementEndpoint); 25: host.AddServiceEndpoint(probeEndpoint); 26:  27: host.Open(); 28:  29: Console.WriteLine("Press any key to exit."); 30: Console.ReadKey(); 31: } 32: catch (Exception ex) 33: { 34: Console.WriteLine(ex.ToString()); 35: } 36: } 37:  38: Console.WriteLine("Done."); 39: Console.ReadKey(); 40: } What we need to notice is that, the discovery service needs two endpoints for announcement and probe. In this example I just retrieve them from the configuration file. I also specified the binding of these two endpoints in configuration file as well. 1: <?xml version="1.0"?> 2: <configuration> 3: <startup> 4: <supportedRuntime version="v4.0" sku=".NETFramework,Version=v4.0"/> 5: </startup> 6: <appSettings> 7: <add key="announcementEndpointAddress" value="net.tcp://localhost:10010/announcement"/> 8: <add key="probeEndpointAddress" value="net.tcp://localhost:10011/probe"/> 9: <add key="bindingType" value="System.ServiceModel.NetTcpBinding, System.ServiceModel, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089"/> 10: </appSettings> 11: </configuration> And this is the console screen when I ran my discovery service. As you can see there are two endpoints listening for announcement message and probe message.   Discoverable Service and Client Next, let’s create a WCF service that is discoverable, which means it can be found by the discovery service. To do so, we need to let the service send the online announcement message to the discovery service, as well as offline message before it shutdown. Just create a simple service which can make the incoming string to upper. The service contract and implementation would be like this. 1: [ServiceContract] 2: public interface IStringService 3: { 4: [OperationContract] 5: string ToUpper(string content); 6: } 1: public class StringService : IStringService 2: { 3: public string ToUpper(string content) 4: { 5: return content.ToUpper(); 6: } 7: } Then host this service in the console application. In order to make the discovery service easy to be tested the service address will be changed each time it’s started. 1: static void Main(string[] args) 2: { 3: var baseAddress = new Uri(string.Format("net.tcp://localhost:11001/stringservice/{0}/", Guid.NewGuid().ToString())); 4:  5: using (var host = new ServiceHost(typeof(StringService), baseAddress)) 6: { 7: host.Opened += (sender, e) => 8: { 9: Console.WriteLine("Service opened at {0}", host.Description.Endpoints.First().ListenUri); 10: }; 11:  12: host.AddServiceEndpoint(typeof(IStringService), new NetTcpBinding(), string.Empty); 13:  14: host.Open(); 15:  16: Console.WriteLine("Press any key to exit."); 17: Console.ReadKey(); 18: } 19: } Currently this service is NOT discoverable. We need to add a special service behavior so that it could send the online and offline message to the discovery service announcement endpoint when the host is opened and closed. WCF 4.0 introduced a service behavior named ServiceDiscoveryBehavior. When we specified the announcement endpoint address and appended it to the service behaviors this service will be discoverable. 1: var announcementAddress = new EndpointAddress(ConfigurationManager.AppSettings["announcementEndpointAddress"]); 2: var announcementBinding = Activator.CreateInstance(Type.GetType(ConfigurationManager.AppSettings["bindingType"], true, true)) as Binding; 3: var announcementEndpoint = new AnnouncementEndpoint(announcementBinding, announcementAddress); 4: var discoveryBehavior = new ServiceDiscoveryBehavior(); 5: discoveryBehavior.AnnouncementEndpoints.Add(announcementEndpoint); 6: host.Description.Behaviors.Add(discoveryBehavior); The ServiceDiscoveryBehavior utilizes the service extension and channel dispatcher to implement the online and offline announcement logic. In short, it injected the channel open and close procedure and send the online and offline message to the announcement endpoint.   On client side, when we have the discovery service, a client can invoke a service without knowing its endpoint. WCF discovery assembly provides a class named DiscoveryClient, which can be used to find the proper service endpoint by passing the criteria. In the code below I initialized the DiscoveryClient, specified the discovery service probe endpoint address. Then I created the find criteria by specifying the service contract I wanted to use and invoke the Find method. This will send the probe message to the discovery service and it will find the endpoints back to me. The discovery service will return all endpoints that matches the find criteria, which means in the result of the find method there might be more than one endpoints. In this example I just returned the first matched one back. In the next post I will show how to extend our discovery service to make it work like a service load balancer. 1: static EndpointAddress FindServiceEndpoint() 2: { 3: var probeEndpointAddress = new EndpointAddress(ConfigurationManager.AppSettings["probeEndpointAddress"]); 4: var probeBinding = Activator.CreateInstance(Type.GetType(ConfigurationManager.AppSettings["bindingType"], true, true)) as Binding; 5: var discoveryEndpoint = new DiscoveryEndpoint(probeBinding, probeEndpointAddress); 6:  7: EndpointAddress address = null; 8: FindResponse result = null; 9: using (var discoveryClient = new DiscoveryClient(discoveryEndpoint)) 10: { 11: result = discoveryClient.Find(new FindCriteria(typeof(IStringService))); 12: } 13:  14: if (result != null && result.Endpoints.Any()) 15: { 16: var endpointMetadata = result.Endpoints.First(); 17: address = endpointMetadata.Address; 18: } 19: return address; 20: } Once we probed the discovery service we will receive the endpoint. So in the client code we can created the channel factory from the endpoint and binding, and invoke to the service. When creating the client side channel factory we need to make sure that the client side binding should be the same as the service side. WCF discovery service can be used to find the endpoint for a service contract, but the binding is NOT included. This is because the binding was not in the WS-Discovery specification. In the next post I will demonstrate how to add the binding information into the discovery service. At that moment the client don’t need to create the binding by itself. Instead it will use the binding received from the discovery service. 1: static void Main(string[] args) 2: { 3: Console.WriteLine("Say something..."); 4: var content = Console.ReadLine(); 5: while (!string.IsNullOrWhiteSpace(content)) 6: { 7: Console.WriteLine("Finding the service endpoint..."); 8: var address = FindServiceEndpoint(); 9: if (address == null) 10: { 11: Console.WriteLine("There is no endpoint matches the criteria."); 12: } 13: else 14: { 15: Console.WriteLine("Found the endpoint {0}", address.Uri); 16:  17: var factory = new ChannelFactory<IStringService>(new NetTcpBinding(), address); 18: factory.Opened += (sender, e) => 19: { 20: Console.WriteLine("Connecting to {0}.", factory.Endpoint.ListenUri); 21: }; 22: var proxy = factory.CreateChannel(); 23: using (proxy as IDisposable) 24: { 25: Console.WriteLine("ToUpper: {0} => {1}", content, proxy.ToUpper(content)); 26: } 27: } 28:  29: Console.WriteLine("Say something..."); 30: content = Console.ReadLine(); 31: } 32: } Similarly, the discovery service probe endpoint and binding were defined in the configuration file. 1: <?xml version="1.0"?> 2: <configuration> 3: <startup> 4: <supportedRuntime version="v4.0" sku=".NETFramework,Version=v4.0"/> 5: </startup> 6: <appSettings> 7: <add key="announcementEndpointAddress" value="net.tcp://localhost:10010/announcement"/> 8: <add key="probeEndpointAddress" value="net.tcp://localhost:10011/probe"/> 9: <add key="bindingType" value="System.ServiceModel.NetTcpBinding, System.ServiceModel, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089"/> 10: </appSettings> 11: </configuration> OK, now let’s have a test. Firstly start the discovery service, and then start our discoverable service. When it started it will announced to the discovery service and registered its endpoint into the repository, which is the local dictionary. And then start the client and type something. As you can see the client asked the discovery service for the endpoint and then establish the connection to the discoverable service. And more interesting, do NOT close the client console but terminate the discoverable service but press the enter key. This will make the service send the offline message to the discovery service. Then start the discoverable service again. Since we made it use a different address each time it started, currently it should be hosted on another address. If we enter something in the client we could see that it asked the discovery service and retrieve the new endpoint, and connect the the service.   Summary In this post I discussed the benefit of using the discovery service and the procedures of service announcement and probe. I also demonstrated how to leverage the WCF Discovery feature in WCF 4.0 to build a simple managed discovery service. For test purpose, in this example I used the in memory dictionary as the discovery endpoint metadata repository. And when finding I also just return the first matched endpoint back. I also hard coded the bindings between the discoverable service and the client. In next post I will show you how to solve the problem mentioned above, as well as some additional feature for production usage. You can download the code here.   Hope this helps, Shaun All documents and related graphics, codes are provided "AS IS" without warranty of any kind. Copyright © Shaun Ziyan Xu. This work is licensed under the Creative Commons License.

    Read the article

  • How can a code editor effectively hint at code nesting level - without using indentation?

    - by pgfearo
    I've written an XML text editor that provides 2 view options for the same XML text, one indented (virtually), the other left-justified. The motivation for the left-justified view is to help users 'see' the whitespace characters they're using for indentation of plain-text or XPath code without interference from indentation that is an automated side-effect of the XML context. I want to provide visual clues (in the non-editable part of the editor) for the left-justified mode that will help the user, but without getting too elaborate. I tried just using connecting lines, but that seemed too busy. The best I've come up with so far is shown in a mocked up screenshot of the editor below, but I'm seeking better/simpler alternatives (that don't require too much code). [Edit] Taking the heatmap idea (from: @jimp) I get this and 3 alternatives - labelled a, b and c: The following section describes the accepted answer as a proposal, bringing together ideas from a number of other answers and comments. As this question is now community wiki, please feel free to update this. NestView The name for this idea which provides a visual method to improve the readability of nested code without using indentation. Contour Lines The name for the differently shaded lines within the NestView The image above shows the NestView used to help visualise an XML snippet. Though XML is used for this illustration, any other code syntax that uses nesting could have been used for this illustration. An Overview: The contour lines are shaded (as in a heatmap) to convey nesting level The contour lines are angled to show when a nesting level is being either opened or closed. A contour line links the start of a nesting level to the corresponding end. The combined width of contour lines give a visual impression of nesting level, in addition to the heatmap. The width of the NestView may be manually resizable, but should not change as the code changes. Contour lines can either be compressed or truncated to keep acheive this. Blank lines are sometimes used code to break up text into more digestable chunks. Such lines could trigger special behaviour in the NestView. For example the heatmap could be reset or a background color contour line used, or both. One or more contour lines associated with the currently selected code can be highlighted. The contour line associated with the selected code level would be emphasized the most, but other contour lines could also 'light up' in addition to help highlight the containing nested group Different behaviors (such as code folding or code selection) can be associated with clicking/double-clicking on a Contour Line. Different parts of a contour line (leading, middle or trailing edge) may have different dynamic behaviors associated. Tooltips can be shown on a mouse hover event over a contour line The NestView is updated continously as the code is edited. Where nesting is not well-balanced assumptions can be made where the nesting level should end, but the associated temporary contour lines must be highlighted in some way as a warning. Drag and drop behaviors of Contour Lines can be supported. Behaviour may vary according to the part of the contour line being dragged. Features commonly found in the left margin such as line numbering and colour highlighting for errors and change state could overlay the NestView. Additional Functionality The proposal addresses a range of additional issues - many are outside the scope of the original question, but a useful side-effect. Visually linking the start and end of a nested region The contour lines connect the start and end of each nested level Highlighting the context of the currently selected line As code is selected, the associated nest-level in the NestView can be highlighted Differentiating between code regions at the same nesting level In the case of XML different hues could be used for different namespaces. Programming languages (such as c#) support named regions that could be used in a similar way. Dividing areas within a nesting area into different visual blocks Extra lines are often inserted into code to aid readability. Such empty lines could be used to reset the saturation level of the NestView's contour lines. Multi-Column Code View Code without indentation makes the use of a multi-column view more effective because word-wrap or horizontal scrolling is less likely to be required. In this view, once code has reach the bottom of one column, it flows into the next one: Usage beyond merely providing a visual aid As proposed in the overview, the NestView could provide a range of editing and selection features which would be broadly in line with what is expected from a TreeView control. The key difference is that a typical TreeView node has 2 parts: an expander and the node icon. A NestView contour line can have as many as 3 parts: an opener (sloping), a connector (vertical) and a close (sloping). On Indentation The NestView presented alongside non-indented code complements, but is unlikely to replace, the conventional indented code view. It's likely that any solutions adopting a NestView, will provide a method to switch seamlessly between indented and non-indented code views without affecting any of the code text itself - including whitespace characters. One technique for the indented view would be 'Virtual Formatting' - where a dynamic left-margin is used in lieu of tab or space characters. The same nesting-level data used to dynamically render the NestView could also used for the more conventional-looking indented view. Printing Indentation will be important for the readability of printed code. Here, the absence of tab/space characters and a dynamic left-margin means that the text can wrap at the right-margin and still maintain the integrity of the indented view. Line numbers can be used as visual markers that indicate where code is word-wrapped and also the exact position of indentation: Screen Real-Estate: Flat Vs Indented Addressing the question of whether the NestView uses up valuable screen real-estate: Contour lines work well with a width the same as the code editor's character width. A NestView width of 12 character widths can therefore accommodate 12 levels of nesting before contour lines are truncated/compressed. If an indented view uses 3 character-widths for each nesting level then space is saved until nesting reaches 4 levels of nesting, after this nesting level the flat view has a space-saving advantage that increases with each nesting level. Note: A minimum indentation of 4 character widths is often recommended for code, however XML often manages with less. Also, Virtual Formatting permits less indentation to be used because there's no risk of alignment issues A comparison of the 2 views is shown below: Based on the above, its probably fair to conclude that view style choice will be based on factors other than screen real-estate. The one exception is where screen space is at a premium, for example on a Netbook/Tablet or when multiple code windows are open. In these cases, the resizable NestView would seem to be a clear winner. Use Cases Examples of real-world examples where NestView may be a useful option: Where screen real-estate is at a premium a. On devices such as tablets, notepads and smartphones b. When showing code on websites c. When multiple code windows need to be visible on the desktop simultaneously Where consistent whitespace indentation of text within code is a priority For reviewing deeply nested code. For example where sub-languages (e.g. Linq in C# or XPath in XSLT) might cause high levels of nesting. Accessibility Resizing and color options must be provided to aid those with visual impairments, and also to suit environmental conditions and personal preferences: Compatability of edited code with other systems A solution incorporating a NestView option should ideally be capable of stripping leading tab and space characters (identified as only having a formatting role) from imported code. Then, once stripped, the code could be rendered neatly in both the left-justified and indented views without change. For many users relying on systems such as merging and diff tools that are not whitespace-aware this will be a major concern (if not a complete show-stopper). Other Works: Visualisation of Overlapping Markup Published research by Wendell Piez, dated from 2004, addresses the issue of the visualisation of overlapping markup, specifically LMNL. This includes SVG graphics with significant similarities to the NestView proposal, as such, they are acknowledged here. The visual differences are clear in the images (below), the key functional distinction is that NestView is intended only for well-nested XML or code, whereas Wendell Piez's graphics are designed to represent overlapped nesting. The graphics above were reproduced - with kind permission - from http://www.piez.org Sources: Towards Hermenutic Markup Half-steps toward LMNL

    Read the article

  • Blogging locally and globally–my experience

    - by DigiMortal
    In Baltic MVP Summit 2011 there was discussion about having two blogs - one for local and another for global audience – and how to publish once written information in these blogs. There are many ways how to optimize your blogging activities if you have more than one audience and here you can find my experiences, best practices and advices about this topic. My two blogs I have to working blogs: this one here technology and programming blog for local market My local blog is almost five years old and it makes it one of the oldest company blogs in Estonia. It is still active and I write there as much as I have time for it. This blog here is active since September 2007, so it is about 3.5 years old right now. Both of these blogs are  my major hits in my MVP carrier and they have very good web statistics too. My local blog My local blog is about programming, web and technology. It has way wider target audience then this blog here has. By example, in my local blog I blog also about local events, cool new concept phones, different webs providing some interesting services etc. But local guys can find there also my postings about how to solve one or another programming problem and postings about Microsoft technologies I am playing with. This far my local blog has a lot of readers for such a small country that Estonia is. This blog has made me a lot of cool contacts and I have had there a lot of interesting discussions about different technical topics. Why I started this blog? Living in small country is different than living in big country. In small country you have less people and therefore smaller audience so you have to target more than one technical topic to find enough readers. In a same time you are still interested in your main topics and you want to reach to more people who are sharing same interests with you. Practically one day y will grow out from local market and you go global. This is how this blog was born. Was it worth to create, promote and mess with it? Every second I have put on my time to this blog has been worth of it. Thanks to this blog I have found new good friends and without them I think it is more boring to work on different problems and solutions. Defining target audiences One thing you should always do when having more than one blog is defining target audiences. If you are just technomaniac interested in sharing your stuff and make some new friends and have something to write to your MVP nomination form then you don’t have to go through complex targeting process. You can do it simple way and same effectively. Here is how I defined target audiences to my blogs: local blog – reader of my local blog is IT professional, software developer, technology innovator or just some guy who is interested in technology,   this blog – reader of this blog is experienced professional software developer who works on Microsoft technologies or software developer who is open minded and open to new technologies and interesting solutions to development problems. You can see how local blog – due to small market with less people – has wider definition for audience while this blog is heavily targeted to Microsoft technologies and specially to software development. On practical side these decisions are also made well I think because it is very hard to build up popular common IT blog. On global level it is better to target some specific niche and find readers who are professionals on your favorite topics. Thanks to this blog I have found new friends who are professional developers and I am very happy about all the discussions I have had with them. Publishing content to different blogs My local blog and this blog have some overlapping topics like .NET, databases and SEO. Due to this overlapping there is question: when I write posting to my local blog then should I have to publish same thing in my global blog? And if I write something to my global blog then should I publish same thing also in my local blog? Well, it really depends on the definition of your target audiences. If they match then of course it is good idea to translate you post and publish it also to another blog. But if you have different audiences then you may need to modify your posting before publishing it. The questions you have to answer are: is target audience interested in this topic? is target audience expecting more specific and deeper handling of this topic or are they expecting more general handling of topic? is the problem you are discussing actual for target audience or not? You have to answer these questions and after that make your decision. If you need to modify your original posting then take some time and do it. Provide quality to all your readers because they will respect you if you respect them. Cross-posting and referencing It is tempting to save time that preparing some blog post takes and if you have are done with posting in one blog it may seem like good idea to make short posting to another blog and add reference to first one where topic is discussed longer. Well, don’t do it – all your readers expect good quality content from you and jumping from one blog post to another is disturbing for them. Of course, there is problem with differences between target audiences. You may have wider target audience and some people may be interested in more specific handling of topic. In this case feel free to refer your blog you are writing in english. This is not working very well in opposite direction because almost all my global blog readers understand english but not estonian. By example, estonian language is complex one and online translating tools make very poor translations from estonian language. This is why I don’t even plan to publish postings here that refer to my local blog for more information. I am keeping these two blogs as two different worlds and if there is posting that fits well to both blogs I will write my posting to one blog and then answer previous three questions before posting same thing to another blog. Conclusion Growing out of your local market is not anything mysterious if you are living in small country. As it is harder to find people there who are interested in same topics with you then sooner or later you will start finding these new contacts from global audience. Global audience is bigger and to be visible there you must provide high quality content to your audience. It is something you will learn over time and you will learn every day something new when you are posting to your global blog. You may ask: if global blog is much more complex thing to do then is it worth to do at all? My answer is: yes, do it for sure. It is not easy thing to do when you start but if you work on your global blog and improve it over time you will get over all obstacles pretty soon. Just don’t forget one thing – content is king and your readers expect high quality from you.

    Read the article

  • DKIM, SPF, PTR records are not working properly with my domain

    - by shihon
    I configured my server and well authenticate email system with DKIM key, SPF record and PTR records, when i start to sent out mails from phplist interface to my users ~50000, my domain is spammed by google. In headers, signed by and mailed by tag shows by my domain : appmail.co, I also test my domain via check mail provide by port25, report is: This message is an automatic response from Port25's authentication verifier service at verifier.port25.com. The service allows email senders to perform a simple check of various sender authentication mechanisms. It is provided free of charge, in the hope that it is useful to the email community. While it is not officially supported, we welcome any feedback you may have at . Thank you for using the verifier, The Port25 Solutions, Inc. team ========================================================== Summary of Results SPF check: pass DomainKeys check: neutral DKIM check: pass Sender-ID check: pass SpamAssassin check: ham ========================================================== Details: HELO hostname: app.appmail.co Source IP: 108.179.192.148 mail-from: [email protected] SPF check details: Result: pass ID(s) verified: [email protected] DNS record(s): appmail.co. SPF (no records) appmail.co. 14400 IN TXT "v=spf1 +a +mx +ip4:108.179.192.148 ?all" appmail.co. 14400 IN A 108.179.192.148 DomainKeys check details: Result: neutral (message not signed) ID(s) verified: [email protected] DNS record(s): DKIM check details: Result: pass (matches From: [email protected]) ID(s) verified: header.d=appmail.co Canonicalized Headers: content-type:multipart/alternative;'20'boundary=047d7b2eda75d8544d04c17b6841'0D''0A' to:[email protected]'0D''0A' from:shashank'20'sharma'20'<[email protected]>'0D''0A' subject:Test'0D''0A' message-id:<CADnDhbH9aDBk3Ho2-CrG7gwOoD6RNX0sFq4bWL64+kmo=9HjWg@mail.gmail.com>'0D''0A' date:Sat,'20'2'20'Jun'20'2012'20'16:44:50'20'+0530'0D''0A' mime-version:1.0'0D''0A' dkim-signature:v=1;'20'a=rsa-sha256;'20'q=dns/txt;'20'c=relaxed/relaxed;'20'd=appmail.co;'20's=default;'20'h=Content-Type:To:From:Subject:Message-ID:Date:MIME-Version;'20'bh=GS6uwlT+weKcrrLJ2I+cjBtWPq9nvhwRlNAJebOiQOk=;'20'b=; Canonicalized Body: --047d7b2eda75d8544d04c17b6841'0D''0A' Content-Type:'20'text/plain;'20'charset=UTF-8'0D''0A' '0D''0A' Hello'20'Senders'0D''0A' '0D''0A' --047d7b2eda75d8544d04c17b6841'0D''0A' Content-Type:'20'text/html;'20'charset=UTF-8'0D''0A' '0D''0A' Hello'20'Senders'0D''0A' '0D''0A' --047d7b2eda75d8544d04c17b6841--'0D''0A' DNS record(s): default._domainkey.appmail.co. 14400 IN TXT "v=DKIM1; k=rsa; p=MHwwDQYJKoZIhvcNAQEBBQADawAwaAJhALGCOdMeZRxRHoatH7/KCvI1CKS0wOOsTAq0LLgPsOpMolifpVQDKOWT2zq/6LHVmDVjXLbnWO2d4ry/riy7ei66pLpnAV5ceIUSjBRusI8jcF9CZhPrh/OImsKVUb9ceQIDAQAB;" NOTE: DKIM checking has been performed based on the latest DKIM specs (RFC 4871 or draft-ietf-dkim-base-10) and verification may fail for older versions. If you are using Port25's PowerMTA, you need to use version 3.2r11 or later to get a compatible version of DKIM. Sender-ID check details: Result: pass ID(s) verified: [email protected] DNS record(s): appmail.co. SPF (no records) appmail.co. 14400 IN TXT "v=spf1 +a +mx +ip4:108.179.192.148 ?all" appmail.co. 14400 IN A 108.179.192.148 SpamAssassin check details: SpamAssassin v3.3.1 (2010-03-16) Result: ham (-0.1 points, 5.0 required) pts rule name description ---- ---------------------- -------------------------------------------------- -0.0 T_RP_MATCHES_RCVD Envelope sender domain matches handover relay domain 0.0 HTML_MESSAGE BODY: HTML included in message -0.5 BAYES_05 BODY: Bayes spam probability is 1 to 5% [score: 0.0288] -0.1 DKIM_VALID_AU Message has a valid DKIM or DK signature from author's domain 0.1 DKIM_SIGNED Message has a DKIM or DK signature, not necessarily valid -0.1 DKIM_VALID Message has at least one valid DKIM or DK signature 0.5 SINGLE_HEADER_1K A single header contains 1K-2K characters ========================================================== Original Email Return-Path: <[email protected]> Received: from app.appmail.co (108.179.192.148) by verifier.port25.com id hp7qqo11u9cc for <[email protected]>; Sat, 2 Jun 2012 07:14:52 -0400 (envelope-from <[email protected]>) Authentication-Results: verifier.port25.com; spf=pass [email protected] Authentication-Results: verifier.port25.com; domainkeys=neutral (message not signed) [email protected] Authentication-Results: verifier.port25.com; dkim=pass (matches From: [email protected]) header.d=appmail.co Authentication-Results: verifier.port25.com; sender-id=pass [email protected] DKIM-Signature: v=1; a=rsa-sha256; q=dns/txt; c=relaxed/relaxed; d=appmail.co; s=default; h=Content-Type:To:From:Subject:Message-ID:Date:MIME-Version; bh=GS6uwlT+weKcrrLJ2I+cjBtWPq9nvhwRlNAJebOiQOk=;b=pNw3UQNMoNyZ2Ujv8omHGodKVu/55S8YdBEsA5TbRciga/H7f+5noiKvo60vU6oXYyzVKeozFHDoOEMV6m5UTgkdBefogl+9cUIbt5CSrTWA97D7tGS97JblTDXApbZH; Received: from mail-pb0-f46.google.com ([209.85.160.46]:57831) by app.appmail.co with esmtpa (Exim 4.77) (envelope-from <[email protected]>) id 1SamIF-00055f-Om for [email protected]; Sat, 02 Jun 2012 16:44:51 +0530 Received: by pbbrp8 with SMTP id rp8so4165728pbb.5 for <[email protected]>; Sat, 02 Jun 2012 04:14:51 -0700 (PDT) MIME-Version: 1.0 Received: by 10.68.216.33 with SMTP id on1mr19414885pbc.105.1338635690988; Sat, 02 Jun 2012 04:14:50 -0700 (PDT) Received: by 10.143.66.13 with HTTP; Sat, 2 Jun 2012 04:14:50 -0700 (PDT) Date: Sat, 2 Jun 2012 16:44:50 +0530 Message-ID: <CADnDhbH9aDBk3Ho2-CrG7gwOoD6RNX0sFq4bWL64+kmo=9HjWg@mail.gmail.com> Subject: Test From: shashank sharma <[email protected]> To: [email protected] Content-Type: multipart/alternative; boundary=047d7b2eda75d8544d04c17b6841 X-AntiAbuse: This header was added to track abuse, please include it with any abuse report X-AntiAbuse: Primary Hostname - app.appmail.co X-AntiAbuse: Original Domain - verifier.port25.com X-AntiAbuse: Originator/Caller UID/GID - [47 12] / [47 12] X-AntiAbuse: Sender Address Domain - appmail.co --047d7b2eda75d8544d04c17b6841 Content-Type: text/plain; charset=UTF-8 Hello Senders --047d7b2eda75d8544d04c17b6841 Content-Type: text/html; charset=UTF-8 Hello Senders --047d7b2eda75d8544d04c17b6841-- I also tried to send mail on yahoo , rediff but i get mails in spam. Please help me to sort out this issue

    Read the article

  • Help me alter this query to get the desired results - New*

    - by sandeepan
    Please dump these data first CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=19 ; INSERT INTO `all_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 1, 1, NULL), (2, 2, 1, NULL), (3, 6, 2, NULL), (4, 7, 2, NULL), (8, 3, 1, 1), (9, 4, 1, 1), (10, 5, 2, 2), (11, 4, 2, 2), (15, 8, 1, 3), (16, 9, 1, 3), (17, 10, 1, 4), (18, 4, 1, 4), (19, 1, 2, 5), (20, 4, 2, 5); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=11 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'), (8, 'more'), (9, 'fresh'), (10, 'second'); CREATE TABLE IF NOT EXISTS `webclasses` ( `id_wc` int(10) NOT NULL AUTO_INCREMENT, `id_author` int(10) NOT NULL, `name` varchar(50) DEFAULT NULL, PRIMARY KEY (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=5 ; INSERT INTO `webclasses` (`id_wc`, `id_author`, `name`) VALUES (1, 1, 'first class'), (2, 2, 'new class'), (3, 1, 'more fresh'), (4, 1, 'second class'), (5, 2, 'sandeepan class'); About the system - The system consists of tutors and classes. - The data in the table All_Tag_Relations stores tag relations for each tutor registered and each class created by a tutor. The tag relations are used for searching classes. The current data dump corresponds to tutor "Sandeepan Nath" who has created classes named "first class", "more fresh", "second class" and tutor "Bob Cratchit" who has created classes "new class" and "Sandeepan class". I am trying for a search query performs AND logic on the search keywords and returns wvery such class for which the search terms are present in the class name or its tutor name To make it easy, following is the list of search terms and desired results:- Search term result classes (check the id_wc in the results) first class 1 Sandeepan Nath class 1 Sandeepan Nath 1,3 Bob Cratchit 2 Sandeepan Nath bob none Sandeepan Class 1,4,5 I have so far reached upto this query -- Two keywords search SET @tag1 = 4, @tag2 = 1; -- Setting some user variables to see where the ids go. SELECT wc.id_wc, sum( DISTINCT ( wtagrels.id_tag = @tag1 ) ) AS key_1_class_matches, sum( DISTINCT ( wtagrels.id_tag = @tag2 ) ) AS key_2_class_matches, sum( DISTINCT ( ttagrels.id_tag = @tag1 ) ) AS key_1_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = @tag2 ) ) AS key_2_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = wtagrels.id_tag ) ) AS key_class_tutor_matches FROM WebClasses as wc join all_tag_relations AS wtagrels on wc.id_wc = wtagrels.id_wc join all_tag_relations as ttagrels on (wc.id_author = ttagrels.id_tutor) WHERE ( wtagrels.id_tag = @tag1 OR wtagrels.id_tag = @tag2 OR ttagrels.id_tag = @tag1 OR ttagrels.id_tag = @tag2 ) GROUP BY wtagrels.id_wc LIMIT 0 , 20 For search with 1 or 3 terms, remove/add the variable part in this query. Tabulating my observation of the values of key_1_class_matches, key_2_class_matches,key_1_tutor_matches (say, class keys),key_2_tutor_matches for various cases (say, tutor keys). Search term expected result Observation first class 1 for class 1, all class keys+all tutor keys =1 Sandeepan Nath class 1 for class 1, one class key+ all tutor keys = 1 Sandeepan Nath 1,3 both tutor keys =1 for these classes Bob Cratchit 2 both tutor keys = 1 Sandeepan Nath bob none no complete tutor matches for any class I found a pattern that, for any case, the class(es) which should appear in the result have the highest number of matches (all class keys and tutor keys). E.g. searching "first class", only for class =1, total of key matches = 4(1+1+1+1) searching "Sandeepan Nath", for classes 1, 3,4(all classes by Sandeepan Nath) have all the tutor keys matching. But no pattern in the search for "Sandeepan Class" - classes 1,4,5 should match. Now, how do I put a condition into the query, based on that pattern so that only those classes are returned. Do I need to use full text search here because it gives a scoring/rank value indicating the strength of the match? Any sample query would help. Please note - I have already found solution for showing classes when any/all of the search terms match with the class name. http://stackoverflow.com/questions/3030022/mysql-help-me-alter-this-search-query-to-get-desired-results But if all the search terms are in tutor name, it does not work. So, I am modifying the query and experimenting.

    Read the article

  • Help me alter this query to get the desired results

    - by sandeepan
    Please dump these data first CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=19 ; INSERT INTO `all_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 1, 1, NULL), (2, 2, 1, NULL), (3, 6, 2, NULL), (4, 7, 2, NULL), (8, 3, 1, 1), (9, 4, 1, 1), (10, 5, 2, 2), (11, 4, 2, 2), (15, 8, 1, 3), (16, 9, 1, 3), (17, 10, 1, 4), (18, 4, 1, 4), (19, 1, 2, 5), (20, 4, 2, 5); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=11 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'), (8, 'more'), (9, 'fresh'), (10, 'second'); CREATE TABLE IF NOT EXISTS `webclasses` ( `id_wc` int(10) NOT NULL AUTO_INCREMENT, `id_author` int(10) NOT NULL, `name` varchar(50) DEFAULT NULL, PRIMARY KEY (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=5 ; INSERT INTO `webclasses` (`id_wc`, `id_author`, `name`) VALUES (1, 1, 'first class'), (2, 2, 'new class'), (3, 1, 'more fresh'), (4, 1, 'second class'), (5, 2, 'sandeepan class'); About the system - The system consists of tutors and classes. - The data in the table All_Tag_Relations stores tag relations for each tutor registered and each class created by a tutor. The tag relations are used for searching classes. The current data dump corresponds to tutor "Sandeepan Nath" who has created classes named "first class", "more fresh", "second class" and tutor "Bob Cratchit" who has created classes "new class" and "Sandeepan class". I am trying for a search query performs AND logic on the search keywords and returns wvery such class for which the search terms are present in the class name or its tutor name To make it easy, following is the list of search terms and desired results:- Search term result classes (check the id_wc in the results) first class 1 Sandeepan Nath class 1 Sandeepan Nath 1,3 Bob Cratchit 2 Sandeepan Nath bob none Sandeepan Class 1,4,5 I have so far reached upto this query -- Two keywords search SET @tag1 = 4, @tag2 = 1; -- Setting some user variables to see where the ids go. SELECT wc.id_wc, sum( DISTINCT ( wtagrels.id_tag = @tag1 ) ) AS key_1_class_matches, sum( DISTINCT ( wtagrels.id_tag = @tag2 ) ) AS key_2_class_matches, sum( DISTINCT ( ttagrels.id_tag = @tag1 ) ) AS key_1_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = @tag2 ) ) AS key_2_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = wtagrels.id_tag ) ) AS key_class_tutor_matches FROM WebClasses as wc join all_tag_relations AS wtagrels on wc.id_wc = wtagrels.id_wc join all_tag_relations as ttagrels on (wc.id_author = ttagrels.id_tutor) WHERE ( wtagrels.id_tag = @tag1 OR wtagrels.id_tag = @tag2 OR ttagrels.id_tag = @tag1 OR ttagrels.id_tag = @tag2 ) GROUP BY wtagrels.id_wc LIMIT 0 , 20 For search with 1 or 3 terms, remove/add the variable part in this query. Tabulating my observation of the values of key_1_class_matches, key_2_class_matches,key_1_tutor_matches (say, class keys),key_2_tutor_matches for various cases (say, tutor keys). Search term expected result Observation first class 1 for class 1, all class keys+all tutor keys =1 Sandeepan Nath class 1 for class 1, one class key+ all tutor keys = 1 Sandeepan Nath 1,3 both tutor keys =1 for these classes Bob Cratchit 2 both tutor keys = 1 Sandeepan Nath bob none no complete tutor matches for any class I found a pattern that, for any case, the class(es) which should appear in the result have the highest number of matches (all class keys and tutor keys). E.g. searching "first class", only for class =1, total of key matches = 4(1+1+1+1) searching "Sandeepan Nath", for classes 1, 3,4(all classes by Sandeepan Nath) have all the tutor keys matching. But no pattern in the search for "Sandeepan Class" - classes 1,4,5 should match. Now, how do I put a condition into the query, based on that pattern so that only those classes are returned. Do I need to use full text search here because it gives a scoring/rank value indicating the strength of the match? Any sample query would help. Please note - I have already found solution for showing classes when any/all of the search terms match with the class name. http://stackoverflow.com/questions/3030022/mysql-help-me-alter-this-search-query-to-get-desired-results But if all the search terms are in tutor name, it does not work. So, I am modifying the query and experimenting.

    Read the article

  • Please help fix and optimize this query

    - by user607217
    I am working on a system to find potential duplicates in our customers table (SQL 2005). I am using the built-in SOUNDEX value that our software computes when customers are added/updated, but I also implemented the double metaphone algorithm for better matching. This is the most-nested query I have created, and I can't help but think there is a better way to do it and I'd like to learn. In the inner-most query I am joining the customer table to the metaphone table I created, then finding customers that have identical pKey (primary phonetic key). I take that, union that with customers that have matching soundex values, and then proceed to score those matches with various text similarity functions. This is currently working, but I would also like to add a union of customers whose aKey (alternate phonetic key) match. This would be identical to "QUERY A" except to substitute on (c1Akey = c2Akey) for the join. However, when I attempt to include that, I get errors when I try to execute my query. Here is the code: --Create aggregate ranking select c1Name, c2Name, nDiff, c1Addr, c2Addr, aDiff, c1SSN, c2SSN, sDiff, c1DOB, c2DOB, dDiff, nDiff+aDiff+dDiff+sDiff as Score ,(sDiff+dDiff)*1.5 + (nDiff+dDiff)*1.5 + (nDiff+sDiff)*1.5 + aDiff *.5 + nDiff *.5 as [Rank] FROM ( --Create match scores for different fields SELECT c1Name, c2Name, c1Addr, c2Addr, c1SSN, c2SSN, c1LTD, c2LTD, c1DOB, c2DOB, dbo.Jaro(c1name, c2name) AS nDiff, dbo.JaroWinkler(c1addr, c2addr) AS aDiff, CASE WHEN c1dob = '1901-01-01' OR c2dob = '1901-01-01' OR c1dob = '1800-01-01' OR c2dob = '1800-01-01' THEN .5 ELSE dbo.SmithWaterman(c1dob, c2dob) END AS dDiff, CASE WHEN c1ssn = '000-00-0000' OR c2ssn = '000-00-0000' THEN .5 ELSE dbo.Jaro(c1ssn, c2ssn) END AS sDiff FROM -- Generate list of possible matches based on multiple phonetic matching fields ( select * from -- List of similar names from pKey field of ##Metaphone table --QUERY A BEGIN (select customers.custno as c1Custno, name as c1Name, haddr as c1Addr, ssn as c1SSN, lasttripdate as c1LTD, dob as c1DOB, soundex as c1Soundex, pkey as c1Pkey, akey as c1Akey from Customers WITH (nolock) join ##Metaphone on customers.custno = ##Metaphone.custno) as c1 JOIN (select customers.custno as c2Custno, name as c2Name, haddr as c2Addr, ssn as c2SSN, lasttripdate as c2LTD, dob as c2DOB, soundex as c2Soundex, pkey as c2Pkey, akey as c2Akey from Customers with (nolock) join ##Metaphone on customers.custno = ##Metaphone.custno) as c2 on (c1Pkey = c2Pkey) and (c1Custno < c2Custno) WHERE (c1Name <> 'PARENT, GUARDIAN') and c1soundex != c2soundex --QUERY A END union --List of similar names from pregenerated SOUNDEX field (select t1.custno, t1.name, t1.haddr, t1.ssn, t1.lasttripdate, t1.dob, t1.[soundex], 0, 0, t2.custno, t2.name, t2.haddr, t2.ssn, t2.lasttripdate, t2.dob, t2.[soundex], 0, 0 from Customers t1 WITH (nolock) join customers t2 with (nolock) on t1.[soundex] = t2.[soundex] and t1.custno < t2.custno where (t1.name <> 'PARENT, GUARDIAN')) ) as a ) as b where (sDiff+dDiff)*1.5 + (nDiff+dDiff)*1.5 + (nDiff+sDiff)*1.5 + aDiff *.5 + nDiff *.5 >= 7.5 order by [rank] desc, score desc Previously, I was using joins such as on c1.pkey = c2.pkey or c1.akey = c2.akey or c1.soundex = c2.soundex but the performance was horrendous, and using unions seems to be working a lot better. Out of 103K customers, tt is currently generating a list of 8.5M potential matches (based on the phonetic codes) in 2.25 minutes, and then taking another 2 to score, rank and filter those down to about 3000. So I am happy with the performance, I just can't help but think there is a better way to structure this, and I need help adding the extra union condition. Thanks!

