Search Results

Search found 7651 results on 307 pages for 'execution plan'.

Page 282/307 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

• Unlimited SMS API/Gateway (Sending and Receiving)

  - by Naif

  I am creating a chat application which requires that users be able to send and receive sms messages through a web interface. It would be somewhat similar to the text messaging service available in yahoo mail or in aol instant messenger. The situation is this: Given the high quantity of messages that would be sent and received, paying on a per message basis is not economically feasible. How is it that sites such as yahoo, aim, and twitter can send and receive unlimited sms messages? Essentially, I am looking for a way to send and receive unlimited sms from my computer. Below is a list of some approaches I've come up with but have run into problems with as well. If just one of the approaches can be utilized effectively, then I am fine. As a note on the nature of my application: I will only be sending messages to users that explicitly sign up for the service and permit the receiving of messages. They can unsubscribe at any time. This is to prevent spam. I am aware of software such as Kannel which allows one to connect to a providers smsc gateway. However, this adds the risk of not being approved by the provider which would be unacceptable. Is there any way to significantly mitigate this risk? Utilizing a gateway provider eliminates this risk, but adds the issue of per message pricing. I am also aware of email to sms. However, I have done some testing with that and it appears that this method results in many messages being undelivered or delivered VERY late. If it weren't for that, this approach would have been ideal. Is there any way to negotiate with carriers to remove me from their filters (considering the nature of my service as stated before)? I could use a gsm modem, but even with an "unilimited" plan on a sim card, there are still limits (around 100,000 messages or so). Furthermore, from my understanding, gsm modems are capable of only sending out around a dozen messages per minute. I need to be able to send out as much as several hundred messages per second. During the first 2 months, around 10 messages per second would suffice. There are ways to send out ads with messages to cover the per message costs. However, this is a deal-breaker since it has a high chance of tarnishing the quality of service. Furthermore, I know it is possible to do it without such ads since yahoo, aim, and twitter do not send ads with their messages.

  Read the article

• dynamic module creation

  - by intuited

  I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

  Read the article

• mootools fx working except in ie9

  - by Craig

  This is my first attempt with Mootools, so I welcome a critique of the code. I have a dynamic list of images that expand on the 'click" event and contract on the 'mouseout' event. The code works fine in all browsers (FF, Safari, Chrome, even the smartphones) but not in IE9 (JS is enabled) Anyone with similar problem or solution? I plan to use a lightbox effect, downloading a larger & clearer image to the center of the page, instead of just resizing a small image. However, I am hesitant to attempt this, if there is problems with IE9. I have coded three image sizes with the upload commit, so the larger image is available for the lightbox, but, I don't see anything in mootools for a lightbox, or am I missing it? $i = 0; while($i < count($validate)) { <div class="validate"> <div class="validate_image_<?php echo $validate[$i]['validate_type']; ?>"> <div class="validate_image" id="validate_image_wrapper_<?php echo $i; ?>"> <?php if ($validate[$i]['validate_image_filename'] != '') { if (file_exists(UPLOAD_DIR . 'validate_image/' . str_replace('.', '_medium.', $validate[$i]['validate_image_filename']))) { echo '<img src="' . UPLOAD_URL . 'validate_image/' . str_replace('.', '_medium.', $validate[$i]['validate_image_filename']) . '" alt="Listing Image" />'; } else { echo '<img src="' . UPLOAD_URL . 'validate_image/' . str_replace('.', '_large.', $validate[$i]['validate_image_filename']) . '" alt="Listing image" />'; } } else { ?> <img src="/images/no_image_posted_validate.png" alt="no image posted" /> <?php } ?> </div> ... remainder of HTML display code function setupEnlargeImage() { window.myFx = new Fx({ duration: 200, transition: Fx.Transitions.Sine.easeOut }); $$('.validate_image').addEvent('click', function() { window.selectedImage = this.id; myFx.start(1,2.0); }); $$('.validate_image').addEvent('mouseout', function() { window.selectedImage = this.id; myFx.start(1.0,1); }); myFx.set = function(value) { var style = "scale(" + (value) + ")"; $(window.selectedImage).setStyles({ "-webkit-transform": style, "-moz-transform": style, "-o-transform": style, "-ms-transform": style, transform: style }); } }

  Read the article

• Mysql select - improve performances

  - by realshadow

  Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

  Read the article

• small scale web site - global javascript file style/format/pattern - improving maintainability

  - by yaya3

  I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• 2nd Year College - Learning - Microsoft Server Products

  - by Ryan

  As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

  Read the article

• Jumping into argv?

  - by jth

  Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

  Read the article

• How can I improve the recursion capabilities of my ECMAScript implementation?

  - by ChaosPandion

  After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

  Read the article

• Proper HTML technique to create an web form out of an image

  - by Lars

  I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

  Read the article

• What common routines do you put in your Program.cs for C#

  - by Rick

  I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

  Read the article

• Should I create a unique clustered index, or non-unique clustered index on this SQL 2005 table?

  - by Bremer

  I have a table storing millions of rows. It looks something like this: Table_Docs ID, Bigint (Identity col) OutputFileID, int Sequence, int …(many other fields) We find ourselves in a situation where the developer who designed it made the OutputFileID the clustered index. It is not unique. There can be thousands of records with this ID. It has no benefit to any processes using this table, so we plan to remove it. The question, is what to change it to… I have two candidates, the ID identity column is a natural choice. However, we have a process which does a lot of update commands on this table, and it uses the Sequence to do so. The Sequence is non-unique. Most records only contain one, but about 20% can have two or more records with the same Sequence. The INSERT app is a VB6 piece of crud throwing thousands insert commands at the table. The Inserted values are never in any particular order. So the Sequence of one insert may be 12345, and the next could be 12245. I know that this could cause SQL to move a lot of data to keep the clustered index in order. However, the Sequence of the inserts are generally close to being in order. All inserts would take place at the end of the clustered table. Eg: I have 5 million records with Sequence spanning 1 to 5 million. The INSERT app will be inserting sequence’s at the end of that range at any given time. Reordering of the data should be minimal (tens of thousands of records at most). Now, the UPDATE app is our .NET star. It does all UPDATES on the Sequence column. “Update Table_Docs Set Feild1=This, Field2=That…WHERE Sequence =12345” – hundreds of thousands of these a day. The UPDATES are completely and totally, random, touching all points of the table. All other processes are simply doing SELECT’s on this (Web pages). Regular indexes cover those. So my question is, what’s better….a unique clustered index on the ID column, benefiting the INSERT app, or a non-unique clustered index on the Sequence, benefiting the UPDATE app?

  Read the article

• run shell command from java

  - by Aykut

  Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

  Read the article

• Having trouble wrapping functions in the linux kernel

  - by Corey Henderson

  I've written a LKM that implements Trusted Path Execution (TPE) into your kernel: https://github.com/cormander/tpe-lkm I run into an occasional kernel OOPS (describe at the end of this question) when I define WRAP_SYSCALLS to 1, and am at my wit's end trying to track it down. A little background: Since the LSM framework doesn't export its symbols, I had to get creative with how I insert the TPE checking into the running kernel. I wrote a find_symbol_address() function that gives me the address of any function I need, and it works very well. I can call functions like this: int (*my_printk)(const char *fmt, ...); my_printk = find_symbol_address("printk"); (*my_printk)("Hello, world!\n"); And it works fine. I use this method to locate the security_file_mmap, security_file_mprotect, and security_bprm_check functions. I then overwrite those functions with an asm jump to my function to do the TPE check. The problem is, the currently loaded LSM will no longer execute the code for it's hook to that function, because it's been totally hijacked. Here is an example of what I do: int tpe_security_bprm_check(struct linux_binprm *bprm) { int ret = 0; if (bprm->file) { ret = tpe_allow_file(bprm->file); if (IS_ERR(ret)) goto out; } #if WRAP_SYSCALLS stop_my_code(&cs_security_bprm_check); ret = cs_security_bprm_check.ptr(bprm); start_my_code(&cs_security_bprm_check); #endif out: return ret; } Notice the section between the #if WRAP_SYSCALLS section (it's defined as 0 by default). If set to 1, the LSM's hook is called because I write the original code back over the asm jump and call that function, but I run into an occasional kernel OOPS with an "invalid opcode": invalid opcode: 0000 [#1] SMP RIP: 0010:[<ffffffff8117b006>] [<ffffffff8117b006>] security_bprm_check+0x6/0x310 I don't know what the issue is. I've tried several different types of locking methods (see the inside of start/stop_my_code for details) to no avail. To trigger the kernel OOPS, write a simple bash while loop that endlessly starts a backgrounded "ls" command. After a minute or so, it'll happen. I'm testing this on a RHEL6 kernel, also works on Ubuntu 10.04 LTS (2.6.32 x86_64). While this method has been the most successful so far, I have tried another method of simply copying the kernel function to a pointer I created with kmalloc but when I try to execute it, I get: kernel tried to execute NX-protected page - exploit attempt? (uid: 0). If anyone can tell me how to kmalloc space and have it marked as executable, that would also help me solve the above problem. Any help is appreciated!

  Read the article

• How can a C/C++ program put itself into background?

  - by Larry Gritz

  What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

  Read the article

• StaX: Content not allowed in prolog

  - by RalfB

  I have the following (test) XML file below and Java code that uses StaX. I want to apply this code to a file that is about 30 GB large but with fairly small elements, so I thought StaX is a good choice. I am getting the following error: Exception in thread "main" javax.xml.stream.XMLStreamException: ParseError at [row,col]:[1,1] Message: Content is not allowed in prolog at com.sun.org.apache.xerces.internal.impl.XMLStreamReaderImpl.next(XMLStreamReaderImpl.java:598) at at.tuwien.mucke.util.xml.staxtest.StaXTest.main(StaXTest.java:18) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) at com.intellij.rt.execution.application.AppMain.main(AppMain.java:120) <?xml version='1.0' encoding='utf-8'?> <catalog> <book id="bk101"> <author>Gambardella, Matthew</author> <title>XML Developer's Guide</title> <price>44.95</price> <description>An in-depth look at creating applications with XML.</description> </book> <book id="bk102"> <author>Ralls, Kim</author> <title>Midnight Rain</title> <price>5.95</price> <description>A former architect battles corporate zombies, an evil sorceress, and her own childhood to become queen of the world.</description> </book> </catalog> Here the code: package xml.staxtest; import java.io.*; import javax.xml.stream.*; public class StaXTest { public static void main(String[] args) throws Exception { XMLInputFactory xif = XMLInputFactory.newInstance(); XMLStreamReader streamReader = xif.createXMLStreamReader(new FileReader("D:/Data/testFile.xml")); while(streamReader.hasNext()){ int eventType = streamReader.next(); if(eventType == XMLStreamReader.START_ELEMENT){ System.out.println(streamReader.getLocalName()); } //... more to come here later ... } } }

  Read the article

• php connecting to mysql server(localhost) very slow

  - by Ahmad

  actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

  Read the article

• When transactionManager is not named "transactionManager" ...

  - by smallufo

  I am trying Spring 3(.0.2.RELEASE) and JPA2 and Hibernate 3.5.1-Final... One thing upsets me is that spring seems only accept a transaction Manager named "transactionManager" If I don't name it "transactionManager" , Spring will throws NoSuchBeanDefinitionException: No bean named 'transactionManager' is defined. Here is my config : <context:component-scan base-package="destiny.data.mining"/> <context:annotation-config/> <bean id="miningEntityManagerFactory" class="org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean"> <property name="persistenceUnitName" value="mining"/> </bean> <bean id="miningTransactionManager" class="org.springframework.orm.jpa.JpaTransactionManager" > <property name="entityManagerFactory" ref="miningEntityManagerFactory"/> </bean> <tx:advice id="txAdviceMining" transaction-manager="miningTransactionManager"> <tx:attributes> <tx:method name="get*" read-only="true"/> <tx:method name="save*" propagation="REQUIRED"/> <tx:method name="update*" propagation="REQUIRED"/> <tx:method name="delete*" propagation="REQUIRED"/> <tx:method name="*" propagation="SUPPORTS" read-only="true"/> </tx:attributes> </tx:advice> <aop:config> <aop:pointcut id="methods" expression="execution(* destiny.utils.AbstractDao+.*(..))"/> <aop:advisor advice-ref="txAdviceMining" pointcut-ref="methods"/> </aop:config> <tx:annotation-driven transaction-manager="miningTransactionManager"/> In this config , an Entity Manager Factory is not necessarily named "entityManagerFactory" , and "txAdvice" is not necessarily named "txAdvice" , either. But I don't know why on earth Spring requires a transaction manager named "transactionManager" ? Is there any way not to name a transaction manager "transactionManager" ? (I'm running multiple spring config files , so I try my best to avoid name-conflicting) test code : @RunWith(SpringJUnit4ClassRunner.class) @ContextConfiguration(locations={"classpath:mining.xml"}) public class MiningPersonDaoTest { @Inject private EntityManagerFactory miningEntityManagerFactory; @Inject private MiningPersonDao miningPersonDao; @Transactional @Test public void testUpdate() { MiningPerson p = miningPersonDao.get(42L); p.setLocationName("OOXX"); miningPersonDao.update(p); System.out.println(p); } } ii

  Read the article

• PHP MySQL Zend-ACL - Find all inherited items (Children / Parents)

  - by Scoobler

  I have one MySQL DB table like the following, the resources table: id | name | type 1 | guest | user 2 | member | user 3 | moderator | user 4 | owner | user 5 | admin | user 6 | index | controller Onto the next table, the rules table: id | user_id | rule | resource_id | extras 1 | 2 | 3 | 1 | null 2 | 3 | 3 | 2 | null 3 | 4 | 3 | 3 | null 4 | 5 | 3 | 4 | null 5 | 6 | 1 | 1 | index,login,register 6 | 6 | 2 | 2 | login,register 7 | 6 | 1 | 2 | logout OK, sorry for the length, but I am trying to give a full picture of what I am trying to do. So the way it works, a role (aka user) can be granted (rule: 1) access to a controller, a role can inherit (rule: 3) access from another role or a role and be denied (rule: 2) access to a controller. (A user is a resource and a controller is a resource) Access to actions are granted / denied using the extras column. This all works, its not a problem with setting up the ACL within zend. What I am now trying to do is show the relationships; to do that I need to find the lowest level a role is granted access to a controller stopping if it has explicitly been removed. I plan on listing the roles. When I click a role, I want it to show all the controllers that role has access to. Then clicking on a controller shows the actions the role is allowed to do. So in the example above, a guest is allowed to view the index action of the index controller along with the login action. A member inherits the same access, but is then denied access to the login action and register action. A moderator inherits the rules of a member. So if I were to select the role moderator. I want to see the controller index listed. If I click on the controller, it should show the allowed actions as being action: index. (which was originally granted to the guest, but hasn't since been dissallowed) Is there any examples to doing this. I am obviously working with the Zend MVC (PHP) and MySQL. Even just a persudo code example would be a helpful starting point - this is one of the last parts of the jigsaw I am putting together. P.S. Obviously I have the ACL object - is it going to be easier to interigate that or is it better to do it my self via PHP/MySQL? The aim will be, show what a role can access which will then allow me to add or edit a role, controller and action in a GUI style (that is somewhat the easy bit) - currently I am updating the DB manually as I have been building the site.

  Read the article

• Poor performance / speed of regex with lookahead

  - by Hugo Zaragoza

  I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

  Read the article

• Can MySQL reasonably perform queries on billions of rows?

  - by haxney

  I am planning on storing scans from a mass spectrometer in a MySQL database and would like to know whether storing and analyzing this amount of data is remotely feasible. I know performance varies wildly depending on the environment, but I'm looking for the rough order of magnitude: will queries take 5 days or 5 milliseconds? Input format Each input file contains a single run of the spectrometer; each run is comprised of a set of scans, and each scan has an ordered array of datapoints. There is a bit of metadata, but the majority of the file is comprised of arrays 32- or 64-bit ints or floats. Host system |----------------+-------------------------------| | OS | Windows 2008 64-bit | | MySQL version | 5.5.24 (x86_64) | | CPU | 2x Xeon E5420 (8 cores total) | | RAM | 8GB | | SSD filesystem | 500 GiB | | HDD RAID | 12 TiB | |----------------+-------------------------------| There are some other services running on the server using negligible processor time. File statistics |------------------+--------------| | number of files | ~16,000 | | total size | 1.3 TiB | | min size | 0 bytes | | max size | 12 GiB | | mean | 800 MiB | | median | 500 MiB | | total datapoints | ~200 billion | |------------------+--------------| The total number of datapoints is a very rough estimate. Proposed schema I'm planning on doing things "right" (i.e. normalizing the data like crazy) and so would have a runs table, a spectra table with a foreign key to runs, and a datapoints table with a foreign key to spectra. The 200 Billion datapoint question I am going to be analyzing across multiple spectra and possibly even multiple runs, resulting in queries which could touch millions of rows. Assuming I index everything properly (which is a topic for another question) and am not trying to shuffle hundreds of MiB across the network, is it remotely plausible for MySQL to handle this? UPDATE: additional info The scan data will be coming from files in the XML-based mzML format. The meat of this format is in the <binaryDataArrayList> elements where the data is stored. Each scan produces = 2 <binaryDataArray> elements which, taken together, form a 2-dimensional (or more) array of the form [[123.456, 234.567, ...], ...]. These data are write-once, so update performance and transaction safety are not concerns. My naïve plan for a database schema is: runs table | column name | type | |-------------+-------------| | id | PRIMARY KEY | | start_time | TIMESTAMP | | name | VARCHAR | |-------------+-------------| spectra table | column name | type | |----------------+-------------| | id | PRIMARY KEY | | name | VARCHAR | | index | INT | | spectrum_type | INT | | representation | INT | | run_id | FOREIGN KEY | |----------------+-------------| datapoints table | column name | type | |-------------+-------------| | id | PRIMARY KEY | | spectrum_id | FOREIGN KEY | | mz | DOUBLE | | num_counts | DOUBLE | | index | INT | |-------------+-------------| Is this reasonable?

  Read the article

• Why does the Ternary\Conditional operator seem significantly faster

  - by Jodrell

  Following on from this question, which I have partially answered. I compile this console app in x64 Release Mode, with optimizations on, and run it from the command line without a debugger attached. using System; using System.Diagnostics; class Program { static void Main() { var stopwatch = new Stopwatch(); var ternary = Looper(10, Ternary); var normal = Looper(10, Normal); if (ternary != normal) { throw new Exception(); } stopwatch.Start(); ternary = Looper(10000000, Ternary); stopWatch.Stop(); Console.WriteLine( "Ternary took {0}ms", stopwatch.ElapsedMilliseconds); stopwatch.Start(); normal = Looper(10000000, Normal); stopWatch.Stop(); Console.WriteLine( "Normal took {0}ms", stopwatch.ElapsedMilliseconds); if (ternary != normal) { throw new Exception(); } Console.ReadKey(); } static int Looper(int iterations, Func<bool, int, int> operation) { var result = 0; for (int i = 0; i < iterations; i++) { var condition = result % 11 == 4; var value = ((i * 11) / 3) % 5; result = operation(condition, value); } return result; } static int Ternary(bool condition, in value) { return value + (condition ? 2 : 1); } static int Normal(int iterations) { if (condition) { return = 2 + value; } return = 1 + value; } } I don't get any exceptions and the output to the console is somthing close to, Ternary took 107ms Normal took 230ms When I break down the CIL for the two logical functions I get this, ... Ternary ... { : ldarg.1 // push second arg : ldarg.0 // push first arg : brtrue.s T // if first arg is true jump to T : ldc.i4.1 // push int32(1) : br.s F // jump to F T: ldc.i4.2 // push int32(2) F: add // add either 1 or 2 to second arg : ret // return result } ... Normal ... { : ldarg.0 // push first arg : brfalse.s F // if first arg is false jump to F : ldc.i4.2 // push int32(2) : ldarg.1 // push second arg : add // add second arg to 2 : ret // return result F: ldc.i4.1 // push int32(1) : ldarg.1 // push second arg : add // add second arg to 1 : ret // return result } Whilst the Ternary CIL is a little shorter, it seems to me that the execution path through the CIL for either function takes 3 loads and 1 or 2 jumps and a return. Why does the Ternary function appear to be twice as fast. I underdtand that, in practice, they are both very quick and indeed, quich enough but, I would like to understand the discrepancy.

  Read the article

• Android browser touch events stop display being updated inc. canvas/elements - How to work around?

  - by Ed Kirk

  On some android's native browser touching the page seems to stop the display from being updated until the finger is released. This occurs for both html element based animation (switching classes) and for canvas based animation. It does not however stop normal js execution and other events are fired as normal. On devices with this problem the dolphin browser also seems effected (not firefox though). Touchstart/move both have preventDefault() fired as well as stopPropergation(), cancelBubble = true; and e.returnValue = false;. In the CSS webkit selection has also been disabled. The page will not scroll. A similar question has been asked here: Does Android browser lock DOM on touchStart? but I'd like to find out if this behaviour can be overcome, or at least to discover what devices will be effected by the problem, is it a device or version android issue? If you cannot answer the question running the demo and reporting your experience along with your device model and useragent (displayed at bottom of demo page) as a comment might help others or myself answer the question. Here is a demo and steps to reproduce the behaviour. A QR code for the link can be found here https://s3-eu-west-1.amazonaws.com/canvas-test-pd/tmp.png. https://s3-eu-west-1.amazonaws.com/canvas-test-pd/index.html The web page has a canvas at the top and a div with a background image at the bottom. Every second the canvas is cleared and a different image displayed and the div has it's class switched (both toggle between 0 and 1 pngs). Once this has toggled a few times place your finger on the canvas (the top grey box) and hold it there. Wait to see if the animation continues (sometimes it will once or twice then stops) and if there are any visual distortions. Update It seems that the Galaxy Tab running 3.2 requires handlers for touchstart/end of document, not just required divs for the screen to continue updating the display. Thanks jimpic. I'm starting to believe it's an issue caused by manufacturers skins, although this is difficult to prove.

  Read the article

• How to fix this Speech Recognition wicked bug?

  - by aF

  I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? NOTE: this project has some code that is allways being executed. Might that be the problem? Because the other code is running it doesn't allow it to this to run?

  Read the article

• Multi domain rails app. How to intelligently use MVC?

  - by denial

  Background: We have app a, b, and plan to add more apps into this same application. The apps are similar enough they could share many views, assets, and actions. Currently a,b live in a single rails app(2.3.10). c will be similar enough that it could also be in this rails app. The problem: As we continue to add more apps to this one app, there's going to be too much case logic that the app will soon become a nightmare to maintain. There will also be potential namespace issues. However, the apps are very similar in function and layout, it also makes sense to keep them in one app so that it's one app to maintain(since roughly 50% of site look/functionality will be shared). What we are trying to do is keep this as clean as possible so it's easy for multiple teams to work on and easy to maintain. Some things we've thought about/are trying: Engines. Make each app an engine. This would let us base routes on the domain. It also allows us to pull out controllers, models and views for the specific app. This solution does not seem ideal as we won't be reusing the apps any time soon. And explicitly stating the host in the routes doesn't seem right. Skinning/themes. The auth logic would be different between the apps. Each user model would be different. So it's not just a skinning problem. In app/view add folder sitea for sitea views, siteb for siteb views and so on. Do the same for controllers and models. This is still pretty messy and since it didn't follow naming conventions, it did not work with rails so nicely and made much of the code messier. Making another rails app. We just didn't want to maintain the same controller or view in 2 apps if they are identical. What we want to do is make the app intelligently use a controller based on the host. So there would be a sessions controller for each app, and perhaps some parent session controller for shared logic(not needed now). In each of these session controllers, it handles authentication for that specific app. So if the domain is a.mysite.com, it would use session controller for app a and know to use app a's views,models,controllers. And if the domain is b.mysite, it would use the session controller for b. And there would be a user model for a and user model for b, which also would be determined by the domain. Does anyone have any suggestions or experience with this situation? And ideally using rails 2.3.x as updating to rails 3 isn't an option right now.

  Read the article

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >