Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 283/336 | < Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Not all symbols of an DLL-exported class is exported (VS9)

    - by mandrake
    I'm building a DLL from a group of static libraries and I'm having a problem where only parts of classes are exported. What I'm doing is declaring all symbols I want to export with a preprocessor definition like: #if defined(MYPROJ_BUILD_DLL) //Build as a DLL # define MY_API __declspec(dllexport) #elif defined(MYPROJ_USE_DLL) //Use as a DLL # define MY_API __declspec(dllimport) #else //Build or use as a static lib # define MY_API #endif For example: class MY_API Foo{ ... } I then build static library with MYPROJ_BUILD_DLL & MYPROJ_USE_DLL undefined causing a static library to be built. In another build I create a DLL from these static libraries. So I define MYPROJ_BUILD_DLL causing all symbols I want to export to be attributed with __declspec(dllexport) (this is done by including all static library headers in the DLL-project source file). Ok, so now to the problem. When I use this new DLL I get unresolved externals because not all symbols of a class is exported. For example in a class like this: class MY_API Foo{ public: Foo(char const* ); int bar(); private: Foo( char const*, char const* ); }; Only Foo::Foo( char const*, char const*); and int Foo::bar(); is exported. How can that be? I can understand if the entire class was missing, due to e.g. I forgot to include the header in the DLL-build. But it's only partial missing. Also, say if Foo::Foo( char const*) was not implemented; then the DLL build would have unresolved external errors. But the build is fine (I also double checked for declarations without implementation). Note: The combined size of the static libraries I'm combining is in the region of 30MB, and the resulting DLL is 1.2MB. I'm using Visual Studio 9.0 (2008) to build everything. And Depends to check for exported symbols.

    Read the article

  • C#: Need one of my classes to trigger an event in another class to update a text box

    - by Matt
    Total n00b to C# and events although I have been programming for a while. I have a class containing a text box. This class creates an instance of a communication manager class that is receiving frames from the Serial Port. I have this all working fine. Every time a frame is received and its data extracted, I want a method to run in my class with the text box in order to append this frame data to the text box. So, without posting all of my code I have my form class... public partial class Form1 : Form { CommManager comm; public Form1() { InitializeComponent(); comm = new CommManager(); } private void updateTextBox() { //get new values and update textbox } . . . and I have my CommManager class class CommManager { //here we manage the comms, recieve the data and parse the frame } SO... essentially, when I parse that frame, I need the updateTextBox method from the form class to run. I'm guessing this is possible with events but I can't seem to get it to work. I tried adding an event handler in the form class after creating the instance of CommManager as below... comm = new CommManager(); comm.framePopulated += new EventHandler(updateTextBox); ...but I must be doing this wrong as the compiler doesn't like it... Any ideas?!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Adding text read from a file to an array list in java

    - by user1824856
    I am having trouble putting text read from a file into an array list. My text looks like this: 438;MIA;JFK;10:55;1092;447 638;JFK;MIA;19:45;1092;447 689;ATL;DFW;12:50;732;448 etc... My code looks like this: package filesexample; import java.io.*; import java.io.FileNotFoundException; import java.util.Scanner; import java.util.ArrayList; /** * * @author */ public class FilesExample { /** * @param args the command line arguments */ public static void main(String[] args) throws IOException { File file = new File ("/Schedule.txt"); try { Scanner scanner= new Scanner(file);; while (scanner.hasNextLine()) { String line = scanner.nextLine(); Scanner lineScanner= new Scanner(line); lineScanner.useDelimiter(";"); while(lineScanner.hasNext()){ String part = lineScanner.next(); System.out.print(part + " "); } System.out.println(); } }catch (FileNotFoundException e){ e.printStackTrace(); } } } Some help on getting started would be much appreciated thank you!

    Read the article

  • Howw to add new value with generic Repository if there are foreign keys (EF-4)?

    - by Phsika
    i try to write a kind of generic repository to add method. Everything is ok to add but I have table which is related with two tables with FOREIGN KEY.But Not working because of foreign key public class DomainRepository<TModel> : IDomainRepository<TModel> where TModel : class { #region IDomainRepository<T> Members private ObjectContext _context; private IObjectSet<TModel> _objectSet; public DomainRepository() { } public DomainRepository(ObjectContext context) { _context = context; _objectSet = _context.CreateObjectSet<TModel>(); } //do something..... public TModel Add<TModel>(TModel entity) where TModel : IEntityWithKey { EntityKey key; object originalItem; key = _context.CreateEntityKey(entity.GetType().Name, entity); _context.AddObject(key.EntitySetName, entity); _context.SaveChanges(); return entity; } //do something..... } Calling REPOSITORY: //insert-update-delete public partial class AddtoTables { public table3 Add(int TaskId, int RefAircraftsId) { using (DomainRepository<table3> repTask = new DomainRepository<table3>(new TaskEntities())) { return repTask.Add<table3>(new table3() { TaskId = TaskId, TaskRefAircraftsID = RefAircraftsId }); } } } How to add a new value if this table includes foreign key relation

    Read the article

  • Symbols (pdb) for native dll are not loaded due to post build step

    - by sean e
    I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

    Read the article

  • Get Multiple Values From Database ASP.NET/C#

    - by user1043177
    I am trying to get/return multiple values from an SQL-Server database using and display them on an ASP.NET page. I am using a stored procedure to perform the SELECT command on the Database side. I am able to return the first value that matches the variable @PERSON but only one row is returned each time. Any help would be much appreciated. Database handler class public MainSQL() { _productConn = new SqlConnection(); _productConnectionString += "data source=mssql.database.co.uk;InitialCatalog=test_data;User ID=username;Password=password"; _productConn.ConnectionString = _productConnectionString; } public string GetItemName(int PersonID) { string returnvalue = string.Empty; SqlCommand myCommand = new SqlCommand("GetItem", _productConn); myCommand.CommandType = CommandType.StoredProcedure; myCommand.Parameters.Add(new SqlParameter("@PERSON", SqlDbType.Int)); myCommand.Parameters[0].Value = PersonID; _productConn.Open(); returnvalue = (string)myCommand.ExecuteScalar(); _productConn.Close(); return (string)returnvalue; } Stored Procedure USE [test_data] GO SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO ALTER PROCEDURE [ppir].[GetItem] ( @PERSON int ) AS /*SET NOCOUNT ON;*/ SELECT Description FROM [Items] WHERE PersonID = @PERSON RETURN return.aspx namespace test { public partial class Final_Page : System.Web.UI.Page { MainSQL GetInfo; protected void Page_Load(object sender, EventArgs e) { int PersonId = (int)Session["PersonID"]; GetInfo = new MainSQL(); string itemname = GetInfo.GetItemName(PersonId); ReturnItemName.Text = itemname; } // End Page_Load } // End Class } // End Namespace

    Read the article

  • Sharing rails fragments between formats

    - by Julian
    Hi I'm toying with mobile_fu and want to share some fragments between the different views. E.g. views/ item/ view.html.erb view.mobile.rb shared/ _common.erb In both view.html.erb and view.mobile.erb I want to share the same fragment '_common.erb' without having to specify the format (should you ever have to specify the format inside a fragment? It doesn't seem like The Rails Way?). Let's say for arguments's sake it's because it's in a helper or whatever -- the point is that I need to share fragments in a 'well-defined and Railsy way' across formats. Let's take this fairly innocuous snippet <% render :fragment => 'shared/common' %> I've tried 3 file name conventions: _common.html.erb only works for html /item/view/xx fails with 'shared/_common.erb not found') however _common.erb fails for html and works for mobile (maybe mobile_fu is doing something wacky?) -- same error as for .html.erb version above _common.rhtml does work for both I'm thinking that: that rhtml works for both is a legacy hack and I'm loathe to rename all the shared fragments .rhtml to get the behaviour I want. Any feedback gratefully welcome! Including 'you fundamentally don't understand how Rails works please RTFM here: http://....' :)

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Problem with incomplete input when using Attoparsec

    - by Dan Dyer
    I am converting some functioning Haskell code that uses Parsec to instead use Attoparsec in the hope of getting better performance. I have made the changes and everything compiles but my parser does not work correctly. I am parsing a file that consists of various record types, one per line. Each of my individual functions for parsing a record or comment works correctly but when I try to write a function to compile a sequence of records the parser always returns a partial result because it is expecting more input. These are the two main variations that I've tried. Both have the same problem. items :: Parser [Item] items = sepBy (comment <|> recordType1 <|> recordType2) endOfLine For this second one I changed the record/comment parsers to consume the end-of-line characters. items :: Parser [Item] items = manyTill (comment <|> recordType1 <|> recordType2) endOfInput Is there anything wrong with my approach? Is there some other way to achieve what I am attempting?

