Search Results

Search found 22427 results on 898 pages for 'opn program'.

Page 285/898 | < Previous Page | 281 282 283 284 285 286 287 288 289 290 291 292  | Next Page >

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • How do you stop Eclipse from inserting a certain class in Content-Assist?

    - by fletchgqc.mp
    I'm using SpringSource Tool Suite (Eclipse) to program with Grails, and I'm also using JFreechart in the program. In Grails you log by typing log.info("method worked"). Unfortunately JFrechart has a class called "Log" with Static methods like "info". This means that in STS I type log.info and then when I type space or ( Eclipse "assists" me by importing the JFreechart Log class and changing what I've typed to Log.info(message). Very irritating. I reckon I could turn off the Eclipse option to "insert single proposals automatically", but I like this feature. Can I instruct Eclipse not to give me content assist from this particular JFreechart class?

    Read the article

  • Array Related Doubt.......

    - by AGeek
    I have the following program........... int insert(int *array, int arraySize, int newElement) { array[arraySize + 1] = newElement; return (arraySize+1); // Return new Array size...... } int main() { int array[] = {1,2,3,4,5}; int arraySize = sizeof(array) / sizeof(int); insertInArray(array, arraySize,6); print(array); } I am trying to work out this program in C programming language... But when i print the array after insertion,,, it doesn't prints the desired output which is needed.. Please correct me if i am doing something wrong..... Thanks..

    Read the article

  • Parent/Child forms communication issue

    - by user361583
    Hi, I am very new to Visual C++ programming, but I have to write simple program which needs to do two things: ( I am using MS Visual C++ ) main ( parent ) form should be displayed when program starts, and after clicking a button on it, second form should be shown. Second form ( child ) also has a button, but this one should ( after clicking, of course ) show current X,Y child form position but on ( important ): parent form. And this is where i got stuck. I can display child form with: a) adding #include "child.h" in parent form.h b) adding child ^child_form; in public: section and afterwards using: child_form = gcnew child(); child_form-Show(); I was googling for two days now and cannot find a way to get it the other way: click on a button on child_form and display it's coordinates on parent form on label-text :/ when i tried to add #include "child.h" in child_form I just got error saying: "there are to many include files..." I really need to get this done and I would really appreciate any suggestions. Thanks in advance :)

    Read the article

  • New to VS.net (VB.net) 2008. Windows 7 aero glass stuff.

    - by StealthRT
    Hey all, i have been using VB.net 2008 for a few months and i have a question. I compiled my program and ran it in a VM running windows 7. However, the progress bar looks like it does in XP. It doesn't have that cool look to it like I've seen in many other programs running in windows 7. I have downloaded the 3.5 .net framework with sp1 and also the sdk for windows 7 (1.4+ gb dvd) but i still see nothing. Is there a check-box i am missing in VS 2008 to enable these types of features? Maybe some type of code i need to place in the program? Thanks! David

    Read the article

  • SQL Database application written in Visual Basic in Visual Studio 2010

    - by TID
    Hello, I am writing a program and part of it is to store the keyed entry in a database on an sql server when the enter key is hit. The database is small and simple with only three entry spots in the table. one for the tracking number, one for the date entered, and one for the time entered. The only thing the user will see is the tracking number text box and an enter button. the date and time will be auto entered when the enter key is hit. i am relatively new to databases so i cannot figure out how to send the data to the database. The database is already configured, just need to get the program and the database talking to eachother. Thanks.

    Read the article

  • Count Clicks in excel

    - by rockbala
    Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

    Read the article

  • How to to dump JS array... (boommarklet?)

    - by Soulhuntre
    A page on a site I use is holding some of my data hostage. Once I have logged into the site and navigated to the right page, the data I need is in the array eeData[] - it is 720 elements long (once every 2 minutes of a given day). Rather than simulate the requests to the underlying stuff json supplier and since its only once a day, I am happy to simply develop a bookmarklet to grab the data - preferably as a XML or CSV file. Any pointers to sample code or hints would help. I found a bookmarklet here that is based on this script that does part of this - but I am not up to speed on any potential JS file IO to see if it is possible to induce a file "download" of the data, or pop it opn in a new window I can copy / paste.

    Read the article

  • C#, working with files, "Unauthorized Access"?

    - by Rob
    Hi, I'm learning about opening and saving files with C# and it seems that vista won't let my program save to a file on the root of C:\ , unless I run it in administrator mode. Any ideas how to allow my program to play around with whatever files it wants? Thanks! string name; private void button2_Click(object sender, EventArgs e) ///// OPEN ///// { if (openFileDialog1.ShowDialog() == DialogResult.OK) { name = openFileDialog1.FileName; textBox1.Clear(); textBox1.Text = File.ReadAllText(name); textBox2.Text = name; } } private void button1_Click(object sender, EventArgs e) ///// SAVE ///// { File.WriteAllText(name, textBox1.Text); }

    Read the article

  • input tags with array

    - by Dumbledore of flash
    Hi , Recently i am doing a project in which i encountered a strange problem this is the program which previous programmer did MPAN <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2" > ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2"> ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="11" size="12"> i have to read it from a javascript what i did 1) document.getElementById("mpan").value == not reading script does not work 2) document.getElementById("mpan[]").value == reading first one 3) document.getElementById("mpan[0]").value == script does not work 4) document.getElementById("mpan[3]").value == script does not work can any body tell me how to read this from a javascript program

    Read the article

  • Highest value datatype can store in c#

    - by user472832
    I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

    Read the article

  • In .NET Xml Serialization, is it possible to serialize a class with an enum property with different

    - by Lasse V. Karlsen
    I have a class, containing a list property, where the list contains objects that has an enum property. When I serialize this, it looks like this: <?xml version="1.0" encoding="ibm850"?> <test> <events> <test-event type="changing" /> <test-event type="changed" /> </events> </test> Is it possible, through attributes, or similar, to get the Xml to look like this? <?xml version="1.0" encoding="ibm850"?> <test> <events> <changing /> <changed /> </events> </test> Basically, use the property value of the enum as a way to determine the tag-name? Is using a class hierarchy (ie. creating subclasses instead of using the property value) the only way? Edit: After testing, it seems even a class-hierarchy won't actually work. If there is a way to structure the classes to get the output I want, even with sub-classes, that is also an acceptable answer. Here's a sample program that will output the above Xml (remember to hit Ctrl+F5 to run in Visual Studio, otherwise the program window will close immediately): using System; using System.Collections.Generic; using System.Xml.Serialization; namespace ConsoleApplication18 { public enum TestEventTypes { [XmlEnum("changing")] Changing, [XmlEnum("changed")] Changed } [XmlType("test-event")] public class TestEvent { [XmlAttribute("type")] public TestEventTypes Type { get; set; } } [XmlType("test")] public class Test { private List<TestEvent> _Events = new List<TestEvent>(); [XmlArray("events")] public List<TestEvent> Events { get { return _Events; } } } class Program { static void Main(string[] args) { Test test = new Test(); test.Events.Add(new TestEvent { Type = TestEventTypes.Changing }); test.Events.Add(new TestEvent { Type = TestEventTypes.Changed }); XmlSerializer serializer = new XmlSerializer(typeof(Test)); XmlSerializerNamespaces ns = new XmlSerializerNamespaces(); ns.Add("", ""); serializer.Serialize(Console.Out, test, ns); } } }

    Read the article

  • C# Console Application Output to .csv file

    - by Zinn
    I am trying to make a program that will show the numbers: 1, 10 +30 2, 40 (the scale goes up in this pattern by adding 20 to the last number added) 3, 90 +50 4, 160 5, 250 +70 So far I have this code: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO;// namespace Myloop { class Program { static void Main(string[] args) /// </summary> { StreamWriter myOutputStream = new StreamWriter("loopdata.csv"); int forloop; for (forloop = 1; forloop < 21; forloop++) Console.WriteLine(forloop); Console.ReadLine(); myOutputStream.Close(); } } } This is showing the first sequence of numbers 1 - 20, but could anyone give me any guidance how to do the other sequence next to it in the console application and how I can output these to a .csv file, as the information I have so far doesn't appear in the .csv file

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • Force to reimplement a static function in inherit classes

    - by pacopepe
    Hi, I have a program in C++ with plugins (dynamic libs). In the main program, I want to execute a static function to check if i can create a object of this type. An example without dynamic libs (aren't neccesary to understand the problem): #include "libs/parent.h" #include "libs/one.h" #include "libs/two.h" int main(int argc, char * argv[]) { Parent obj; if (One.match(argv[1])) { obj = new One(); else if (Two.match(argv[1])) { obj = new Two(); } Now, i have a interface class named Parent. All plugins inherit from this class. Ideally, I have a virtual static function in Parent named match, and all the plugins need to reimplement this function. The problem with this code is that i can't do a static virtual function in C++, so i don't know how to solve the problem. Sorry for mi english, i did my best

    Read the article

  • I serialized a C++ object, how to allocate memory for it without knowing what type it is?

    - by Neo_b
    Hello, I have serialized a C++ object and I wish to allocate space for it, although I can't use the "new" operator, because I do not know the object's class. I tried using malloc(sizeof(object)), although trying to typecast the pointer to the type the serialized object is of, the program shut down. Where is the information about the object class stored? class object { public: virtual void somefunc(); int someint; }; class objectchild:public object { } object *o=(object*)malloc(sizeof(objectchild)); cout << int(dynamic_cast<objectchild*>(o)) << endl; This causes a program shutdown. Thank you in advance.

    Read the article

  • Creating a search module displaying results in an iframe?

    - by ivayloc
    I recently signed up for a travel affiliate program and I'm creating a module with search fields to search in the affiliate program. What I need is a component with <iframe>...</iframe>, so when I make a search, the search results to shows in the <iframe>...</iframe> in the component. In this way I can chose which other module to show or not with the search results. Could someone tell me how to do it or tell me a similar module/component. I would be grateful if you provide me with an answer or a solution of any kind! Thank you in advance!

    Read the article

  • How can I find out how much memory an object of a C++ class consumes?

    - by Shadow
    Hi, I am developing a Graph-class, based on boost-graph-library. A Graph-object contains a boost-graph, so to say an adjacency_list, and a map. When monitoring the total memory usage of my program, it consumes quite a lot (checked with pmap). Now, I would like to know, how much of the memory is exactly consumed by a filled object of this Graph-class? With filled I mean when the adjacency_list is full of vertices and edges. I found out, that using sizeof() doesn't bring me far. Using valgrind is also not an alternative as there is quite some memory allocation done previously and this makes the usage of valgrind impractical for this purpose. I'm also not interested in what other parts of the program cost in memory, I want to focus on one single object. Thank you.

    Read the article

  • how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

    - by numeric
    Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • What kind of string is this? What can I do in php to read it?

    - by kevin
    This is a string (see below, after the dashed line) in a database.inf file for a free program I downloaded that lists some websites. The file is plain text as you can see , but there is a string after it that looks base64 encoded (due to the end chars of ==). But b64_decoding it gives giberish. I wanted to decode it so I could add to the list of sites it had (the program lists a bunch of sites and data about them which I can read in the GUI) and to do that I need to decode this, add to it, and re-encode it. I think the program uses .net since I think the .net library was required on install, but I know nothing of the original source language. I am using php to figure out if there is a simple way to read this. I have tried using unpack, binhex, base_convert, etc as I suspect the file is binary at some level, but I am lost. Nothing illegal, just wanting to know what it is and if I can add a few things to it to make it more useful for me. here is the file - any ideas how to decode and recode this for playing with? Site List file size: 62139 db version: 13 generated: 2010-04-27 11:53:40 eJztPWmT27iVnze/gjVVk56pXXXz1BW3XW2PPXaNr/iIa69SUSIkMaZIhaQstys/fgHwEIiDBEjQk6Q2lUraeuAD8PDwbgAPtkl6eBoZsX8At1enDKRXRvGfL350gj/9uEmBn4MVAqFGP14Z+f0R3FoP//CA+Rb9ddXj26OfZYJ+EeicpEHrt/5V/2/XA75FDTjzlf7WvlL/NgWXnlW/BQc/jPjzxaAfMUzU7+Xr7m+pj7cVZ/C63pa8Iewa/e+299fbMM3yuv8+fa8wCs5Cy/W9EmwLztfU51Eb2SKZoUe9v458gmq9+l4hFDyiS/W9Ei0Z52tO5/W8+VQ3aGwipvcjIRGUMPmnfN8XE40qCFKABSaFpgQg2ggGARtwB9D55SbM77lfIkCxGIIvsxw2460jBrRxwbfwyJdVEFB2eSERTaTstP4r2OQsG+RhHoEfL7+XOGy6d9yObKaKwE/zJo4eCFYNDD0QhJsIXHD0RHAZRV8EzF6WRQCXkU/ECnDBIUSwB37A8oEsgg3kuF2S3rOCtASwCNq1H4ECCYVCuTT4mRlDUwH2QNDUgT1HcFGDfUewIobQjaBVGdIYkMqoV0I8h2gIgqZK7DmCi1bsOYKVcB25CFp1I38djAY6wXqeokg8Enk8qEWSXg0eT4GHGFFPPMk5BmkHn8rgaVoOA+ZVStCaTgPoo2U8eBzD6bNdHUHci38Ycwi14Xk2F0C7aCpZh3Vv1BAQQ1BFUDDdAATk9PsjuBiW/WjQGIUqglPamACBAJpBH9+9JIwFsbkE27GaXhoBXkZiHKoIzmCdhTnH9VBEsKrHoIoAfd0gZB8i8pexAnQpGMhBySndsIKmAnDsJc6GXocJX1RBQJfJViwkgaEfAmIMqgjI0fcbwTo55cINLYOg0BsXPL1GQGrnnkQMQA65hvRWxQgoDAHINlxbBQHS8JiHSUz6nswQiHZXvRCUVGzi4SNpV98NDCoIstPh4BPeR8scWkdA4FFEkOVJo38JBBSGz+AehSWzKwZDBekwe8s5EHj6IVhdMHQioN3AJM5BnHPWocQtsSFXTSTqCPAc1klAhWLUEAyaAmpGzKIfghx87UuDQqYMQFBFNGoMiggu1JcmImP5VpGD8BKW4AcV2udQtV2FZCqAiwCOIQeHYwSBxotfbq/uChTGL362Xyd+GhhRsgtjOzutD2EOO7g+7o9XD//wbw+yI9iEfrRCmB5KffbgpvENxLGN/F328O/P/axo//e7U54U3/z9wU0Bhc0wDNk+D2+4aC/wS+MMpA+DZHM6QIa83oH8aQTQn9nj+9eQVj9BYtd5qZ//2/zfa0ymGhX6usaFsicduOrMC4sLf13j2oZxmO0f3tQzwCKYnEbZAlEYt0HzsvkfkA1g+xTswiyH/gKmVBbu4tOxaNiAXDAXQrpjanW08jI149b4oQzU/fCn/4H/6cRQKRkKB6knJDHhbUahqTaYJApob9IYahNUEgVUDjSKWl/88Kd6ZUoCXygeJDEoludwX466sZQ1nPokSpLPcKtb9UZ7f9psoEeGgi33xtsELm7QRFJ/ATGVDnXRcfmPolsSQjQkMTx8C2IDTb3Z510QoC65X5C8KMVjDSeTomsjlSizPGU+Uhc6ztYmEdWpVbmh6cS2paQXiahIHMlgiVqwRNJYSmpbAkRVGkkGVZHd4eNBCR4ZHDgrxUeB81IyOIr8FB9JkaJCO51mdCTpUSx2s/fjHXhom+Z8YjoT2zKsxdKyl5YHBT3R4A8PbioF/JBWxjdhHICvaKc+Ovo7cIsVBKt8uc10KFs+Xo62rTb+R6g3jZdkM0IkSCpm1GBV8qQ1TC8Tm43GxNfK9YRZZUz+u54VnKrx5pQ3W5NzbqhwipwNjc4o88s/rRrhc5AC4z45GRs/NooGRgzORmUVkEgsrjTmLWsFHGImNPOBPS0FKqJNK3l++FcebRaHxyPIh9kgNTK+QXOxRGRsAGohDlBCwv+XNwb+E9os1eIbe7iv1wBUjNFqEHB+t5vYwqwDj82RdLOJucCSbrq05kvPVJB0aGdf413EdzCoBkLpdhdFydl4/uHVS0LQ8aUbjbGPF1FERAc7EBLuA7Gzy6FDnXpN2JCPHjW2PyN9ur/hOBH4o+Kn1EdbBH8FZc4BHNYgvX0Nzv/+Cv85RHoMkhp15EZsj3du6ktUlyd0UERSWjIUGMpIyCe4w5Pzdf0Zcl6uwzgGKeJQUmKgf0t0IuVHcUSPijlOKuAhpuUlJT3MuMTjoTdaH1ten+2t046vckOsJsF5me/FvRQSWQa+BO0xB19JWcRYT1gLw7KgObw05wp6ohhndiMyhRtwCRuYrxooLH00w8dLdGmgFfu224ptCPpq8NU63ARJp5ynvxkizT8MkebvdQSKnoXsACrDbRuKzDMVGfmRjR2S27+ua+8e61ttgqTC9CSJoZl8GI7wGTK2Xw9XBC/9VjSyeuCpBhXwOEx2qX/cs4b7RVRKSjBvYi8M21ma9tK25SXYVRs2c2nPl46CPCzDgR9SP4CG2iY5CEPzlya9pSL+86afOMQHSLTYydIh9uZwOzx56PxAD+oLgF4PEeSETXcgMKCHIOPiW1WU/qbdEuc04ojkWnxr8Mt1uOVaQvhknq93EL9RwTDYYJfwHzQY1MMVhS4L+G64YkBNH8uhURGmlr10vKXlKpiD5+OkLWhAgnWEDJr4+shB2EyDGDzLRQpsPGI/OEA5eEyyfAIdd4nMITnLR/4Gbe2WIGH970omvit/MJ4lqfFhH2bGe+jfEB+ywlNiE6HxDwsvHjZwowRhDt0cc5iXrsPBLhyYwVJByTlW3IzmdOk6CpuxULjGT2s/MPb5IfqZsyOZNv+61ohena9f4Uhzg2UhT92ZLW1LnhtevH/6y+vrJN2xTFCDdIjkgp6TykjhMwSRrwlj44/G+yJ3clfnTYYkq/TUkGC9KS3W6VkX/nsp6itgPOGVGAiqRZoI+WUjjAR/gpnKuIuNu80mOcU5j7bD5H5lXw6zO1uqRiQjr63WJoFjoG4gTkMNc7oPYRBEYAXdlRxuMArZ9wveQn/z6Mc07SXI3Vq9IV9OMLwQ4JgmX8J401UJ0IkG2i/MOqiVNRz3SUwPQ6KQwf/KlFN8h6i0DneFI117mkn6wvUbNVRKSnaG0qa2Sji8zfnR5flUYptE2Fdf+hqrLv0VZYAV9O7Umit5rVj9a2gVpZ8OrYxYZVC/5/i0wMAITL6KwvgzOgvUP+OUrvApT95oWK0qwPb4/kXw01WIwtXICUueQtfMuvp5UOp0oPLlcmdPiVNwp6geTkHgFIhsHYh0yGR/aKIRSo0NLiUYppb9lZSKUgrmm0vbWbrTVvkbhKkB0d9enc/na0j5z0kcQoZNY5DX8XckH/jgBzel7EBc9PCVn34GeRjvDD8OjAxEEfo7ieH/AeMc5nvDN7KDH0VGkhr75ACM9SmDsAxa1RgBRLRLkl0EHk6ga1b+CX/0I/DVx78Vf1Fh6n2eH5c3N/wh3hQG/Ko04K+Rl94azx6EzVYTpNXlHT3laHFiqVVicUQIyy7uxLQxu7hLh/WJIYswnOIf/G9o5RgeIQFN7rgrIcxau+xSW3PPnBGrrexHE4tIjuimqPMpolXXm+1hQJkUa9KPVy3VyPmozq0jVbRPwfb2Bzib2pCA3z7CLFjWdK7uk1NaQTO51JFokFQ/sjtRFgdr9IiQ1LYQxvD7pqSInI1Ffq9S80WWaykIA2VnXlMllQZfXOOxCP1VCxIGjqQu7yGci0Vfh99Y8dwAUQK6rJV9HH5jZPSUldGeNTOtVhlNSGaRaGgMh3Jo2tPOvbCoq2fUUhzEIoq4ZYodMTZhKEqlCLzExbWAiYsopBENEl8ljuFByQpRq0U+kkWTAT+FLaqAMbT3GhuHBTc3z3sMv0SJqf3jcWwcZ+bNZ90mLdszFd1W0aPKyBR3DK8uqvdJB26FlBJ3D6rdu2tVqTLFf+Eu9vNTyqfIqNxcWSXNQipKC+REDRVPERQ1VlK87E3nU132Oj24MjX6KABZfnvJPP7DJkqFxrrSxIYVeMkd4WodnFSKtxVDnf6lZ6jrYBZzrFL1aFaADoKE6xOK36zIm9V0H9ZqdKTjiAcPr86SturiiGFJxuoEXHk5T3e6UX3REOrVMfLZ6pN2Kfv/FW/aPBRvYs9wScV8abGH5HjqqQyKTzZJmvoRo59YcK2gdFzTgfVZGac3nuA+GCXnsErOtheeaxNaToeiBpUtVoRJGVJw4PppUZmtxhvciUyEbu5NvXkHLSxMCw+Ro5MWMUhqC5QgQfNn/TN/DZK76sSyRFjSsuYzT+OsCb2Zhpu9yFCrYKOtvPEO9iBDAddzGk6/RgJ8gYLGF1GgBo5Ggr+gHmTEgOWac1RHqJUGh/tS5q1PYcQz2XkN9NPi1b1RycXHRT9SFHHMhauTK2r/FP4CNijJsUuioEETcRP9VPml6uJX2IVRY6p+ldk39tS1zREo5KbgmIZxzqUNCRxRabjGu6IfhhAmJ2o4s217JBG69UOhr1vBxhOhz2APDAVsDis4c9ObjkOBLAY5SlqKqEDCR+SI10UvUrLDMq2FTkMCzTZOcnD0g+vySG1FhMvPIxgSBW6ZKU89+B9X85RPx9M6gq4+nNw2acy6AdE/8Y/G2wI/USLbLQ8905nqXvUqDRAleS4OehHg8WTB46ITGW6YzSxzoZkS2xSAKqA7CcAxYWs5+E30U+QZ7OeiMlE/MkRxp/OF9i2Shrt9dT8RQw8aqJ8S71APFSmkbG3L9izdiuLo536cQ1syO0VFRUulGr748JcGTTra6ifRW9whMkFRj/DPzHiBi29wgRXHS+eEomeOO7VnI6lXHG0SKtcaOp5qvUNdyFgZlu0ubO2CxY8i6BsgsxLE4JQijcJSg99mBJpE0VOioxdYvUlQZr5wF7oZBHyrHRJGAVMw/YR4+l+17m3xSni6Z+o4C61uCcrAX2++3dSapRrOxTkRNhlPHSu5apY7s2Y6iUKIiA2I2GgnBRuPDE9gDzI+GnRVLVMnBa7a+xN3ZZmoK9vDZ6ndpSMXXa62G9bpcXIWCmyywXgyGyv+18mZIT2nxtW25wvt7lCtn04b1vChgeOx33vUhYwKt73ZwtYdYSvn+dlPD8IoYw0cjQi/oR6kAkbuwprqjpOgaxn/dgIZMlKuT58pY68BG8O4KzuQmf5s6lnaI+1lOGxSRlJZH4CFj+AGFJ1UcVYZYixmnjOSResHX+AgTqlQLjQajCcb7qpuZMwW6BU5nnYNbU2SYx4ewm/FxZCku9MkTEvDEQhkTd4QvUlEnzuPTggLOFom1nr9Pldnu4YJdba5NNkLolv48VAdIamP2lP82GgwHj/WR1nkMkLWCOGKKvcHcpSXF6YGL+ARs4NFJ1J7E7rf2oMWdRKQVyxAA8cjw19C2UoBbzGf6SZCqZW2JxCBgKECAx2tYuIZ7kKKDObMm+q244LT4RCCbHcKA5Cz0QcWrJ8QH/bwu6If41fUkQwxFtO5N9ettML4S5iFaygW16xRSwP1E+JF1cOrx3cyNHBm5szVLSfzvZ9nh/s43OxZK4YGjsEMsAfj1b3xGvUhRQUbunj6qVBVCp2TNGLlAwc+zsaovv+EupGSElNvrt3TgdMtJeImSWNONojXYByCEIVmsWw9heNYuhkEneGr8htMiJIG6qcEvo2/23jl88fMHKligCkr4cBGsyd+ffPyF5mAtePazlglEwdo2SXHJAo5J3l5LUa0uOt+pIooZtPFQmuMskqKnsG6FAwsSTjwETKm754+NT6BdSU4pOgxm831kwO/5wGCyy1arIXBNhjDysC9iOsLeEkec6rf9IS+FhRcqJA6Cr9A37Ccdp3A4ASUuj8YI8JU9Wq8xN1KyF2e2IF62TV10/Ds7w9ihmKg+qnz6e75q4kSK808z/S66r77yl8/Pol92gt0zEgH6kMmLWTPp+58rMx6GGcoTSJMTxDwEQvXXhS9tGwUHl2mtjt3RmKQjTj0sxk57POEE/HhZSqcETRxHd3yo4M49FUC+RSQfEaOCnRBlHJli97CstpnPZ2YHn4TxFracolLZF9wdASdqhE3G06JZr2WyjaYtO8AdWocQbqF3QuVBQc+fP5vC6RiY4PHDPbcnC/aC+DVpr+FIyZWuTF1DkzDssO2Brn2UpUSpgudM93LTs6NTgJQMD3srjBjG/rl3rRdB6rN+LN/hhPa+2WRLkpskIvNBw+f928l3qp4l5fp4B6AWkxnHcEa9RWvHG6opUAsdMdrqJLCk7CAfsWYZQoTPHPecYpDffKHe7E5TMF0TfzVvUy9GO/Qn23PdS7+8Logc7F00Du0UqT+GzR0w/yeECIsyQVtdJH+zwX6hqiV8kJcqGQcnSqG2Fq1ESEMAjVbfIdCPZYm3GIpx5yJhfGFSWboIkSLvYiWR5Mo8FEEND0USXD6HhgWrJ8aL3+5I/ooeKVinH6uvOWZC7GeJgllzXg3RnLzkX6aRGHsC7cSr8EIWcmyF6XjJ9bUk6LHdOnA/y7kNtN60xkQErQZYUM9ftLvoKJltVXPk5RBkkaOU8opx+DrSShhauB4wuU16kLGk7Es1xbXYJI0gBvGk9M9+LwNMt3F2p7fRJfmwVIEm/nCjcIlxXwxd3UavGQAIzkcw6guNuLGOJpNRqyNvnQk5/qYltgSarCIs/TkBMgO1dhUS4/Ef3JgmUTUSBeb/IrwX8xD2IPxCnYhQ5Pp3LQX7fHi/iZKNQGhhUI2GNFAqb6VqmOeOmJyXHjEW3rO0mZfJuKGz4tLoi8SgrZPeA108canArdSbMRFx5BGchiz2M/Fl2ZcoKOxw3vchSEZM+Pdm7bwxDZ9g0MgbeSkyD5Zr+87DRFhK1288hx10C/hb9mLxdTSHVYqJzspbkAE8Y53246okeaQw+Q9gf93ia0GAByFhggNHOFGDdiDkvvrebOZ3E5xob6Vk6U130+S7UVeMrUx4mYj3jRivNkq2WmOYzVvYGwhkLc0lZIwAeaGA+/EBLeFrs1SvryFK4deg7MwMv099osfJPgCvWr9W1y8tpYjaKKyu74RvelUcl85ztLp3lenz9fr1IcuzBpOoUEbBqKLTR4jrOjGhZ1avmpmubO5tSCPSHPuxmSGfUOvSvN2TJbZqucnoQqXOL9YC5jsGAYg3VCnF/lgQT4A3U143bnLMKInyScleWPPLdsy20vc1XdZvgenzxIJ0JZ2Q0iBqjU//tYv++k4ZmuMrR9BCmue5x83IIJJFxeaZjdtiaBPFR6pU3nzmWe77RuGGRxxhqjaOYUYl9s5tolOEXEekW/XWAnvjCML5l98zL+nhHfZhNes6Zd765W9NJcYEfssWXXK6nd5wrP9XZL2y4TJWcXgXCVuO98pa8fU/oiZyrWuJZks4VMWRq8nKQQof4dXAs9aHgjUgaX7kS2ll60slNCRiLxW70t9jpMz5KIdyKAxSR2Cb2nTlA6Py4a/VQ3f44ZydQPedDZvF5wt42hKzqGPTpVojIFP+BVIylro/pfko3umfchPrzks71Nvn0lcle9NzJlhLZauJVtqhp4P3KWodoI9JULBmvzwEgJ/LYBy94pMZ2YHD3D6pF955L3P0EoGp3ubVLgBfv01TU4x97JNGt4kB6qdM57iFv1MKNtcLOwOc1wwEuFl9TzKWCaijDNbmtLmODSjwm+UFcaC+MbE86KBlH01c8xGgYWSPcEO6FIR1PqM+IfE8IPA8GOj2tX3yck4nLIc9Uq8JqD+QCpu9l2fppcgxiP8rvhtYZJImSIcbMVra1mBb5PfHtNkGyKztvOV8WdhFBnQhTG2IYiCzFgD9EpGnhhVS8M34NgMRKP/QE8lwj8MqAv4T4+rGDz0avS0KzTdY6/nGnuogLZymNTeL8ZCwptDZ03eZ4c0PO8TvsN+gTXFxEe4uJ/27M1lPB9zbi08zjMrtXiwZeQDOZSbR2Fwe2f9k7yCKN7m7JwclX3Nfm7L7uMwRsIyNQKQQ2rUm3kPYmMThZvPxnv0SAu6p+6ev3+5zGfhwjZXJnO82QP/CB3ufZKh+you0WoMKH9NwZcQnOGCfAk3IMNPwAdIeJGcOhRRk62foI/wMbbnxZeqtoDpTht3vHAWf+iI6+W/3EFHvYZVx/snuDgDA7MsTGJJSwOvI8pIdIcvAHqa8pJfICufWVCT1k8x/BIA9nN/7cfs9cs8kYKumeqwudjui5+ouI4KSTx76XbfC4NyLMckiVA86QtcwKbfxoU2CfOphBjobsi3sK2Ur2YvPIvz+KycEcYdVfnQ0z/wm1WcZefPROVVKD6G+lWoYcEbuTd55PW9ZVjmEp1R6t6qB7gF/CrBgxK5IcWaogbUc9m4Ve0r3RXtpG4GXszdRUccVjSGm80unKwhNxbfXB/ZUIKYPlAloepACa86gUvHPj9a/yqIWJ+Pk64gPYFCppoRDn/Bf2Sx4XTXWNEQsHtwc4T6QylW2cAhGaWsDIF3lemPCq7yfQgNCUgIeYsBBcWK67bkEgto2ML8Pw1ssi2CKpUAefa0+W6SYA3obrtixmI29dylK0cHaz6fC+lAA5t0QFAxHXinR1zT7q1XeOMpUwVFOLCPasm/5vrSBRBZ/4wBMzXqVVJuyFO0ERlk9WYs0PR/fjD/WgVhBwQ8v+aDIq9oDDix1x1T70Cj5b1AiKd8t7DjOcOBb/DBflqyIj3zNfwN0DMswt8APUMbENkmidXwyXBO63PpJVRyrvskBtSTjlIfbv2vVz0+Qwqxz3eohNyP7zlrLPW5jlcbEZulNBLZwR/Y9IqiXWstzfnSlCuKq+RmmEV+LKy2JsACS67weIyf1n5gIKn7c+fVCxij1LGvKXTQzPZLsvtUeE0Ofp6GX5mS6gZk6HSDySuMS+qiuOl0Pm2/B6zH8eow9uMNmFTpxknksxekixo1LaBnRSujSowad3FgvPTPxrsydymXFlvYjt0W1ey0i0Sj/ad0u1snVHrfjx5J20JCVC1uuHIqWUcmWefjxZIPLEtiwy8h63gHuXgGufsRZDG6D/6uwBhu07p4pUzBfwrjIDlf1x+uk+D+OoxjkCLUSqNmu7GVumlO6V/q8WVfT9ZqLYdG6QFmdNBsaUkeVi1PXYYb4YHMAqRHvUNkMlX+C2vutFSx91Ts8b3Qw6dgVAI/vlc6VOzC0VtOd5yD6vQGWt3tfq6CfyoWVTKlXoWxSYtNpeqbwt5Ex+3V7M3yeWvBre8EmFtkofJytTdz3Mapq9LeuItQ5g7JLNLgaK9wJMZF1+nwIlbKirVd7SgsibN0F7LnUMEXkN4HvnjX8BpQGSmqhdx9g1OnsS4C0vN6V01BFbLSlKNHtkmSY/U0SpMSTVCTBu8R7M+yD55YrjdrXvAhmH6zy5tqAyhTwF3ai6Ut9zgDCj5P3JCdPwmgiuPevPlt4r74IBcgXkwtTtmT0o4kh0JHDwfuRa7Jtg3TLP/RKP6BaChjhHAxyZofG5+R7fAnsEvSe5kYRF/7nAk+qZnkjKWjZjpvWkKcCvIPcru3tLtLefAVQGeQsamr+tcmn/8Z/Sz18LU7h//t3t91P9+jOgHSxYHaWu4Ki3wPinOxRSEdTSAW3KQUOl1TnHs18I2+UifoZ47tSKSO2L6pkmmV/JGLLn2xJF/USsEhBOnlEBJtwPAaNOnytmiheHDc9UyZvCave/pATrvx2UKluaxF4Uw9oTFBwZq0gUCVU2kLy5pyMmyEHpEPKlHjujkkwQn9jeo90Uhu0bnU1d1mk5zQK16/71Ed1HzVP/vWOdfiKO6qPoErGXxSouEfkyMqycVTHxKTyvBzo6qGs0pEAl08qz8XpS8RhblBR8BDxFY9Ax8NdLbmCAiSSTN8SlnpPohjmgjvpKpgXJfzLQTKnbA2p5wjgn28zWo8OGKQnOOBdi2bkqIO3LTustO6Mj5XvVJrKG6ozb2doVsNJC9IIa929ONA9BikuBmVBFG9yXEOdZQpcYhWPIBKga+qEq5BbLD1/Q1vCfu7ORgjV/4o+TsYzaDUQoFhUEwMo1hHp5T1Y+jziyrcOlc80ZztEyg9henYGsqPjj1HYKnaV3QxokQQgukXiaQoxAXX1352fARlw61m0SRf2kI4qPRZ3MvCK62XN1tacqGSKs+2D3f7CL9YQHsE3Bb8k6bG86qNzOKhBzssicXjDgDfkDBpOgRDAtFf83LrGkbPzYtQ7IEfQJYaXKG0Gn5MFSJZ36NgbwdjyiDCQrVL5sqNCbOkEJOkwEaICnnNrJaSxEZ4tJZA1c3RAkKyHPRgxYZoU0ooV+asypv2VqLKHgUBM8e3RIoiDv8H/FOXyg==

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

< Previous Page | 281 282 283 284 285 286 287 288 289 290 291 292  | Next Page >