    Read the article

  • Tip/Trick: Fix Common SEO Problems Using the URL Rewrite Extension

    - by ScottGu
    Search engine optimization (SEO) is important for any publically facing web-site.  A large % of traffic to sites now comes directly from search engines, and improving your site’s search relevancy will lead to more users visiting your site from search engine queries.  This can directly or indirectly increase the money you make through your site. This blog post covers how you can use the free Microsoft URL Rewrite Extension to fix a bunch of common SEO problems that your site might have.  It takes less than 15 minutes (and no code changes) to apply 4 simple URL Rewrite rules to your site, and in doing so cause search engines to drive more visitors and traffic to your site.  The techniques below work equally well with both ASP.NET Web Forms and ASP.NET MVC based sites.  They also works with all versions of ASP.NET (and even work with non-ASP.NET content). [In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu] Measuring the SEO of your website with the Microsoft SEO Toolkit A few months ago I blogged about the free SEO Toolkit that we’ve shipped.  This useful tool enables you to automatically crawl/scan your site for SEO correctness, and it then flags any SEO issues it finds.  I highly recommend downloading and using the tool against any public site you work on.  It makes it easy to spot SEO issues you might have in your site, and pinpoint ways to optimize it further. Below is a simple example of a report I ran against one of my sites (www.scottgu.com) prior to applying the URL Rewrite rules I’ll cover later in this blog post:   Search Relevancy and URL Splitting Two of the important things that search engines evaluate when assessing your site’s “search relevancy” are: How many other sites link to your content.  Search engines assume that if a lot of people around the web are linking to your content, then it is likely useful and so weight it higher in relevancy. The uniqueness of the content it finds on your site.  If search engines find that the content is duplicated in multiple places around the Internet (or on multiple URLs on your site) then it is likely to drop the relevancy of the content. One of the things you want to be very careful to avoid when building public facing sites is to not allow different URLs to retrieve the same content within your site.  Doing so will hurt with both of the situations above.  In particular, allowing external sites to link to the same content with multiple URLs will cause your link-count and page-ranking to be split up across those different URLs (and so give you a smaller page rank than what it would otherwise be if it was just one URL).  Not allowing external sites to link to you in different ways sounds easy in theory – but you might wonder what exactly this means in practice and how you avoid it. 4 Really Common SEO Problems Your Sites Might Have Below are 4 really common scenarios that can cause your site to inadvertently expose multiple URLs for the same content.  When this happens external sites linking to yours will end up splitting their page links across multiple URLs - and as a result cause you to have a lower page ranking with search engines than you deserve. SEO Problem #1: Default Document IIS (and other web servers) supports the concept of a “default document”.  This allows you to avoid having to explicitly specify the page you want to serve at either the root of the web-site/application, or within a sub-directory.  This is convenient – but means that by default this content is available via two different publically exposed URLs (which is bad).  For example: http://scottgu.com/ http://scottgu.com/default.aspx SEO Problem #2: Different URL Casings Web developers often don’t realize URLs are case sensitive to search engines on the web.  This means that search engines will treat the following links as two completely different URLs: http://scottgu.com/Albums.aspx http://scottgu.com/albums.aspx SEO Problem #3: Trailing Slashes Consider the below two URLs – they might look the same at first, but they are subtly different. The trailing slash creates yet another situation that causes search engines to treat the URLs as different and so split search rankings: http://scottgu.com http://scottgu.com/ SEO Problem #4: Canonical Host Names Sometimes sites support scenarios where they support a web-site with both a leading “www” hostname prefix as well as just the hostname itself.  This causes search engines to treat the URLs as different and split search rankling: http://scottgu.com/albums.aspx/ http://www.scottgu.com/albums.aspx/ How to Easily Fix these SEO Problems in 10 minutes (or less) using IIS Rewrite If you haven’t been careful when coding your sites, chances are you are suffering from one (or more) of the above SEO problems.  Addressing these issues will improve your search engine relevancy ranking and drive more traffic to your site. The “good news” is that fixing the above 4 issues is really easy using the URL Rewrite Extension.  This is a completely free Microsoft extension available for IIS 7.x (on Windows Server 2008, Windows Server 2008 R2, Windows 7 and Windows Vista).  The great thing about using the IIS Rewrite extension is that it allows you to fix the above problems *without* having to change any code within your applications.  You can easily install the URL Rewrite Extension in under 3 minutes using the Microsoft Web Platform Installer (a free tool we ship that automates setting up web servers and development machines).  Just click the green “Install Now” button on the URL Rewrite Spotlight page to install it on your Windows Server 2008, Windows 7 or Windows Vista machine: Once installed you’ll find that a new “URL Rewrite” icon is available within the IIS 7 Admin Tool: Double-clicking the icon will open up the URL Rewrite admin panel – which will display the list of URL Rewrite rules configured for a particular application or site: Notice that our rewrite rule list above is currently empty (which is the default when you first install the extension).  We can click the “Add Rule…” link button in the top-right of the panel to add and enable new URL Rewriting logic for our site.  Scenario 1: Handling Default Document Scenarios One of the SEO problems I discussed earlier in this post was the scenario where the “default document” feature of IIS causes you to inadvertently expose two URLs for the same content on your site.  For example: http://scottgu.com/ http://scottgu.com/default.aspx We can fix this by adding a new IIS Rewrite rule that automatically redirects anyone who navigates to the second URL to instead go to the first one.  We will setup the HTTP redirect to be a “permanent redirect” – which will indicate to search engines that they should follow the redirect and use the new URL they are redirected to as the identifier of the content they retrieve.  Let’s look at how we can create such a rule.  We’ll begin by clicking the “Add Rule” link in the screenshot above.  This will cause the below dialog to display: We’ll select the “Blank Rule” template within the “Inbound rules” section to create a new custom URL Rewriting rule.  This will display an empty pane like below: Don’t worry – setting up the above rule is easy.  The following 4 steps explain how to do so: Step 1: Name the Rule Our first step will be to name the rule we are creating.  Naming it with a descriptive name will make it easier to find and understand later.  Let’s name this rule our “Default Document URL Rewrite” rule: Step 2: Setup the Regular Expression that Matches this Rule Our second step will be to specify a regular expression filter that will cause this rule to execute when an incoming URL matches the regex pattern.   Don’t worry if you aren’t good with regular expressions - I suck at them too. The trick is to know someone who is good at them or copy/paste them from a web-site.  Below we are going to specify the following regular expression as our pattern rule: (.*?)/?Default\.aspx$ This pattern will match any URL string that ends with Default.aspx. The "(.*?)" matches any preceding character zero or more times. The "/?" part says to match the slash symbol zero or one times. The "$" symbol at the end will ensure that the pattern will only match strings that end with Default.aspx.  Combining all these regex elements allows this rule to work not only for the root of your web site (e.g. http://scottgu.com/default.aspx) but also for any application or subdirectory within the site (e.g. http://scottgu.com/photos/default.aspx.  Because the “ignore case” checkbox is selected it will match both “Default.aspx” as well as “default.aspx” within the URL.   One nice feature built-into the rule editor is a “Test pattern” button that you can click to bring up a dialog that allows you to test out a few URLs with the rule you are configuring: Above I've added a “products/default.aspx” URL and clicked the “Test” button.  This will give me immediate feedback on whether the rule will execute for it.  Step 3: Setup a Permanent Redirect Action We’ll then setup an action to occur when our regular expression pattern matches the incoming URL: In the dialog above I’ve changed the “Action Type” drop down to be a “Redirect” action.  The “Redirect Type” will be a HTTP 301 Permanent redirect – which means search engines will follow it. I’ve also set the “Redirect URL” property to be: {R:1}/ This indicates that we want to redirect the web client requesting the original URL to a new URL that has the originally requested URL path - minus the "Default.aspx" in it.  For example, requests for http://scottgu.com/default.aspx will be redirected to http://scottgu.com/, and requests for http://scottgu.com/photos/default.aspx will be redirected to http://scottgu.com/photos/ The "{R:N}" regex construct, where N >= 0, is called a back-reference and N is the back-reference index. In the case of our pattern "(.*?)/?Default\.aspx$", if the input URL is "products/Default.aspx" then {R:0} will contain "products/Default.aspx" and {R:1} will contain "products".  We are going to use this {R:1}/ value to be the URL we redirect users to.  Step 4: Apply and Save the Rule Our final step is to click the “Apply” button in the top right hand of the IIS admin tool – which will cause the tool to persist the URL Rewrite rule into our application’s root web.config file (under a <system.webServer/rewrite> configuration section): <configuration>     <system.webServer>         <rewrite>             <rules>                 <rule name="Default Document" stopProcessing="true">                     <match url="(.*?)/?Default\.aspx$" />                     <action type="Redirect" url="{R:1}/" />                 </rule>             </rules>         </rewrite>     </system.webServer> </configuration> Because IIS 7.x and ASP.NET share the same web.config files, you can actually just copy/paste the above code into your web.config files using Visual Studio and skip the need to run the admin tool entirely.  This also makes adding/deploying URL Rewrite rules with your ASP.NET applications really easy. Step 5: Try the Rule Out Now that we’ve saved the rule, let’s try it out on our site.  Try the following two URLs on my site: http://scottgu.com/ http://scottgu.com/default.aspx Notice that the second URL automatically redirects to the first one.  Because it is a permanent redirect, search engines will follow the URL and should update the page ranking of http://scottgu.com to include links to http://scottgu.com/default.aspx as well. Scenario 2: Different URL Casing Another common SEO problem I discussed earlier in this post is that URLs are case sensitive to search engines on the web.  This means that search engines will treat the following links as two completely different URLs: http://scottgu.com/Albums.aspx http://scottgu.com/albums.aspx We can fix this by adding a new IIS Rewrite rule that automatically redirects anyone who navigates to the first URL to instead go to the second (all lower-case) one.  Like before, we will setup the HTTP redirect to be a “permanent redirect” – which will indicate to search engines that they should follow the redirect and use the new URL they are redirected to as the identifier of the content they retrieve. To create such a rule we’ll click the “Add Rule” link in the URL Rewrite admin tool again.  This will cause the “Add Rule” dialog to appear again: Unlike the previous scenario (where we created a “Blank Rule”), with this scenario we can take advantage of a built-in “Enforce lowercase URLs” rule template.  