    Read the article

  • Ruby on Rails - pass variable to nested form

    - by Krule
    I am trying to build a multilingual site using Rails, but I can't figure out how to pass variable to nested form. Right now I am creating nested form like this. @languages.each do @article.article_locale.build(:language_id => language.id) end But i would like to pass value of language to it so i can distinguish fields. Something like this. @languages.each do |language| @language = language @article.article_locale.build(:language_id => language.id) end However, I always end up with language of the last loop iteration. Any way to pass this variable? -- edit -- In the end, since I've got no answer I have solved this problem so it, at least, works as it should. Following code is my partial solution. In model: def self.languages Language.all end def self.language_name language = [] self.languages.each_with_index do |lang, i| language[i] = lang.longname end return language end In Controller: def new @article = Article.new Article.languages.each do |language| @article.article_locale.build(:language_id => language.id) end end In HAML View: -count = 0 -f.fields_for :article_locale do |al| %h3= Article.language_name[count] -count+=1 -field_set_tag do %p =al.label :name, t(:name) =al.text_field :name %p =al.label :description, t(:description) =al.text_area :description =al.hidden_field :language_id It's not the most elegant solution I suppose, but it works. I would really love if I could get rid of counter in view for instance.

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • How to throw meaningful data in exceptions ?

    - by ZeroCool
    I would like to throw exceptions with meaningful explanation ! I thought of using variable arguments worked fine but lately I figured out it's impossible to extend the class in order to implement other exception types. So I figured out using an std::ostreamstring as a an internal buffer to deal with formatting ... but doesn't compile! I guess it has something to deal with copy constructors. Anyhow here is my piece of code: class Exception: public std::exception { public: Exception(const char *fmt, ...); Exception(const char *fname, const char *funcname, int line, const char *fmt, ...); //std::ostringstream &Get() { return os_ ; } ~Exception() throw(); virtual const char *what() const throw(); protected: char err_msg_[ERRBUFSIZ]; //std::ostringstream os_; }; The variable argumens constructor can't be inherited from! this is why I thought of std::ostringstream! Any advice on how to implement such approach ?

    Read the article

  • ForEach loop in Mathematica.

    - by dreeves
    I'd like something like this: ForEach[i_, {1,2,3}, Print[i] ] Or, more generally, to destructure arbitrary stuff in the list you're looping over, like: ForEach[{i_, j_}, {{1,10}, {2,20}, {3,30}}, Print[i*j] ] (Meta-question: is that a good way to call a ForEach loop, with the first argument a pattern like that?) ADDED: Some answerers have rightly pointed out that usually you want to use Map or other purely functional constructs and eschew a non-functional programming style where you use side effects. I agree! But here's an example where I think this ForEach construct is supremely useful: Say I have a list of options (rules) that pair symbols with expressions, like attrVals = {a -> 7, b -> 8, c -> 9} Now I want to make a hash table where I do the obvious mapping of those symbols to those numbers. I don't think there's a cleaner way to do that than ForEach[a_ -> v_, attrVals, h[a] = v] ADDED: I just realized that to do ForEach properly, it should support Break[] and Continue[]. I'm not sure how to implement that. Perhaps it will need to somehow be implemented in terms of For, While, or Do since those are the only loop constructs that support Break[] and Continue[]. If anyone interested in this wants to ask about that as a separate question, please do!

    Read the article

  • Troubleshooting multiple GET variables In PHP

    - by V413HAV
    This may be a very simple question but I don't what's the wrong thing am doing here... To explain you clearly, I've set a real simple example below: <ul> <li><a href="test.php?link1=true">Link 1</a></li> <li><a href="test.php?link2=true">Link 2</a></li> <li><a href="test.php?link3=true">Link 3</a></li> </ul> <?php if(isset($_GET['link1'])) { if(($_GET['link1']) == 'true') { echo 'This Is Link 1'; } } if(isset($_GET['link2'])) { if(($_GET['link2']) == 'true') { echo 'This Is Link 2'; } } if(isset($_GET['link3'])) { if(($_GET['link3']) == 'true') { echo 'This Is Link 3'; } } ?> This is a test.php page, here I've set 3 different arguments for $_GET, and show contents accordingly, now everything works perfect, the only thing am not understanding is how to block this kind of url say if user clicks on link 1 the url will be : http://localhost/test.php?link1=true And the Output of this url is This is Link 1 Now if I change this url to : http://localhost/test.php?link3=true&link2=true&link1=true And the Output what I get is This Is Link 1This Is Link 2This Is Link 3 Now this is ok here, but it's very annoying if someone types this and see's forms one below the other, any way I can stop this tampering?

    Read the article

  • Problems with binding to Window Height and Width

    - by D.H.
    I have some problems when I try to bind the height and width of a window to properties in my view model. Here is a small sample app to illustrate the problem. This is the code in app.xaml.xs public partial class App : Application { protected override void OnStartup(StartupEventArgs e) { base.OnStartup(e); MainWindow mainWindow = new MainWindow(); MainWindowViewModel mainWindowViewModel = new MainWindowViewModel(); mainWindow.DataContext = mainWindowViewModel; mainWindow.Show(); } } This is MainWindow.xaml: <Window x:Class="TestApp.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Height="{Binding WindowHeight}" Width="{Binding WindowWidth}" BorderThickness="{Binding WindowBorderThickness}"> </Window> And this is the view model: public class MainWindowViewModel { public int WindowWidth { get { return 100; } } public int WindowHeight { get { return 200; } } public int WindowBorderThickness { get { return 8; } } } When the program is started the getters of WindowHeight and WindowBorderThickness (but not WindowWidth) are called, so the height and the border of the window is set properly, but not the width. I then add button that will trigger PropertyChanged for all properties, so that the view model now looks like this: public class MainWindowViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public void TriggerPropertyChanges() { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs("WindowWidth")); PropertyChanged(this, new PropertyChangedEventArgs("WindowHeight")); PropertyChanged(this, new PropertyChangedEventArgs("WindowBorderThickness")); } } public ICommand ButtonCommand { get { return new RelayCommand(delegate { TriggerPropertyChanges(); }); } } public int WindowWidth { get { return 100; } } public int WindowHeight { get { return 200; } } public int WindowBorderThickness { get { return 8; } } } Now, when I click the button, the getter of WindowBorderThickness is called, but not the ones for WindowWidth and WindowHeight. It all just seems very weird and inconsistent to me. What am I missing?

    Read the article

  • What can cause a spontaneous EPIPE error without either end calling close() or crashing?

    - by Hongli
    I have an application that consists of two processes (let's call them A and B), connected to each other through Unix domain sockets. Most of the time it works fine, but some users report the following behavior: A sends a request to B. This works. A now starts reading the reply from B. B sends a reply to A. The corresponding write() call returns an EPIPE error, and as a result B close() the socket. However, A did not close() the socket, nor did it crash. A's read() call returns 0, indicating end-of-file. A thinks that B prematurely closed the connection. Users have also reported variations of this behavior, e.g.: A sends a request to B. This works partially, but before the entire request is sent A's write() call returns EPIPE, and as a result A close() the socket. However B did not close() the socket, nor did it crash. B reads a partial request and then suddenly gets an EOF. The problem is I cannot reproduce this behavior locally at all. I've tried OS X and Linux. The users are on a variety of systems, mostly OS X and Linux. Things that I've already tried and considered: Double close() bugs (close() is called twice on the same file descriptor): probably not as that would result in EBADF errors, but I haven't seen them. Increasing the maximum file descriptor limit. One user reported that this worked for him, the rest reported that it did not. What else can possibly cause behavior like this? I know for certain that neither A nor B close() the socket prematurely, and I know for certain that neither of them have crashed because both A and B were able to report the error. It is as if the kernel suddenly decided to pull the plug from the socket for some reason.

    Read the article

  • what is the best practice approach for n-tier application development with entity framework?

    - by samsur
    I am building an application using entity framework. I am using the T4 template to generate self tracking entities. Currently, I am thinking of creating the entity framework code in a separate project. In this same project, I would have partial classes with additional methods for the entities. I am thinking of creating a separate project for a service layer (WCF) with methods for the upper/presentation tier. The WCF layer will reference the entity framework project. The methods in the WCF layer will return the entities or accept the entities as the parameters. I am thinkg of creating a third project for the presentation layer (ASP.net), this will make calls to the WCF service but will also need to reference the entities as the WCF methods take these types as the parameters/return types. In short, i want to use the STE entities generated by the T4 template as a DTO to be used in all layers. I was originally thinking of creating a business logic layer that maps to each entities. Example: If i have a customer class, the Business Layer would have a CustomerBLL class and then methods in the customerBLL will be used by the service layer. I was also trying to create a DTO in this business layer. I however found that this approach is very time consuming and i do not see a major benefit as it would create more maintenance work. What is the best practice for n-tier application development using entity framework 4?

    Read the article

  • class modifier issues in C# with "private" classes

    - by devoured elysium
    I had a class that had lots of methods: public class MyClass { public bool checkConditions() { return checkCondition1() && checkCondition2() && checkCondition3(); } ...conditions methods public void DoProcess() { FirstPartOfProcess(); SecondPartOfProcess(); ThirdPartOfProcess(); } ...process methods } I identified two "vital" work areas, and decided to extract those methods to classes of its own: public class MyClass { private readonly MyClassConditions _conditions = new ...; private readonly MyClassProcessExecution = new ...; public bool checkConditions() { return _conditions.checkConditions(); } public void DoProcess() { _process.DoProcess(); } } In Java, I'd define MyClassConditions and MyClassProcessExecution as package protected, but I can't do that in C#. How would you go about doing this in C#? Setting both classes as inner classes of MyClass? I have 2 options: I either define them inside MyClass, having everything in the same file, which looks confusing and ugly, or I can define MyClass as a partial class, having one file for MyClass, other for MyClassConditions and other for MyClassProcessExecution. Defining them as internal? I don't really like that much of the internal modifier, as I don't find these classes add any value at all for the rest of my program/assembly, and I'd like to hide them if possible. It's not like they're gonna be useful/reusable in any other part of the program. Keep them as public? I can't see why, but I've let this option here. Any other? Name it! Thanks

    Read the article

  • Change Sequence to Choice

    - by Gordon
    In my Schema File I defined a Group with a Sequence of possible Elements. <group name="argumentGroup"> <sequence> <element name="foo" type="double" /> <element name="bar" type="string" /> <element name="baz" type="integer" /> </sequence> </group> I then reference this Group like this: <element name="arguments"> <complexType> <group ref="my:argumentGroup"/> </complexType> </element> Is it possible to reference the Group at some other point but restrict it so it's a Choice instead of a Sequence. The position where I want to reuse it would only allow one of the Elements within. <element name="argument" minOccurs="0" maxOccurs="1"> <complexType> <group name="my:argumentGroup"> <! -- Somehow change argumentGroup sequence to choice here --> </group> <complexType> </element>

    Read the article

  • How to get drag working properly in silverlight when mouse is not pressed ?

    - by Mrt
    Hello, I have the following code xaml <Canvas x:Name="LayoutRoot" > <Rectangle Canvas.Left="40" Canvas.Top="40" Width="20" Height="20" Name="rec" Fill="Red" MouseLeftButtonDown="rec_MouseLeftButtonDown" MouseMove="rec_MouseMove" /> </Canvas> code behind public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); } public Point LastDragPosition { get; set; } private bool isDragging; private void rec_MouseMove(object sender, MouseEventArgs e) { if(!isDragging) { return; } var position = e.GetPosition(rec as UIElement); var newPosition = new Point( Canvas.GetLeft(rec) + position.X - LastDragPosition.X, Canvas.GetTop(rec) + position.Y - LastDragPosition.Y); Canvas.SetLeft(rec, newPosition.X); Canvas.SetTop(rec, newPosition.Y); LastDragPosition = e.GetPosition(rec as UIElement); } private void rec_MouseLeftButtonDown(object sender, MouseButtonEventArgs e) { isDragging = true; LastDragPosition = e.GetPosition(sender as UIElement); rec.CaptureMouse(); } } This issue is the rectangle follows the mouse if the mouse left button is down, but I would like the rectangle to move even when the mouse left button isn't down. It works, but if you move the mouse very slowly. If you move the mouse to quickly the rectangle stops moving (is the mouse capture lost ?) Cheers,

    Read the article

  • How to detect the root recursive call?

    - by ahmadabdolkader
    Say we're writing a simple recursive function fib(n) that calculates the nth Fibonacci number. Now, we want the function to print that nth number. As the same function is being called repeatedly, there has to be a condition that allows only the root call to print. The question is: how to write this condition without passing any additional arguments, or using global/static variables. So, we're dealing with something like this: int fib(int n) { if(n <= 0) return 0; int fn = 1; if(n > 2) fn = fib(n-2) + fib(n-1); if(???) cout << fn << endl; return fn; } int main() { fib(5); return 0; } I thought that the root call differs from all children by returning to a different caller, namely the main method in this example. I wanted to know whether it is possible to use this property to write the condition and how. Update: please note that this is a contrived example that only serves to present the idea. This should be clear from the tags. I'm not looking for standard solutions. Thanks.

    Read the article

  • Can you do this with Hudson?

    - by damian
    I want to create a hudson job, that takes an id as a parameter. And use that id to calculate the svn-repo path. Where I work you have a svn path for every issue that you resolve. And then all the issues are joined into a single svn-path. What I want to do is to run static code analysis on the partial issues. So I think maybe having an Ant build.xml that I use for every issue, then, parametrize the job with the issue id. I have tried to achieve that but the svn path doesn't replace the parameter. I have tried with #issueId, %issueId%, ${issueId} and ${env.issueId} without success. Jump error like: Location 'http://svn-path:8181/svn/devSet/issues/${env.chuid}' does not exist Checking out a fresh workspace because C:\Documents and Settings\dnoseda\.hudson\jobs\test\workspace\${env.chuid} doesn't exist Checking out http://svn-path:8181/svn/devSet/issues/${env.chuid} ERROR: Failed to check out http://svn-path:8181/svn/devSet/issues/${env.chuid} org.tmatesoft.svn.core.SVNException: svn: '/svn/!svn/bc/46190/devSet/issues/$%7Benv.chuid%7D' path not found: 404 Not Found (http://svn-path:8181) at org.tmatesoft.svn.core.internal.wc.SVNErrorManager.error(SVNErrorManager.java:64) at org.tmatesoft.svn.core.internal.wc.SVNErrorManager.error(SVNErrorManager.java:51) at I am think that I can not do what I want. Do you know how I can setup the correct configuration to achieve this matter? Thanks for any help. Edit The section of the configurate job that I want to put this parameter is this: <scm class="hudson.scm.SubversionSCM"> <locations> <hudson.scm.SubversionSCM_-ModuleLocation> <remote>http://svn-path:8181/svn/devSet/issues/${env.issueid}</remote> </hudson.scm.SubversionSCM_-ModuleLocation> </locations>

    Read the article

  • Pass List of models to controller ASP.NET MVC 5

    - by user3697231
    I have a view where user can enter some data. But problem is this: Let's say you have 3 text box on view. Every time user can fill multiple times this 3 text boxes. To clarify, let's say user fills this 3 text boxes and press button which adds on form again these 3 text boxes. Now when user clicks submit this form is sent to controller, but how do I sent List of models as parameter. My architecture for this problem is something like this: MyModel public int ID { get;set; } public string Something { get; set; } /*This three textboxes can user set multiple times*/ /*Perhaps i Can create new model with these properties and then /*put List of that model as property here, but how to fill that list inside view ??*/ public string TextBoxOneValue { get; set; } public string TextBoxTwoValue { get; set; } public string TextBoxThreeValue { get; set; } Now, i was thinking that i Create PartialView with this 3 text boxes, and then when user clicks button on view another PartialView is loaded. And now, let's say I have Two partial views loaded, and user clicks submit, how that I pass list with values of these 3 text boxes to controller ??

    Read the article

< Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >