Search Results

Search found 44691 results on 1788 pages for 'first'.

Page 286/1788 | < Previous Page | 282 283 284 285 286 287 288 289 290 291 292 293  | Next Page >

  • AudioOutputUnitStart takes time

    - by tokentoken
    Hello, I'm making an iPhone game application using Core Audio, Extended Audio File Services. It works OK, but when I first call AudioOutputUnitStart, it takes about 1-2 seconds. After the second call, no problem. For a game application, 1-2 seconds is very noticeable. (I tested this on iPhone simulator, and iPhone 3GS) Also, if I leave the game for about 10 seconds, first call of AudioOutputUnitStart also takes time. Maybe I have to call AudioOutputUnitStart beginning of the application to prevent the start-up time?

    Read the article

  • SSIS - user variable used in derived column transform is not available - in some cases

    - by soo
    Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

    Read the article

  • JQuery within a partial view not being called

    - by XN16
    I have a view that has some jQuery to load a partial view (via a button click) into a div in the view. This works without a problem. However within the partial view I have a very similar bit of jQuery that will load another partial view into a div in the first partial view, but this isn't working, it almost seems like the jQuery in the first partial view isn't being loaded. I have tried searching for solutions, but I haven't managed to find an answer. I have also re-created the jQuery function in a @Ajax.ActionLink which works fine, however I am trying to avoid the Microsoft helpers as I am trying to learn jQuery. Here is the first partial view which contains the jQuery that doesn't seem to work, it also contains the @Ajax.ActionLink that does work: @model MyProject.ViewModels.AddressIndexViewModel <script> $(".viewContacts").click(function () { $.ajax({ url: '@Url.Action("CustomerAddressContacts", "Customer")', type: 'POST', data: { addressID: $(this).attr('data-addressid') }, cache: false, success: function (result) { $("#customerAddressContactsPartial-" + $(this).attr('data-addressid')) .html(result); }, error: function () { alert("error"); } }); return false; }); </script> <table class="customers" style="width: 100%"> <tr> <th style="width: 25%"> Name </th> <th style="width: 25%"> Actions </th> </tr> </table> @foreach (Address item in Model.Addresses) { <table style="width: 100%; border-top: none"> <tr id="[email protected]"> <td style="width: 25%; border-top: none"> @Html.DisplayFor(modelItem => item.Name) </td> <td style="width: 25%; border-top: none"> <a href="#" class="viewContacts standardbutton" data-addressid="@item.AddressID">ContactsJQ</a> @Ajax.ActionLink("Contacts", "CustomerAddressContacts", "Customer", new { addressID = item.AddressID }, new AjaxOptions { UpdateTargetId = "customerAddressContactsPartial-" + @item.AddressID, HttpMethod = "POST" }, new { @class = "standardbutton"}) </td> </tr> </table> <div id="[email protected]"></div> } If someone could explain what I am doing wrong here and how to fix it then I would be very grateful. Thanks very much.

    Read the article

  • jQuery Load MySQL Fetch Array

    - by Robert Hanson
    I'm a beginner in jQuery area and I have simple question like this : I want to load (AJAX) MySQL result in array, let's say : $row[0] = first name $row[1] = last name $row[2] = phone number I have no problem with PHP part, but I have difficulties to display each of that array content on different id. because syntax I found loads everything processed by PHP : <script type="text/javascript"> $(document).ready(function(){ $('#mysql-result').load('ajax.php'); }); </script> how to get 'First Name', 'Last Name' and 'Phone Number' from PHP with only one time load and still I can put the result in different . thank you.

    Read the article

  • Mootools accordion inside another...

    - by jimbo
    Hi all, This is a funny one... I have created a mootools accordion with tabs, each section appears when clicked. This works fine. Now within the first accordion that shows, I have another accordion that displays more data. This was to keep the area small with the mass of information that is needed on the page. All works fine, the problem come when the information hidden is larger than the area that is worked our for the first tabs accordion, and it wont display. does any-one either understand what i'm trying to say, or have an idea of a fix or workaround? Hope this makes sense!

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • (conditional) Multiple Event Handlers C#

    - by gjk
    A portion of my program requires a "flag" retrieval, that is I am fetching a value that is either True or False, and based on this return value two things could follow. 1) The flag is true, aka "go ahead", and I retrieve data from a database. 2) The flag is false, and I want to prevent the data from being retrieved. Now, this check has to be performed before any function that would call upon the database in question. I decided to implement this check in the form of an event handler attached to GUI objects that would trigger this data inquiry. This check event handler is called first upon necessary events, and my question is: How do I stop subsequent event handlers from firing if the FIRST event handler (my flag checker) comes up FALSE? Thanks

    Read the article

  • Shall I optimize or let compiler to do that?

    - by Knowing me knowing you
    What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

    Read the article

  • ontouch - Switching positions of two views(images) in Android

    - by idish
    I've been looking for that 2 days long and haven't found anything related to it. I'll give an example for my goal. Let's say I have 2 images positioned side by side horizontally. I want the user to be able to switch their positions onlongtouch listener. so let's say that the first image was on the left and the second was on the right side, after switching positions between them, the first image would be in the right and the second would be on the left side. Basically, it is just like in the launcher where you can switch apps positions. Please, if anything is not clear for you, I would like to know, and I'll try to explain it better, thank you.

    Read the article

  • xsl:variable xsl:copy-of select

    - by user1901345
    I have the following XML: Picture 1 Picture 2 Picture 3 While this XSL does what is expected (output the attr of the first picture): It seems to be not possible to do the same inside the variable declaration using xsl:copy-of: Curious: If I just select "$FirstPicture" instead of "$FirstPicture/@attr" in the second example, it outputs the text node of Picture 1 as expected... Before you all suggest me to rewrite the code: This is just a simplified test, my real aim is to use a named template to select a node into the variable FirstPicture and reuse it for further selections. I hope someone could help me to understand the behavior or could suggest me a proper way to select a node with code which could be easily reused (the decission which node is the first one is complex in my real application). Thanks.

    Read the article

  • How do customize the g:sortableColumn?

    - by kakaotalk
    Well, I have one column in my list that I need to customize, the thing is grails' own g:sortable doesn't work. For instance, my first column shows employee ids, then my second column, shows the employees full name where full name is a combination of first name and last name. I got it to work, sorting and all, but when I try to place it in a table with g:sortable, the g:sortable just wouldn't work. I'm thinking about passing params around but it's a bit tricky. Any suggestions? I've looked around the internet, and seems like nothing. :\

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • Strange Locking Behaviour in SQL Server 2005

    - by SQL Learner
    Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

    Read the article

  • How to deal with delegate method calling back the object who send the message ?

    - by olipion
    I have two object: @protocol ObjectADelegate - (void)objectAfirst:(ObjectA *)obj; - (void)objectAsecond:(ObjectA *)obj; @end @interface ObjectA : NSObject { id<ObjectADelegate> delegate; - (void)callSecond { [self.delegate objectAsecond:self]; } @end @interface ObjectB : NSObject <ObjectADelegate>{ ObjectA *myObjectA; } @implementation ObjectB - (void)objectAfirst:(ObjectA *)obj { // First is finished, do second [obj callSecond]; } - (void)objectASecond:(ObjectA *)obj { // Do my stuff } @end As you can see in the code, when ObjectA send the message objectAfirst to its delegate, objectb use again objectA methods that result in objecta calling back objectb. It means that what first fire objectAfirst is not finished but objectA send the objectAsecond message. Could it be a problem ? Any way to let delay message handling in objectB ? for example, something like using [obj performSelector:@selector(callSecond) afterDelay:0.01]; instead of [obj callSecond]; ?

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Perform tasks with delay, without delaying web response (ASP.NET)

    - by Tomas Lycken
    I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

    Read the article

  • JDBC Pagination

    - by Zeeshan
    Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

    Read the article

  • objective-c - calling one constructor from another

    - by synic
    Say you had the following two constructors: - (id)initWithTitle:(NSString *)title; - (id)initWithTitle:(NSString *)title page:(NSString *)page; The second constructor is no different from the first, except that it sets up the member variable "page". Since it basically has to do the same thing, is there a way to call the first one from the second one to reduce code duplication, or do you have to set up a third method to do the common tasks? I'm talking about something similar to this, though I doubt this will work: - (id)initWithTitle:(NSString *)_title { if(self = [super init]) { self.title = _title; } return self; } - (id)initWithTitle:(NSString *)_title page:(NSString *)_page { if(self = [self initWithTitle:_title]) { self.page = _page; } return self; }

    Read the article

  • Should I be using libraries if I'm trying to learn how to program?

    - by CodeJustin.com
    I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

    Read the article

< Previous Page | 282 283 284 285 286 287 288 289 290 291 292 293  | Next Page >