When we click the “ok” button we’ll see the following dialog which asks us if we want to create a rule that enforces the use of lowercase letters in URLs: When we click the “Yes” button we’ll get a pre-written rule that automatically performs a permanent redirect if an incoming URL has upper-case characters in it – and automatically send users to a lower-case version of the URL: We can click the “Apply” button to use this rule “as-is” and have it apply to all incoming URLs to our site.  Because my www.scottgu.com site uses ASP.NET Web Forms, I’m going to make one small change to the rule we generated above – which is to add a condition that will ensure that URLs to ASP.NET’s built-in “WebResource.axd” handler are excluded from our case-sensitivity URL Rewrite logic.  URLs to the WebResource.axd handler will only come from server-controls emitted from my pages – and will never be linked to from external sites.  While my site will continue to function fine if we redirect these URLs to automatically be lower-case – doing so isn’t necessary and will add an extra HTTP redirect to many of my pages.  The good news is that adding a condition that prevents my URL Rewriting rule from happening with certain URLs is easy.  We simply need to expand the “Conditions” section of the form above We can then click the “Add” button to add a condition clause.  This will bring up the “Add Condition” dialog: Above I’ve entered {URL} as the Condition input – and said that this rule should only execute if the URL does not match a regex pattern which contains the string “WebResource.axd”.  This will ensure that WebResource.axd URLs to my site will be allowed to execute just fine without having the URL be re-written to be all lower-case. Note: If you have static resources (like references to .jpg, .css, and .js files) within your site that currently use upper-case characters you’ll probably want to add additional condition filter clauses so that URLs to them also don’t get redirected to be lower-case (just add rules for patterns like .jpg, .gif, .js, etc).  Your site will continue to work fine if these URLs get redirected to be lower case (meaning the site won’t break) – but it will cause an extra HTTP redirect to happen on your site for URLs that don’t need to be redirected for SEO reasons.  So setting up a condition clause makes sense to add. When I click the “ok” button above and apply our lower-case rewriting rule the admin tool will save the following additional rule to our web.config file: <configuration>     <system.webServer>         <rewrite>             <rules>                 <rule name="Default Document" stopProcessing="true">                     <match url="(.*?)/?Default\.aspx$" />                     <action type="Redirect" url="{R:1}/" />                 </rule>                 <rule name="Lower Case URLs" stopProcessing="true">                     <match url="[A-Z]" ignoreCase="false" />                     <conditions logicalGrouping="MatchAll" trackAllCaptures="false">                         <add input="{URL}" pattern="WebResource.axd" negate="true" />                     </conditions>                     <action type="Redirect" url="{ToLower:{URL}}" />                 </rule>             </rules>         </rewrite>     </system.webServer> </configuration> Try the Rule Out Now that we’ve saved the rule, let’s try it out on our site.  Try the following two URLs on my site: http://scottgu.com/Albums.aspx http://scottgu.com/albums.aspx Notice that the first URL (which has a capital “A”) automatically does a redirect to a lower-case version of the URL.  Scenario 3: Trailing Slashes Another common SEO problem I discussed earlier in this post is the scenario of trailing slashes within URLs.  The trailing slash creates yet another situation that causes search engines to treat the URLs as different and so split search rankings: http://scottgu.com http://scottgu.com/ We can fix this by adding a new IIS Rewrite rule that automatically redirects anyone who navigates to the first URL (that does not have a trailing slash) to instead go to the second one that does.  Like before, we will setup the HTTP redirect to be a “permanent redirect” – which will indicate to search engines that they should follow the redirect and use the new URL they are redirected to as the identifier of the content they retrieve.  To create such a rule we’ll click the “Add Rule” link in the URL Rewrite admin tool again.  This will cause the “Add Rule” dialog to appear again: The URL Rewrite admin tool has a built-in “Append or remove the trailing slash symbol” rule template.  When we select it and click the “ok” button we’ll see the following dialog which asks us if we want to create a rule that automatically redirects users to a URL with a trailing slash if one isn’t present: Like within our previous lower-casing rewrite rule we’ll add one additional condition clause that will exclude WebResource.axd URLs from being processed by this rule.  This will avoid an unnecessary redirect for happening for those URLs. When we click the “OK” button we’ll get a pre-written rule that automatically performs a permanent redirect if the URL doesn’t have a trailing slash – and if the URL is not processed by either a directory or a file.  This will save the following additional rule to our web.config file: <configuration>     <system.webServer>         <rewrite>             <rules>                 <rule name="Default Document" stopProcessing="true">                     <match url="(.*?)/?Default\.aspx$" />                     <action type="Redirect" url="{R:1}/" />                 </rule>                 <rule name="Lower Case URLs" stopProcessing="true">                     <match url="[A-Z]" ignoreCase="false" />                     <conditions logicalGrouping="MatchAll" trackAllCaptures="false">                         <add input="{URL}" pattern="WebResource.axd" negate="true" />                     </conditions>                     <action type="Redirect" url="{ToLower:{URL}}" />                 </rule>                 <rule name="Trailing Slash" stopProcessing="true">                     <match url="(.*[^/])$" />                     <conditions logicalGrouping="MatchAll" trackAllCaptures="false">                         <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" />                         <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" />                         <add input="{URL}" pattern="WebResource.axd" negate="true" />                     </conditions>                     <action type="Redirect" url="{R:1}/" />                 </rule>             </rules>         </rewrite>     </system.webServer> </configuration> Try the Rule Out Now that we’ve saved the rule, let’s try it out on our site.  Try the following two URLs on my site: http://scottgu.com http://scottgu.com/ Notice that the first URL (which has no trailing slash) automatically does a redirect to a URL with the trailing slash.  Because it is a permanent redirect, search engines will follow the URL and update the page ranking. Scenario 4: Canonical Host Names The final SEO problem I discussed earlier are scenarios where a site works with both a leading “www” hostname prefix as well as just the hostname itself.  This causes search engines to treat the URLs as different and split search rankling: http://www.scottgu.com/albums.aspx http://scottgu.com/albums.aspx We can fix this by adding a new IIS Rewrite rule that automatically redirects anyone who navigates to the first URL (that has a www prefix) to instead go to the second URL.  Like before, we will setup the HTTP redirect to be a “permanent redirect” – which will indicate to search engines that they should follow the redirect and use the new URL they are redirected to as the identifier of the content they retrieve.  To create such a rule we’ll click the “Add Rule” link in the URL Rewrite admin tool again.  This will cause the “Add Rule” dialog to appear again: The URL Rewrite admin tool has a built-in “Canonical domain name” rule template.  When we select it and click the “ok” button we’ll see the following dialog which asks us if we want to create a redirect rule that automatically redirects users to a primary host name URL: Above I’m entering the primary URL address I want to expose to the web: scottgu.com.  When we click the “OK” button we’ll get a pre-written rule that automatically performs a permanent redirect if the URL has another leading domain name prefix.  This will save the following additional rule to our web.config file: <configuration>     <system.webServer>         <rewrite>             <rules>                 <rule name="Cannonical Hostname">                     <match url="(.*)" />                     <conditions logicalGrouping="MatchAll" trackAllCaptures="false">                         <add input="{HTTP_HOST}" pattern="^scottgu\.com$" negate="true" />                     </conditions>                     <action type="Redirect" url="http://scottgu.com/{R:1}" />                 </rule>                 <rule name="Default Document" stopProcessing="true">                     <match url="(.*?)/?Default\.aspx$" />                     <action type="Redirect" url="{R:1}/" />                 </rule>                 <rule name="Lower Case URLs" stopProcessing="true">                     <match url="[A-Z]" ignoreCase="false" />                     <conditions logicalGrouping="MatchAll" trackAllCaptures="false">                         <add input="{URL}" pattern="WebResource.axd" negate="true" />                     </conditions>                     <action type="Redirect" url="{ToLower:{URL}}" />                 </rule>                 <rule name="Trailing Slash" stopProcessing="true">                     <match url="(.*[^/])$" />                     <conditions logicalGrouping="MatchAll" trackAllCaptures="false">                         <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" />                         <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" />                         <add input="{URL}" pattern="WebResource.axd" negate="true" />                     </conditions>                     <action type="Redirect" url="{R:1}/" />                 </rule>             </rules>         </rewrite>     </system.webServer> </configuration> Try the Rule Out Now that we’ve saved the rule, let’s try it out on our site.  Try the following two URLs on my site: http://www.scottgu.com/albums.aspx http://scottgu.com/albums.aspx Notice that the first URL (which has the “www” prefix) now automatically does a redirect to the second URL which does not have the www prefix.  Because it is a permanent redirect, search engines will follow the URL and update the page ranking. 4 Simple Rules for Improved SEO The above 4 rules are pretty easy to setup and should take less than 15 minutes to configure on existing sites you already have.  The beauty of using a solution like the URL Rewrite Extension is that you can take advantage of it without having to change code within your web-site – and without having to break any existing links already pointing at your site.  Users who follow existing links will be automatically redirected to the new URLs you wish to publish.  And search engines will start to give your site a higher search relevancy ranking – which will list your site higher in search results and drive more traffic to it. Customizing your URL Rewriting rules further is easy to-do either by editing the web.config file directly, or alternatively, just double click the URL Rewrite icon within the IIS 7.x admin tool and it will list all the active rules for your web-site or application: Clicking any of the rules above will open the rules editor back up and allow you to tweak/customize/save them further. Summary Measuring and improving SEO is something every developer building a public-facing web-site needs to think about and focus on.  If you haven’t already, download and use the SEO Toolkit to analyze the SEO of your sites today. New URL Routing features in ASP.NET MVC and ASP.NET Web Forms 4 make it much easier to build applications that have more control over the URLs that are published.  Tools like the URL Rewrite Extension that I’ve talked about in this blog post make it much easier to improve the URLs that are published from sites you already have built today – without requiring you to change a lot of code. The URL Rewrite Extension provides a bunch of additional great capabilities – far beyond just SEO - as well.  I’ll be covering these additional capabilities more in future blog posts. Hope this helps, Scott

    Read the article

  • T-SQL Improvements And Data Types in ms sql 2008

    - by Aamir Hasan
     Microsoft SQL Server 2008 is a new version released in the first half of 2008 introducing new properties and capabilities to SQL Server product family. All these new and enhanced capabilities can be defined as the classic words like secure, reliable, scalable and manageable. SQL Server 2008 is secure. It is reliable. SQL2008 is scalable and is more manageable when compared to previous releases. Now we will have a look at the features that are making MS SQL Server 2008 more secure, more reliable, more scalable, etc. in details.Microsoft SQL Server 2008 provides T-SQL enhancements that improve performance and reliability. Itzik discusses composable DML, the ability to declare and initialize variables in the same statement, compound assignment operators, and more reliable object dependency information. Table-Valued ParametersInserts into structures with 1-N cardinality problematicOne order -> N order line items"N" is variable and can be largeDon't want to force a new order for every 20 line itemsOne database round-trip / line item slows things downNo ARRAY data type in SQL ServerXML composition/decomposition used as an alternativeTable-valued parameters solve this problemTable-Valued ParametersSQL Server has table variablesDECLARE @t TABLE (id int);SQL Server 2008 adds strongly typed table variablesCREATE TYPE mytab AS TABLE (id int);DECLARE @t mytab;Parameters must use strongly typed table variables Table Variables are Input OnlyDeclare and initialize TABLE variable  DECLARE @t mytab;  INSERT @t VALUES (1), (2), (3);  EXEC myproc @t;Procedure must declare variable READONLY  CREATE PROCEDURE usetable (    @t mytab READONLY ...)  AS    INSERT INTO lineitems SELECT * FROM @t;    UPDATE @t SET... -- no!T-SQL Syntax EnhancementsSingle statement declare and initialize  DECLARE @iint = 4;Compound Assignment Operators  SET @i += 1;Row constructors  DECLARE @t TABLE (id int, name varchar(20));  INSERT INTO @t VALUES    (1, 'Fred'), (2, 'Jim'), (3, 'Sue');Grouping SetsGrouping Sets allow multiple GROUP BY clauses in a single SQL statementMultiple, arbitrary, sets of subtotalsSingle read pass for performanceNested subtotals provide ever better performanceGrouping Sets are an ANSI-standardCOMPUTE BY is deprecatedGROUPING SETS, ROLLUP, CUBESQL Server 2008 - ANSI-syntax ROLLUP and CUBEPre-2008 non-ANSI syntax is deprecatedWITH ROLLUP produces n+1 different groupings of datawhere n is the number of columns in GROUP BYWITH CUBE produces 2^n different groupingswhere n is the number of columns in GROUP BYGROUPING SETS provide a "halfway measure"Just the number of different groupings you needGrouping Sets are visible in query planGROUPING_ID and GROUPINGGrouping Sets can produce non-homogeneous setsGrouping set includes NULL values for group membersNeed to distinguish by grouping and NULL valuesGROUPING (column expression) returns 0 or 1Is this a group based on column expr. or NULL value?GROUPING_ID (a,b,c) is a bitmaskGROUPING_ID bits are set based on column expressions a, b, and cMERGE StatementMultiple set operations in a single SQL statementUses multiple sets as inputMERGE target USING source ON ...Operations can be INSERT, UPDATE, DELETEOperations based onWHEN MATCHEDWHEN NOT MATCHED [BY TARGET] WHEN NOT MATCHED [BY SOURCE]More on MERGEMERGE statement can reference a $action columnUsed when MERGE used with OUTPUT clauseMultiple WHEN clauses possible For MATCHED and NOT MATCHED BY SOURCEOnly one WHEN clause for NOT MATCHED BY TARGETMERGE can be used with any table sourceA MERGE statement causes triggers to be fired onceRows affected includes total rows affected by all clausesMERGE PerformanceMERGE statement is transactionalNo explicit transaction requiredOne Pass Through TablesAt most a full outer joinMatching rows = when matchedLeft-outer join rows = when not matched by targetRight-outer join rows = when not matched by sourceMERGE and DeterminismUPDATE using a JOIN is non-deterministicIf more than one row in source matches ON clause, either/any row can be used for the UPDATEMERGE is deterministicIf more than one row in source matches ON clause, its an errorKeeping Track of DependenciesNew dependency views replace sp_dependsViews are kept in sync as changes occursys.dm_sql_referenced_entitiesLists all named entities that an object referencesExample: which objects does this stored procedure use?sys.dm_sql_referencing_entities 

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >