Search Results

Search found 7418 results on 297 pages for 'argument passing'.

Page 281/297 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • C# Select clause returns system exception instead of relevant object

    - by Kashif
    I am trying to use the select clause to pick out an object which matches a specified name field from a database query as follows: objectQuery = from obj in objectList where obj.Equals(objectName) select obj; In the results view of my query, I get: base {System.SystemException} = {"Boolean Equals(System.Object)"} Where I should be expecting something like a Car, Make, or Model Would someone please explain what I am doing wrong here? The method in question can be seen here: // this function searches the database's table for a single object that matches the 'Name' property with 'objectName' public static T Read<T>(string objectName) where T : IEquatable<T> { using (ISession session = NHibernateHelper.OpenSession()) { IQueryable<T> objectList = session.Query<T>(); // pull (query) all the objects from the table in the database int count = objectList.Count(); // return the number of objects in the table // alternative: int count = makeList.Count<T>(); IQueryable<T> objectQuery = null; // create a reference for our queryable list of objects T foundObject = default(T); // create an object reference for our found object if (count > 0) { // give me all objects that have a name that matches 'objectName' and store them in 'objectQuery' objectQuery = from obj in objectList where obj.Equals(objectName) select obj; // make sure that 'objectQuery' has only one object in it try { foundObject = (T)objectQuery.Single(); } catch { return default(T); } // output some information to the console (output screen) Console.WriteLine("Read Make: " + foundObject.ToString()); } // pass the reference of the found object on to whoever asked for it return foundObject; } } Note that I am using the interface "IQuatable<T>" in my method descriptor. An example of the classes I am trying to pull from the database is: public class Make: IEquatable<Make> { public virtual int Id { get; set; } public virtual string Name { get; set; } public virtual IList<Model> Models { get; set; } public Make() { // this public no-argument constructor is required for NHibernate } public Make(string makeName) { this.Name = makeName; } public override string ToString() { return Name; } // Implementation of IEquatable<T> interface public virtual bool Equals(Make make) { if (this.Id == make.Id) { return true; } else { return false; } } // Implementation of IEquatable<T> interface public virtual bool Equals(String name) { if (this.Name.Equals(name)) { return true; } else { return false; } } } And the interface is described simply as: public interface IEquatable<T> { bool Equals(T obj); }

    Read the article

  • Virtual member call in a constructor when assigning value to property

    - by comecme
    I have an Abstract class and a Derived class. The abstract class defines an abstract property named Message. In the derived class, the property is implemented by overriding the abstract property. The constructor of the derived class takes a string argument and assigns it to its Message property. In Resharper, this assignment leads to a warning "Virtual member call in constructor". The AbstractClass has this definition: public abstract class AbstractClass { public abstract string Message { get; set; } protected AbstractClass() { } public abstract void PrintMessage(); } And the DerivedClass is as follows: using System; public class DerivedClass : AbstractClass { private string _message; public override string Message { get { return _message; } set { _message = value; } } public DerivedClass(string message) { Message = message; // Warning: Virtual member call in a constructor } public DerivedClass() : this("Default DerivedClass message") {} public override void PrintMessage() { Console.WriteLine("DerivedClass PrintMessage(): " + Message); } } I did find some other questions about this warning, but in those situations there is an actual call to a method. For instance, in this question, the answer by Matt Howels contains some sample code. I'll repeat it here for easy reference. class Parent { public Parent() { DoSomething(); } protected virtual void DoSomething() {}; } class Child : Parent { private string foo; public Child() { foo = "HELLO"; } protected override void DoSomething() { Console.WriteLine(foo.ToLower()); } } Matt doesn't describe on what error the warning would appear, but I'm assuming it will be on the call to DoSomething in the Parent constructor. In this example, I understand what is meant by a virtual member being called. The member call occurs in the base class, in which only a virtual method exists. In my situation however, I don't see why assigning a value to Message would be calling a virtual member. Both the call to and the implementation of the Message property are defined in the derived class. Although I can get rid of the error by making my Derived Class sealed, I would like to understand why this situation is resulting in the warning.

    Read the article

  • MVC using ODP.NET getting ORA-01840

    - by sse
    I am writing a simple MVC Application using ODP.NET. I am trying to call a Pl/Sql proc that inserts a record. Here is the simple Pl/Sql: procedure spAddCountry(pGisRecid in country.GISRECID%type, pCountryCode in country.COUNTRYCODE%type, pCountryName in country.COUNTRYNAME%type, pCurrencyCode in country.CURRENCYCODE%type, pEUTerritory in country.EUTERRITORY%type, pFatCAStatus in country.FATCASTATUS%type, pFATF in country.FATF%type, pFSCountryCode in country.COUNTRYCODE%type, pInsertedBy in country.INSERTEDBY%type, pInsertedOn in country.INSERTEDON%type, pLanguages in country.LANGUAGES%type, pNCCT in country.NCCT%type) is PRAGMA AUTONOMOUS_TRANSACTION; begin INSERT INTO COUNTRY (GISRECID, COUNTRYCODE, COUNTRYNAME, CURRENCYCODE, EUTERRITORY, FATCASTATUS, FATF, FSCOUNTRYCODE, INSERTEDBY, INSERTEDON, LANGUAGES, NCCT) VALUES(pGISRECID, pCOUNTRYCODE, pCOUNTRYNAME, pCURRENCYCODE, pEUTERRITORY, pFATCASTATUS, pFATF, pFSCOUNTRYCODE, pINSERTEDBY, pINSERTEDON, pLANGUAGES, pNCCT); Commit; end; I am having difficulty passing the date parameter, pInsertedOn, to the Stored Proc. I have verified that the web form retrieves the form data successfully and calls the AddCountry method below, which in turns calls the stored proc, spAddCountry, after populating all of the parms. Here is a snippet of the MVC C# code. I get the following exception: "ORA-01840 input value not long enough for date format". public void AddCountry(Country aCountry) //because the country object field names match the form field names they automatically get bound!! { string oradb = "Data Source=XYZ;User Id=XYZ;Password=xyz;"; OracleConnection conn = new OracleConnection(oradb); OracleCommand cmd = conn.CreateCommand(); cmd.CommandText = "tstpack.spAddCountry"; cmd.CommandType = CommandType.StoredProcedure; ... OracleParameter paramInsertedBy = new OracleParameter(); paramInsertedBy.ParameterName = "pInsertedBy"; paramInsertedBy.Value = aCountry.InsertedBy; cmd.Parameters.Add(paramInsertedBy); // CultureInfo ci = new CultureInfo("en-US"); OracleParameter paramInsertedOn = new OracleParameter(); paramInsertedOn.ParameterName = "pInsertedOn"; // paramInsertedOn.Value = DateTime.Now; //just testing to see if it's WebForm issue // paramInsertedOn.Value = Convert.ToDateTime(DateTime.Now.ToString(), ci); //flail! paramInsertedOn.Value = aCountry.InsertedOn; cmd.Parameters.Add(paramInsertedOn); ... conn.Open(); cmd.ExecuteNonQuery(); //CRASH! ORA-01840 conn.Close(); } Just to verify that the flow of the program is working, I tried removing the date parm "pInsertedOn" from the pl/sql and from the parm list above, and everything worked fine. I know I am going off of the rails with the date. Can someone tell me how to pass a date to Oracle from an MVC WebForm? Is there some sort of type cast needed? I would really appreciate an example too. Thanks so much! ps, I did try changing the parm type to Varchar2 in the Pl/Sql and doing some conversions myself in the Pl/Sql, the automatic MVC binder was getting in my way, forcing the property of paramInsertedOn.OracleType to DateTime. I tried forcing it to Varchar2, but no luck there either...

    Read the article

  • Drupal's not reading correct values from DB

    - by John
    Hey Everyone, Here is my current problem. I am working with the chat module and I'm building a module that notifies users via AJAX that they have been invited to a chat. The current table structure for the invites table looks like this: |-------------------------------------------------------------------------| | CCID | NID | INVITER_UID | INVITEE_UID | NOTIFIED | ACCEPTED | |-------------------------------------------------------------------------| | int | int | int | int | (0 or 1) | (0 or 1) | |-------------------------------------------------------------------------| I'm using the periodical updater plug-in for JQuery to continually poll the server to check for invites. When an invite is found, I set the notified from 0 to 1. However, my problem is the periodical updater. When I first see that there is an invite, I notify the user, and set notified to 1. On the next select though, I get the same results before, as if the update didn't work. But, when I got check the database, I can see that it worked just fine. It's as if the query is querying a cache, but I can't figure it out. My code for the periodical updater is as follows: window.onload = function() { var uid = $('a#chat_uid').html(); $.PeriodicalUpdater( '/steelylib/sites/all/modules/_chat_whos_online/ajax/ajax.php', //url to service { method: 'get', //send data via... data: {uid: uid}, //data to send minTimeout: '1000', //min time before server is polled (milli-sec.) maxTimeout: '20000', //max time before server is polled (milli-sec.) multiplyer: '1.5', //multiply against curretn poll time every time constant data is returned type: 'text', //type of data recieved (response type) maxCalls: 0, //max calls to make (0=unlimited) autoStop: 0 //max calls with constant data (0=unlimited/disabled) }, function(data) //callback function { alert( data ); //for now, until i get it working } ); } And my code for the ajax call is as follows: <?php #bootstrap Drupal, and call function, passing current user's uid. function _create_chat_node_check_invites($uid) { cache_clear_all('chatroom_chat_list', 'cache'); $query = "SELECT * FROM {chatroom_chat_invite} WHERE notified=0 AND invitee_uid=%d and accepted=0"; $query_results = db_query( $query, $uid ); $json = '{"invites":['; while( $row = db_fetch_object($query_results) ) { var_dump($row); global $base_url; $url = $base_url . '/content/privatechat' . $uid .'-' . $row->inviter_uid; $inviter = db_fetch_object( db_query( "SELECT name FROM {users} WHERE uid = %d", $row->inviter_uid ) ); $invitee = db_fetch_object( db_query( "SELECT name FROM {users} WHERE uid = %d", $row->invitee_uid ) ); #reset table $query = "UPDATE {chatroom_chat_invite} " ."SET notified=1 " ."WHERE inviter_uid=%d AND invitee_uid=%d"; db_query( $query, $row->inviter_uid, $row->invitee_uid ); $json .= '['; $json .= '"' . $url . '",'; $json .= '"' . ($inviter->name) . '",'; $json .= '"' . ($invitee->name) . '"' ; $json .= '],'; } $json = substr($json, 0, -1); $json .= ']}'; return $json; } ?> I can't figure out what is going wrong, any help is greatly appreciated!

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • Using fft2 with reshaping for an RGB filter

    - by Mahmoud Aladdin
    I want to apply a filter on an image, for example, blurring filter [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]. Also, I'd like to use the approach that convolution in Spatial domain is equivalent to multiplication in Frequency domain. So, my algorithm will be like. Load Image. Create Filter. convert both Filter & Image to Frequency domains. multiply both. reconvert the output to Spatial Domain and that should be the required output. The following is the basic code I use, the image is loaded and displayed as cv.cvmat object. Image is a class of my creation, it has a member image which is an object of scipy.matrix and toFrequencyDomain(size = None) uses spf.fftshift(spf.fft2(self.image, size)) where spf is scipy.fftpack and dotMultiply(img) uses scipy.multiply(self.image, image) f = Image.fromMatrix([[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]) lena = Image.fromFile("Test/images/lena.jpg") print lena.image.shape lenaf = lena.toFrequencyDomain(lena.image.shape) ff = f.toFrequencyDomain(lena.image.shape) lenafm = lenaf.dotMultiplyImage(ff) lenaff = lenafm.toTimeDomain() lena.display() lenaff.display() So, the previous code works pretty well, if I told OpenCV to load the image via GRAY_SCALE. However, if I let the image to be loaded in color ... lena.image.shape will be (512, 512, 3) .. so, it gives me an error when using scipy.fttpack.ftt2 saying "When given, Shape and Axes should be of same length". What I tried next was converted my filter to 3-D .. as [[[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]] And, not knowing what the axes argument do, I added it with random numbers as (-2, -1, -1), (-1, -1, -2), .. etc. until it gave me the correct filter output shape for the dotMultiply to work. But, of course it wasn't the correct value. Things were totally worse. My final trial, was using fft2 function on each of the components 2-D matrices, and then re-making the 3-D one, using the following code. # Spiltting the 3-D matrix to three 2-D matrices. for i, row in enumerate(self.image): r.append(list()) g.append(list()) b.append(list()) for pixel in row: r[i].append(pixel[0]) g[i].append(pixel[1]) b[i].append(pixel[2]) rfft = spf.fftshift(spf.fft2(r, size)) gfft = spf.fftshift(spf.fft2(g, size)) bfft = spf.fftshift(spf.fft2(b, size)) newImage.image = sp.asarray([[[rfft[i][j], gfft[i][j], bfft[i][j]] for j in xrange(len(rfft[i]))] for i in xrange(len(rfft))] ) return newImage Any help on what I made wrong, or how can I achieve that for both GreyScale and Coloured pictures.

    Read the article

  • can't the asp file system object access shared server paths?

    - by sushant
    i am using this code to access files and folders. <%@ Language=VBScript %><% option explicit dim sRoot, sDir, sParent, objFSO, objFolder, objFile, objSubFolder, sSize %> <META content="Microsoft Visual Studio 6.0" name=GENERATOR><!-- Author: Adrian Forbes --> <% sRoot = "D:Raghu" sDir = Request("Dir") sDir = sDir & "\" Response.Write "<h1>" & sDir & "</h1>" & vbCRLF Set objFSO = CreateObject("Scripting.FileSystemObject") on error resume next Set objFolder = objFSO.GetFolder(sRoot & sDir) if err.number <> 0 then Response.Write "Could not open folder" Response.End end if on error goto 0 sParent = objFSO.GetParentFolderName(objFolder.Path) ' Remove the contents of sRoot from the front. This gives us the parent ' path relative to the root folder ' eg. if parent folder is "c:webfilessubfolder1subfolder2" then we just want "subfolder1subfolder2" sParent = mid(sParent, len(sRoot) + 1) Response.Write "<table border=""1"">" ' Give a link to the parent folder. This is just a link to this page only pssing in ' the new folder as a parameter Response.Write "<tr><td colspan=3><a href=""browse.asp?dir=" & Server.URLEncode(sParent) & """>Parent folder</a></td></tr>" & vbCRLF ' Now we want to loop through the subfolders in this folder For Each objSubFolder In objFolder.SubFolders ' And provide a link to them Response.Write "<tr><td colspan=3><a href=""browse.asp?dir=" & Server.URLEncode(sDir & objSubFolder.Name) & """>" & objSubFolder.Name & "</a></td></tr>" & vbCRLF Next ' Now we want to loop through the files in this folder For Each objFile In objFolder.Files if Clng(objFile.Size) < 1024 then sSize = objFile.Size & " bytes" else sSize = Clng(objFile.Size / 1024) & " KB" end if ' And provide a link to view them. This is a link to show.asp passing in the directory and the file ' as parameters Response.Write "<tr><td><a href=""show.asp?file=" & server.URLEncode(objFile.Name) & "&dir=" & server.URLEncode (sDir) & """>" & objFile.Name & "</a></td><td>" & sSize & "</td><td>" & objFile.Type & "</td></tr>" & vbCRLF Next Response.Write "</table>" %> it works fine. but when i try to access something on shared path like: "\\cvrdd0110:share" it gives error. how to access these files? and sorry for formatting issues.

    Read the article

  • How to make a jQuery plugin (the right way)?

    - by macek
    I know there are jQuery cookie plugins out there, but I wanted to write one for the sake of better learning the jQuery plugin pattern. I like the separation of "work" in small, manageable functions, but I feel like I'm passing name, value, and options arguments around too much. Is there a way this can be refactored? I'm looking for snippets of code to help illustrate examples provided with in answers. Any help is appreciated. Thanks :) example usage $.cookie('foo', 'bar', {expires:7}); $.cookie('foo'); //=> bar $.cookie('foo', null); $.cookie('foo'); //=> undefined Edit: I did a little bit of work on this. You can view the revision history to see where this has come from. It still feels like more refactoring can be done to optimize the flow a bit. Any ideas? the plugin (function($){ $.cookie = function(name, value, options) { if (typeof value == 'undefined') { return get(name); } else { options = $.extend({}, $.cookie.defaults, options || {}); return (value != null) ? set(name, value, options) : unset(name, options); } }; $.cookie.defaults = { expires: null, path: '/', domain: null, secure: false }; var set = function(name, value, options){ console.log(options); return document.cookie = options_string(name, value, options); }; var get = function(name){ var cookies = {}; $.map(document.cookie.split(';'), function(pair){ var c = $.trim(pair).split('='); cookies[c[0]] = c[1]; }); return decodeURIComponent(cookies[name]); }; var unset = function(name, options){ value = ''; options.expires = -1; set(name, value, options); }; var options_string = function(name, value, options){ var pairs = [param.name(name, value)]; $.each(options, function(k,v){ pairs.push(param[k](v)); }); return $.map(pairs, function(p){ return p === null ? null : p; }).join(';'); }; var param = { name: function(name, value){ return name + "=" + encodeURIComponent(value); }, expires: function(value){ // no expiry if(value === null){ return null; } // number of days else if(typeof value == "number"){ d = new Date(); d.setTime(d.getTime() + (value * 24 * 60 * 60 * 1000)); } // date object else if(typeof value == "object" && value instanceof "Date") { d = value; } return "expires=" + d.toUTCString(); }, path: function(value){ return "path="+value; }, domain: function(value){ return value === null ? null : "domain=" + value; }, secure: function(bool){ return bool ? "secure" : null; } }; })(jQuery);

    Read the article

  • How to bind to the sum of two data bound values in WPF?

    - by Sheridan
    I have designed an analog clock control. It uses the stroke from two ellipses to represent an outer border and an inner border to the clock face. I have exposed properties in the UserControl that allow a user to alter the thickness of these two borders. The Ellipse.StrokeThickness properties are then bound to these UserControl properties. At the moment, I am binding the UserControl property for the outer border thickness to the margins of the inner elements so that they are not hidden when the border size is increased. <Ellipse Name="OuterBorder" Panel.ZIndex="1" StrokeThickness="{Binding OuterBorderThickness, ElementName=This}" Stroke="{StaticResource OuterBorderBrush}" /> <Ellipse Name="InnerBorder" Panel.ZIndex="5" StrokeThickness="{Binding InnerBorderThickness, ElementName=This}" Margin="{Binding OuterBorderThickness, ElementName=This}" Stroke="{StaticResource InnerBorderBrush}"> ... <Ellipse Name="Face" Panel.ZIndex="1" Margin="{Binding OuterBorderThickness, ElementName=This}" Fill="{StaticResource FaceBackgroundBrush}" /> ... The problem is that if the inner border thickness is increased, this does not affect the margins and so the hour ticks and numbers can become partially obscured or hidden. So what I really need is to be able to bind the margin properties of the inner controls to the sum of the inner and outer border thickness values (they are of type double). I have done this successfully using 'DataContext = this;', but am trying to rewrite the control without this as I hear it is not recommended. I also thought about using a converter and passing the second value as the ConverterParameter, but didn't know how to bind to the ConverterParameter. Any tips would be greatly appreciated. EDIT Thanks to Kent's suggestion, I've created a simple MultiConverter to add the input values and return the result. I've hooked the SAME multibinding with converter XAML to both a TextBlock.Text property and the TextBlock.Margin property to test it. <TextBlock> <TextBlock.Text> <MultiBinding Converter="{StaticResource SumConverter}" ConverterParameter="Add"> <Binding Path="OuterBorderThickness" ElementName="This" /> <Binding Path="InnerBorderThickness" ElementName="This" /> </MultiBinding> </TextBlock.Text> <TextBlock.Margin> <MultiBinding Converter="{StaticResource SumConverter}" ConverterParameter="Add"> <Binding Path="OuterBorderThickness" ElementName="This" /> <Binding Path="InnerBorderThickness" ElementName="This" /> </MultiBinding> </TextBlock.Margin> </TextBlock> I can see the correct value displayed in the TexBlock, but the Margin is not set. Any ideas? EDIT Interestingly, the Margin property can be bound to a data property of type double, but this does not seem to apply within a MultiBinding. As advised by Kent, I changed the Converter to return the value as a Thickness object and now it works. Thanks Kent.

    Read the article

  • Contact Form using validation to send to phpmailer

    - by Jaciinto
    This is the first time I have ever wrote anything in java script so I am unsure if I am doing anything right. I used yensdesign.com tutorial as an example and went from there but cant get it to submit the var to validation.php and also can not get it to at the end give me congrats message for it passing. Any help would be greatly appreciated. //Form $(document).ready(function(){ //global vars var form = $("#contactForm"); var title = $("#contactTitle"); var name = $("#contactName"); var email = $("#contactEmail"); var message = $("#contactMessage"); //On blur name.blur(validateName); email.blur(validateEmail); title.blur(validateTitle); //On key press name.keyup(validateName); email.keyup(validateEmail); title.keyup(validateTitle); message.keyup(validateMessage); //validation functions function validateEmail() { //testing regular expression var a = $("#contactEmail").val(); var filter = /^[a-zA-Z0-9]+[a-zA-Z0-9_.-]+[a-zA-Z0-9_-]+@[a-zA-Z0-9]+[a-zA-Z0-9.-]+[a-zA-Z0-9]+.[a-z]{2,4}$/; //if it's valid email if(filter.test(a)) { email.removeClass("contactError"); return true; } //if it's NOT valid else { email.addClass("contactError"); return false; } } function validateName() { //if it's NOT valid if(name.val().length < 4) { name.addClass("contactError"); return false; } //if it's valid else { name.removeClass("contactError"); return true; } } function validateTitle() { //if it's NOT valid if(title.val().length < 4) { title.addClass("contactError"); return false; } //if it's valid else { title.removeClass("contactError"); return true; } } function validateMessage(){ //it's NOT valid if(message.val().length < 10){ message.addClass("contactError"); return false; } //it's valid else{ message.removeClass("contactError"); return true; } } var dataString = 'name='+ name + '&email=' + email + '&number=' + number + '&comment=' + comment; function valid () { if(validateName() & validateEmail() & validateTitle() & validateMessage()) { type: "POST", url: "bin/process.php", data: dataString, success: function() { $('#contactForm').html("<div id='message'></div>"); $('#message').html("<h2>Thanks!</h2>") .append("<p>We will be in touch soon.</p>") .hide() .fadeIn(1500, function() { $('#message').append("<img id='checkmark' src='images/check.png' />"); }); } else { return false; } } });

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • asp.net mvc radio button state

    - by Josh Bush
    I'm trying out asp.net mvc for a new project, and I ran across something odd. When I use the MVC UI helpers for textboxes, the values get persisted between calls. But, when I use a series of radio buttons, the checked state doesn't get persisted. Here's an example from my view. <li> <%=Html.RadioButton("providerType","1")%><label>Hospital</label> <%=Html.RadioButton("providerType","2")%><label>Facility</label> <%=Html.RadioButton("providerType","3")%><label>Physician</label> </li> When the form gets posted back, I build up an object with "ProviderType" as one of it's properties. The value on the object is getting set, and then I RedirectToAction with the provider as a argument. All is well, and I end up at a URL like "http://localhost/Provider/List?ProviderType=1" with ProviderType showing. The value gets persisted to the URL, but the UI helper isn't picking up the checked state. I'm having this problem with listbox, dropdownlist, and radiobutton. Textboxes pick up the values just fine. Do you see something I'm doing wrong? I'm assuming that the helpers will do this for me, but maybe I'll just have to take care of this on my own. I'm just feeling my way through this, so your input is appreciated. Edit: I just found the override for the SelectList constructor that takes a selected value. That took care of my dropdown issue I mentioned above. Edit #2: I found something that works, but it pains me to do it this way. I feel like this should be inferred. <li> <%=Html.RadioButton("ProviderType","1",Request["ProviderType"]=="1")%><label>Hospital</label> <%=Html.RadioButton("ProviderType", "2", Request["ProviderType"] == "2")%><label>Facility</label> <%=Html.RadioButton("ProviderType", "3", Request["ProviderType"] == "3")%><label>Physician</label> </li> Hopefully someone will come up with another way.

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • mysql_fetch_array() problem

    - by Marty
    So I have 3 DB tables that are all identical in every way (data is different) except the name of the table. I did this so I could use one piece of code with a switch like so: function disp_bestof($atts) { extract(shortcode_atts(array( 'topic' => '' ), $atts)); $connect = mysql_connect("localhost","foo","bar"); if (!$connect) { die('Could not connect: ' . mysql_error()); } switch ($topic) { case "attorneys": $bestof_query = "SELECT * FROM attorneys p JOIN (awards a, categories c, awardLevels l) ON (a.id = p.id AND c.id = a.category AND l.id = a.level) ORDER BY a.category, a.level ASC"; $category_query = "SELECT * FROM categories"; $db = mysql_select_db('roanoke_BestOf_TopAttorneys'); $query = mysql_query($bestof_query); $categoryQuery = mysql_query($category_query); break; case "physicians": $bestof_query = "SELECT * FROM physicians p JOIN (awards a, categories c, awardLevels l) ON (a.id = p.id AND c.id = a.category AND l.id = a.level) ORDER BY a.category, a.level ASC"; $category_query = "SELECT * FROM categories"; $db = mysql_select_db('roanoke_BestOf_TopDocs'); $query = mysql_query($bestof_query); $categoryQuery = mysql_query($category_query); break; case "dining": $bestof_query = "SELECT * FROM restaurants p JOIN (awards a, categories c, awardLevels l) ON (a.id = p.id AND c.id = a.category AND l.id = a.level) ORDER BY a.category, a.level ASC"; $category_query = "SELECT * FROM categories"; $db = mysql_select_db('roanoke_BestOf_DiningAwards'); $query = mysql_query($bestof_query); $categoryQuery = mysql_query($category_query); break; default: $bestof_query = "switch on $best did not match required case(s)"; break; } $category = ''; while( $result = mysql_fetch_array($query) ) { if( $result['category'] != $category ) { $category = $result['category']; //echo "<div class\"category\">"; $bestof_content .= "<h2>".$category."</h2>\n"; //echo "<ul>"; Now, this whole thing works PERFECT for the first two cases, but the third one "dining" breaks with this error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource ... on line 78 Line 78 is the while() at the bottom. I have checked and double checked and can't figure what the problem is. Here's the DB structure for 'restaurants': CREATE TABLE `restaurants` ( `id` int(10) NOT NULL auto_increment, `restaurant` varchar(255) default NULL, `address1` varchar(255) default NULL, `address2` varchar(255) default NULL, `city` varchar(255) default NULL, `state` varchar(255) default NULL, `zip` double default NULL, `phone` double default NULL, `URI` varchar(255) default NULL, `neighborhood` varchar(255) default NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM AUTO_INCREMENT=249 DEFAULT CHARSET=utf8 Does anyone see what I'm doing wrong here? I'm passing "dining" to the function and as I said before, the first two cases in the switch work fine. I'm sure it's something stupid...

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • Magento Onepage Success Conversion Tracking Design Pattern

    - by user1734954
    My intent is to track conversions through multiple channels by inserting third party javascript (for example google analytics, optimizely, pricegrabber etc.) into the footer of onepage success . I've accomplished this by adding a block to the footer reference inside of the checkout success node within local.xml and everything works appropriately. My questions are more about efficiency and extensibility. It occurred to me that it would be better to combine all of the blocks into a single block reference and then use a various methods acting on a single call to the various related models to provide the data needed for insertion into the javascript for each of the conversion tracking scripts. Some examples of the common data that conversion tracking may rely on(pseudo): Order ID , Order Total, Order.LineItem.Name(foreach) and so on Currently for each of the scripts I've made a call to the appropriate model passing the customers last order id as the load value and the calling a get() assigning the return value to a variable and then iterating through the data to match the values with the expectations of the given third party service. All of the data should be pulled once when checkout is complete each third party services may expect different data in different formats Here is an example of one of the conversion tracking template files which loads at the footer of checkout success. $order = Mage::getModel('sales/order')->loadByIncrementId(Mage::getSingleton('checkout/session')->getLastRealOrderId()); $amount = number_format($order->getGrandTotal(),2); $customer = Mage::helper('customer')->getCustomer()->getData(); ?> <script type="text/javascript"> popup_email = '<?php echo($customer['email']);?>'; popup_order_number = '<?php echo $this->getOrderId() ?>'; </script> <!-- PriceGrabber Merchant Evaluation Code --> <script type="text/javascript" charset="UTF-8" src="https://www.pricegrabber.com/rating_merchrevpopjs.php?retid=<something>"></script> <noscript><a href="http://www.pricegrabber.com/rating_merchrev.php?retid=<something>" target=_blank> <img src="https://images.pricegrabber.com/images/mr_noprize.jpg" border="0" width="272" height="238" alt="Merchant Evaluation"></a></noscript> <!-- End PriceGrabber Code --> Having just a single piece of code like this is not that big of a deal, but we are doing similar things with a number of different third party services. Pricegrabber is one of the simpler examples. A more sophisticated tracking service expects a comma separated list of all of the product names, ids, prices, categories , order id etc. I would like to make it all more manageable so my idea to do the following: combine all of the template files into a single file Develop a helper class or library to deliver the data to the conversion template Goals Include Extensibility Minimal Model Calls Minimal Method Calls The Questions 1. Is a Mage helper the best route to take? 2. Is there any design pattern you may recommend for the "helper" class? 3. Why would this the design pattern you've chosen be best for this instance?

    Read the article

  • trie reg exp parse step over char and continue

    - by forest.peterson
    Setup: 1) a string trie database formed from linked nodes and a vector array linking to the next node terminating in a leaf, 2) a recursive regular expression function that if A) char '*' continues down all paths until string length limit is reached, then continues down remaining string paths if valid, and B) char '?' continues down all paths for 1 char and then continues down remaining string paths if valid. 3) after reg expression the candidate strings are measured for edit distance against the 'try' string. Problem: the reg expression works fine for adding chars or swapping ? for a char but if the remaining string has an error then there is not a valid path to a terminating leaf; making the matching function redundant. I tried adding a 'step-over' ? char if the end of the node vector was reached and then followed every path of that node - allowing this step-over only once; resulted in a memory exception; I cannot find logically why it is accessing the vector out of range - bactracking? Questions: 1) how can the regular expression step over an invalid char and continue with the path? 2) why is swapping the 'sticking' char for '?' resulting in an overflow? Function: void Ontology::matchRegExpHelper(nodeT *w, string inWild, Set<string> &matchSet, string out, int level, int pos, int stepover) { if (inWild=="") { matchSet.add(out); } else { if (w->alpha.size() == pos) { int testLength = out.length() + inWild.length(); if (stepover == 0 && matchSet.size() == 0 && out.length() > 8 && testLength == tokenLength) {//candidate generator inWild[0] = '?'; matchRegExpHelper(w, inWild, matchSet, out, level, 0, stepover+1); } else return; //giveup on this path } if (inWild[0] == '?' || (inWild[0] == '*' && (out.length() + inWild.length() ) == level ) ) { //wild matchRegExpHelper(w->alpha[pos].next, inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover);//follow path -> if ontology is full, treat '*' like a '?' } else if (inWild[0] == '*') matchRegExpHelper(w->alpha[pos].next, '*'+inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover); //keep adding chars if (inWild[0] == w->alpha[pos].letter) //follow self matchRegExpHelper(w->alpha[pos].next, inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover); //follow char matchRegExpHelper(w, inWild, matchSet, out, level, pos+1, stepover);//check next path } } Error Message: +str "Attempt to access index 1 in a vector of size 1." std::basic_string<char,std::char_traits<char>,std::allocator<char> > +err {msg="Attempt to access index 1 in a vector of size 1." } ErrorException Note: this function works fine for hundreds of test strings with '*' wilds if the extra stepover gate is not used Semi-Solved: I place a pos < w->alpha.size() condition on each path that calls w->alpha[pos]... - this prevented the backtrack calls from attempting to access the vector with an out of bounds index value. Still have other issues to work out - it loops infinitely adding the ? and backtracking to remove it, then repeat. But, moving forward now. Revised question: why during backtracking is the position index accumulating and/or not deincrementing - so at somepoint it calls w->alpha[pos]... with an invalid position that is either remaining from the next node or somehow incremented pos+1 when passing upward?

    Read the article

  • Haskell type classes and type families (cont'd)

    - by Giuseppe Maggiore
    I need some help in figuring a compiler error which is really driving me nuts... I have the following type class: infixl 7 --> class Selectable a s b where type Res a s b :: * (-->) :: (CNum n) => (Reference s a) -> (n,(a->b),(a->b->a)) -> Res a s b which I instance twice. First time goes like a charm: instance Selectable a s b where type Res a s b = Reference s b (-->) (Reference get set) (_,read,write) = (Reference (\s -> let (v,s') = get s in (read v,s')) (\s -> \x -> let (v,s') = get s v' = write v x (_,s'') = set s' v' in (x,s''))) since the type checker infers (-->) :: Reference s a -> (n,a->b,a->b->a) -> Reference s b and this signature matches with the class signature for (--) since Res a s b = Reference s b Now I add a second instance and everything breaks: instance (Recursive a, Rec a ~ reca) => Selectable a s (Method reca b c) where type Res a s (Method reca b c) = b -> Reference s c (-->) (Reference get set) (_,read,write) = \(x :: b) -> from_constant( Constant(\(s :: s)-> let (v,s') = get s :: (a,s) m = read v ry = m x :: Reference (reca) c (y,v') = getter ry (cons v) :: (c,reca) v'' = elim v' (_,s'') = set s' v'' in (y,s''))) :: Reference s c the compiler complains that Couldn't match expected type `Res a s (Method reca b c)' against inferred type `b -> Reference s c' The lambda expression `\ (x :: b) -> ...' has one argument, which does not match its type In the expression: \ (x :: b) -> from_constant (Constant (\ (s :: s) -> let ... in ...)) :: Reference s c In the definition of `-->': --> (Reference get set) (_, read, write) = \ (x :: b) -> from_constant (Constant (\ (s :: s) -> ...)) :: Reference s c reading carefully the compiler is telling me that it has inferred the type of (--) thusly: (-->) :: Reference s a -> (n,a->(Method reca b c),a->(Method reca b c)->a) -> (b -> Reference s c) which is correct since Res a s (Method reca b c) = b -> Reference s c but why can't it match the two definitions? Sorry for not offering a more succint and standalone example, but in this case I cannot figure how to do it...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • java will this threading setup work or what can i be doing wrong

    - by Erik
    Im a bit unsure and have to get advice. I have the: public class MyApp extends JFrame{ And from there i do; MyServer = new MyServer (this); MyServer.execute(); MyServer is a: public class MyServer extends SwingWorker<String, Object> { MyServer is doing listen_socket.accept() in the doInBackground() and on connection it create a new class Connection implements Runnable { I have the belove DbHelper that are a singleton. It holds an Sqlite connected. Im initiating it in the above MyApp and passing references all the way in to my runnable: class Connection implements Runnable { My question is what will happen if there are two simultaneous read or `write? My thought here was the all methods in the singleton are synchronized and would put all calls in the queue waiting to get a lock on the synchronized method. Will this work or what can i change? public final class DbHelper { private boolean initalized = false; private String HomePath = ""; private File DBFile; private static final String SYSTEM_TABLE = "systemtable"; Connection con = null; private Statement stmt; private static final ContentProviderHelper instance = new ContentProviderHelper (); public static ContentProviderHelper getInstance() { return instance; } private DbHelper () { if (!initalized) { initDB(); initalized = true; } } private void initDB() { DBFile = locateDBFile(); try { Class.forName("org.sqlite.JDBC"); // create a database connection con = DriverManager.getConnection("jdbc:sqlite:J:/workspace/workComputer/user_ptpp"); } catch (SQLException e) { e.printStackTrace(); } catch (ClassNotFoundException e) { e.printStackTrace(); } } private File locateDBFile() { File f = null; try{ HomePath = System.getProperty("user.dir"); System.out.println("HomePath: " + HomePath); f = new File(HomePath + "/user_ptpp"); if (f.canRead()) return f; else { boolean success = f.createNewFile(); if (success) { System.out.println("File did not exist and was created " + HomePath); // File did not exist and was created } else { System.out.println("File already exists " + HomePath); // File already exists } } } catch (IOException e) { System.out.println("Maybe try a new directory. " + HomePath); //Maybe try a new directory. } return f; } public String getHomePath() { return HomePath; } private synchronized String getDate(){ SimpleDateFormat dateFormat = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss"); Date date = new Date(); return dateFormat.format(date); } public synchronized String getSelectedSystemTableColumn( String column) { String query = "select "+ column + " from " + SYSTEM_TABLE ; try { stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); ResultSet rs = stmt.executeQuery(query); while (rs.next()) { String value = rs.getString(column); if(value == null || value == "") return ""; else return value; } } catch (SQLException e ) { e.printStackTrace(); return ""; } finally { } return ""; } }

    Read the article

  • Damaged data when gzipping

    - by RadiantHeart
    This is the script I hva written for gzipping content on my site, which is located in 'gzip.php'. The way i use it is that on pages where I want to enable gzipping i include the file at the top and at the bottom i call the output function like this: print_gzipped_page('javascript') If the file is a css-file i use 'css' as the $type-argument and if its a php file i call the function without declaring any arguments. The script works fine in all browsers except Opera which gives an error saying it could not decode the page due to damaged data. Can anyone tell me what I have done wrong? <?php function print_gzipped_page($type = false) { if(headers_sent()){ $encoding = false; } elseif( strpos($_SERVER['HTTP_ACCEPT_ENCODING'], 'x-gzip') !== false ){ $encoding = 'x-gzip'; } elseif( strpos($_SERVER['HTTP_ACCEPT_ENCODING'],'gzip') !== false ){ $encoding = 'gzip'; } else{ $encoding = false; } if ($type!=false) { $type_header_array = array("css" => "Content-Type: text/css", "javascript" => "Content-Type: application/x-javascript"); $type_header = $type_header_array[$type]; } $contents = ob_get_contents(); ob_end_clean(); $etag = '"' . md5($contents) . '"'; $etag_header = 'Etag: ' . $etag; header($etag_header); if ($type!=false) { header($type_header); } if (isset($_SERVER['HTTP_IF_NONE_MATCH']) and $_SERVER['HTTP_IF_NONE_MATCH']==$etag) { header("HTTP/1.1 304 Not Modified"); exit(); } if($encoding){ header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); } echo $contents; exit(); } ob_start(); ob_implicit_flush(0); ?> Additional info: The script works if the length og the document beeing compressed is only 10-15 characters.

    Read the article

  • Error With Sending mail (kSKPSMTPPartMessageKey is nil)

    - by user1553381
    I'm trying to send mail in iPhone using "SKPSMTPMessage" and I added the libraries, In my class I added the following code: - (IBAction)sendMail:(id)sender { // if there are a connection if ([theConnection isEqualToString:@"true"]) { if ([fromEmail.text isEqualToString:@""] || [toEmail.text isEqualToString:@""]) { UIAlertView *warning = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ??? ????? ???? ????????" delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [warning show]; }else { SKPSMTPMessage *test_smtp_message = [[SKPSMTPMessage alloc] init]; test_smtp_message.fromEmail = fromEmail.text; test_smtp_message.toEmail = toEmail.text; test_smtp_message.relayHost = @"smtp.gmail.com"; test_smtp_message.requiresAuth = YES; test_smtp_message.login = @"[email protected]"; test_smtp_message.pass = @"myPass"; test_smtp_message.wantsSecure = YES; NSString *subject= @"Suggest a book for you"; test_smtp_message.subject = [NSString stringWithFormat:@"%@ < %@ > ",fromEmail.text, subject]; test_smtp_message.delegate = self; NSMutableArray *parts_to_send = [NSMutableArray array]; NSDictionary *plain_text_part = [NSDictionary dictionaryWithObjectsAndKeys: @"text/plain\r\n\tcharset=UTF-8;\r\n\tformat=flowed", kSKPSMTPPartContentTypeKey, [messageBody.text stringByAppendingString:@"\n"], kSKPSMTPPartMessageKey, @"quoted-printable", kSKPSMTPPartContentTransferEncodingKey, nil]; [parts_to_send addObject:plain_text_part]; // to send attachment NSString *image_path = [[NSBundle mainBundle] pathForResource:BookCover ofType:@"jpg"]; NSData *image_data = [NSData dataWithContentsOfFile:image_path]; NSDictionary *image_part = [NSDictionary dictionaryWithObjectsAndKeys: @"inline;\r\n\tfilename=\"image.png\"",kSKPSMTPPartContentDispositionKey, @"base64",kSKPSMTPPartContentTransferEncodingKey, @"image/png;\r\n\tname=Success.png;\r\n\tx-unix-mode=0666",kSKPSMTPPartContentTypeKey, [image_data encodeWrappedBase64ForData],kSKPSMTPPartMessageKey, nil]; [parts_to_send addObject:image_part]; test_smtp_message.parts = parts_to_send; Spinner.hidden = NO; [Spinner startAnimating]; ProgressBar.hidden = NO; HighestState = 0; [test_smtp_message send]; } }else { UIAlertView *alertNoconnection = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ???? ???? " delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [alertNoconnection show]; } } but when I tried to send it gives me the following Exception: *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFString appendString:]: nil argument' and it highlighted this line in SKPSMTPMessage.m [message appendString:[part objectForKey:kSKPSMTPPartMessageKey]]; and I Can't understand what is nil exactly Can Anyone help me in this issue? Thanks in Advance.

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >