Search Results

Search found 24106 results on 965 pages for 'usb key'.

Page 286/965 | < Previous Page | 282 283 284 285 286 287 288 289 290 291 292 293  | Next Page >

  • How to store an inventory using hashtables?

    - by Harm De Weirdt
    Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

    Read the article

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

  • MySQL DDL error creating tables

    - by Alexandstein
    I am attempting to create tables for a MySQL database, but I am having some syntactical issues. It would seem that syntax checking is behaving differently between tables for some reason. While I've gotten all the other tables to go through, the table, 'stock' doesn't seem to be working, despite seeming to use the same syntax patterns. CREATE TABLE users ( user_id SMALLINT UNSIGNED NOT NULL AUTO_INCREMENT, username VARCHAR(30) NOT NULL, password CHAR(41) NOT NULL, date_joined DATETIME NOT NULL, funds DOUBLE UNSIGNED NOT NULL, PRIMARY KEY(user_id), UNIQUE KEY(username) ); CREATE TABLE owned_stocks ( id SMALLINT UNSIGNED NOT NULL AUTO_INCREMENT, user_id SMALLINT UNSIGNED NOT NULL, paid_price DOUBLE UNSIGNED NOT NULL, quantity MEDIUMINT UNSIGNED NOT NULL, purchase_date DATETIME NOT NULL, PRIMARY KEY(id) ); CREATE TABLE tracking_stocks ( ticker VARCHAR(5) NOT NULL, user_id SMALLINT UNSIGNED NOT NULL, PRIMARY KEY(ticker) ); CREATE TABLE stocks ( ticker VARCHAR(5) NOT NULL, last DOUBLE UNSIGNED NOT NULL, high DOUBLE UNSIGNED NOT NULL, low DOUBLE UNSIGNED NOT NULL, company_name VARCHAR(30) NOT NULL, last_updated INT UNSIGNED NOT NULL, change DOUBLE NOT NULL, percent_change DOUBLE NOT NULL, PRIMARY KEY(ticker) ); Am I just missing a really obvious syntactical issue? ERROR: #1064 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'change DOUBLE NOT NULL, percent_change DOUBLE NOT NULL, last DOUBLE' at line 4

    Read the article

  • Python to C# with openSSL requirement

    - by fonix232
    Hey there again! Today I ran into a problem when I was making a new theme creator for chrome. As you may know, Chrome uses a "new" file format, called CRX, to manage it's plugins and themes. It is a basic zip file, but a bit modified: "Cr24" + derkey + signature + zipFile And here comes the problem. There are only two CRX creators, written in Ruby or Python. I don't know neither language too much (had some basic experience in Python though, but mostly with PyS60), so I would like to ask you to help me convert this python app to a C# class. Also, here is the source of crxmake.py: #!/usr/bin/python # Cribbed from http://github.com/Constellation/crxmake/blob/master/lib/crxmake.rb # and http://src.chromium.org/viewvc/chrome/trunk/src/chrome/tools/extensions/chromium_extension.py?revision=14872&content-type=text/plain&pathrev=14872 # from: http://grack.com/blog/2009/11/09/packing-chrome-extensions-in-python/ import sys from array import * from subprocess import * import os import tempfile def main(argv): arg0,dir,key,output = argv # zip up the directory input = dir + ".zip" if not os.path.exists(input): os.system("cd %(dir)s; zip -r ../%(input)s . -x '.svn/*'" % locals()) else: print "'%s' already exists using it" % input # Sign the zip file with the private key in PEM format signature = Popen(["openssl", "sha1", "-sign", key, input], stdout=PIPE).stdout.read(); # Convert the PEM key to DER (and extract the public form) for inclusion in the CRX header derkey = Popen(["openssl", "rsa", "-pubout", "-inform", "PEM", "-outform", "DER", "-in", key], stdout=PIPE).stdout.read(); out=open(output, "wb"); out.write("Cr24") # Extension file magic number header = array("l"); header.append(2); # Version 2 header.append(len(derkey)); header.append(len(signature)); header.tofile(out); out.write(derkey) out.write(signature) out.write(open(input).read()) os.unlink(input) print "Done." if __name__ == '__main__': main(sys.argv) Please could you help me?

    Read the article

  • A scheme for expiring downloaded content?

    - by Chad Johnson
    I am going to offer a web API service that allows users to download and "rent" content for a monthly subscription fee. The API will either be open to everyone or possibly just select parties (not sure yet). Each developer must agree to a license, and they receive a developer key for their person. Each software application will have its own key as well. So then end-users will download the software which will interact with my service's API. Each user will have a key for each application as well (probably using OAuth). Content will be cached on first download and accessible offline via just the third-party application that cached the content. If a user cancels their subscription, I plan on doing the following: Deactivate the user's OAuth key for all applications. Do not allow the user's account to download new content via the API (and subsequently any software that uses the API). Now, the big question is: how do I make content expire if they cancel their subscription? If they cancel, they should not have access to content anymore. Here are ideas I've thought of (some of these are half-solutions, not yet fully fleshed out): Require that applications encrypt downloaded content using the user's OAuth key, making it available to only the application. This will prevent most users from going to the cache directory and just copying and keeping files. Update the user's key once a month, forcing content to re-cache on a monthly basic. Users could then access content for a month after they cancel their subscription. Require applications to "phone home" [to the service] periodically and check whether the user's subscription has terminated. If so, require in the API developer license that applications expire cache. If it is found that applications do not comply, their keys (and possibly keys for all developers) are permanently deactivated as a consequence. One major worry is that some applications may blatantly ignore constraints of the license. Is it generally acceptable to rely on applications abiding by the licensing constraints? Bad idea? Any other ideas? Maybe a way to make content auto-expire after x days? Something else? I'm open to out-of-the-box ideas.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What location to put bootloader, when running multiple drives and partition

    - by Matt G
    I have Win8 on my desktop, where a 120G SSD is used to run windows and some select applications, while I have a 2TB HDD to provide basic file storage and where possible, install applications instead of on the SSD. I want to install Ubuntu on a new partition of the HDD (I allocated 300GB, with 5GB swap file). I've used a USB to install the OS, which seemed to have done the job. However, after prompting for a restart, I can no longer boot to ubuntu. During instillation I was confused about where to install the "boot loader instillation". I ended up selecting "/dev/stb" because I figured I would be able to boot with BIOS by selecting the HDD drive as a priority over the SSD. The bootloader is a large part of where I think I went wrong. My partition system looked something like this: /dev/sta ... //SSD ~120 GB /dev/sta1 NTFS (350 MB) //Win8System /dev/sta2 NTFS (118 GB) //Win8C-Drive /dev/stb ... //HDD ~2TB /dev/stb1 NTFS (1563 GB) //FileStorage /dev/stb5 Free Space (300 GB) //Space I want to use for Linux (NOTE: Created two partitions from the 300GB, ~5GB and 295GB. stb5,stb6.) It'd be great if I could get an explanation of what drive you'd select for the boot loader and why, and what selections won't work with regards to the Boot Loader Instillation. I think I understand what Grub is, but I have no idea on how to use it, or play around with it. I seem to be able to get back into OS from my usb, however I believe it's just showing me a preview/trial of Ubuntu (ie, can't access any of the system NTFS drives). Note, if I try to install from the USB again, it will recognize that a version of Ubuntu 13.10 exists on the system. Apologies in advance, have used windows all my life, don't really know to much about Linux at all. Did have a brief skim over some similar questions, didn't find anything too useful. - Where to install bootloader when installing Ubuntu as secondary OS? - ubuntu 12.10 dual boot with windows 8 on two hdds - Dual-boot Windows 7 and Ubuntu on two SSDs with UEFI

    Read the article

  • I made a horrible loop.... help fix my logic please

    - by Webnet
    I know I'm doing this a bad way... but I'm having trouble seeing any alternatives. I have an array of products that I need to select 4 of randomly. $rawUpsellList is an array of all of the possible upsells based off of the items in their cart. Each value is a product object. I know this is horribly ugly code but I don't see an alternative now.... someone please put me out of my misery so this code doesn't make it to production..... $rawUpsellList = array(); foreach ($tru->global->cart->getItemList() as $item) { $product = $item->getProduct(); $rawUpsellList = array_merge($rawUpsellList, $product->getUpsellList()); } $upsellCount = count($rawUpsellList); $showItems = 4; if ($upsellCount < $showItems) { $showItems = $upsellCount; } $maxLoop = 20; $upsellList = array(); for ($x = 0; $x <= $showItems; $x++) { $key = rand(0, $upsellCount); if (!array_key_exists($key, $upsellList) && is_object($rawUpsellList[$key])) { $upsellList[$key] = $rawUpsellList[$key]; $x++; } if ($x == $maxLoop) { break; } } Posting this code was highly embarassing...

    Read the article

  • atk4 advanced crud?

    - by thindery
    I have the following tables: -- ----------------------------------------------------- -- Table `product` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `product` ( `id` INT NOT NULL AUTO_INCREMENT , `productName` VARCHAR(255) NULL , `s7location` VARCHAR(255) NULL , PRIMARY KEY (`id`) ) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `pages` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `pages` ( `id` INT NOT NULL AUTO_INCREMENT , `productID` INT NULL , `pageName` VARCHAR(255) NOT NULL , `isBlank` TINYINT(1) NULL , `pageOrder` INT(11) NULL , `s7page` INT(11) NULL , PRIMARY KEY (`id`) , INDEX `productID` (`productID` ASC) , CONSTRAINT `productID` FOREIGN KEY (`productID` ) REFERENCES `product` (`id` ) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `field` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `field` ( `id` INT NOT NULL AUTO_INCREMENT , `pagesID` INT NULL , `fieldName` VARCHAR(255) NOT NULL , `fieldType` VARCHAR(255) NOT NULL , `fieldDefaultValue` VARCHAR(255) NULL , PRIMARY KEY (`id`) , INDEX `id` (`pagesID` ASC) , CONSTRAINT `pagesID` FOREIGN KEY (`pagesID` ) REFERENCES `pages` (`id` ) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; I have gotten CRUD to work on the 'product' table. //addproduct.php class page_addproduct extends Page { function init(){ parent::init(); $crud=$this->add('CRUD')->setModel('Product'); } } This works. but I need to get it so that when a new product is created it basically allows me to add new rows into the pages and field tables. For example, the products in the tables are a print product(like a greeting card) that has multiple pages to render. Page 1 may have 2 text fields that can be customized, page 2 may have 3 text fields, a slider to define text size, and a drop down list to pick a color, and page 3 may have five text fields that can all be customized. All three pages (and all form elements, 12 in this example) are associated with 1 product. So when I create the product, could i add a button to create a page for that product, then within the page i can add a button to add a new form element field? I'm still somewhat new to this, so my db structure may not be ideal. i'd appreciate any suggestions and feedback! Could someone point me toward some information, tutorials, documentation, ideas, suggestions, on how I can implement this?

    Read the article

  • Database Modelling - Conceptually different entities but with near identical fields

    - by Andrew Shepherd
    Suppose you have two sets of conceptual entities: MarketPriceDataSet which has multiple ForwardPriceEntries PoolPriceForecastDataSet which has multiple PoolPriceForecastEntry Both different child objects have near identical fields: ForwardPriceEntry has MarketPriceDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForwardPrice PoolPriceForecastEntry has PoolPriceForecastDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForecastPoolPrice If I modelled them as separate tables, the only difference would be the foreign key, and the name of the price field. There has been a debate as to whether the two near identical tables should be merged into one. Options I've thought of to model this is: Just keep them as two independent, separate tables Have both sets in the one table with an additional "type" field, and a parent_id equalling a foreign key to either parent table. This would sacrifice referential integrity checks. Have both sets in the one table with an additional "type" field, and create a complicated sequence of joining tables to maintain referential integrity. What do you think I should do, and why?

    Read the article

  • Mysql select - improve performance

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated.

    Read the article

  • Can a partition table be edited from a LiveUSB of another architecture?

    - by Eliran Malka
    My purpose is to re-partition a dual-boot machine (running Ubuntu 13.04 / Windows 7), i.e. the current table is as follows: ----------------------------------------------------------- | | extended partition | | | windows |--------------------------------| recovery | | (NTFS) | swap | filesystem | (NTFS) | | | (swap) | (ext4) | | ----------------------------------------------------------- and I want to create an additional ext4 partition under the extended partition, and mount those (the one I created and the 'filesystem' partition) to root and home (/ and /home), such as the new layout will be: ----------------------------------------------------------- | | extended partition | | | windows |--------------------------------| recovery | | (NTFS) | swap | root | home | (NTFS) | | | (swap) | (ext4) | (ext4) | | ----------------------------------------------------------- As the installations on the system and on my Live USB differ in architecture, I want to know: Is it safe to use a 64bit GParted from a Live USB for partitioning a 32bit installation?

    Read the article

  • PLEASE HELP RECOVER MY MINT14 BOOT/GRUB [closed]

    - by C2940680
    Hi I have following from [bootinfoscript][1] v0.61 [1Apr-2012]: I tried to do several time to do a boot-repair from YannUbuntu. However, I get error rebooting into my Linux Mint 14 Cinnamon. I have partitioned /boot, /, /home partitions. Could I still use /home partition if I recover files on to external USB and then reformatting the whole hard drive, repartition and use /home from USB drive which I have saved before? Also, I tried to install Qubes 2beta and then deleted the partition where it was stored. Also, also {my bad} I tried to copy the BOOT.CFG from sda6 to sda1 and sda2. All answers appreciated in advance. sda1: __________________________________________ File system: ext2 Boot sector type: - Boot sector info: Operating System: Boot files: /grub/grub.cfg sda2: __________________________________________ File system: Extended Partition Boot sector type: - Boot sector info: sda5: __________________________________________ File system: swap Boot sector type: - Boot sector info: sda6: __________________________________________ File system: ext4 Boot sector type: - Boot sector info: Operating System: Linux Mint 14 Nadia Boot files: /boot/grub/grub.cfg /etc/fstab

    Read the article

  • Rewrite SQL Fulltext Function to return Table only

    - by Alex
    I have a MS SQL Fulltext Function like this: (...) RETURNS TABLE AS RETURN SELECT * FROM fishes INNER JOIN CONTAINSTABLE(fishes, *, @keywords, @limit) AS KEY_TBL ON fishes.id = KEY_TBL.[KEY] When I use this function in LINQ, it generates a special return type which includes all fields of my "fishes" table, plus Key and Rank. How could I rewrite above query, or change something in LINQ, to omit Key and Rank and just return my "fishes" results (and to have the fulltext search result objects be of type Fish, which is what I really care about, so I don't have to cast)?

    Read the article

  • How to store date into Mysql database with play framework in scala?

    - by Rahul Kulhari
    I am working with play framework with scala and what am i doing : login page to login into web app sign up page to register into web app after login i want to store all databases values to user what i want to do: when user register for web app then i want to store user values into database with current time and date but my form is giving error. error: List(FormError(dates,error.required,List())),None) controllers/Application.scala object Application extends Controller { val ta:Form[Keyword] = Form( mapping( "id" -> ignored(NotAssigned:Pk[Long]), "word" -> nonEmptyText, "blog" -> nonEmptyText, "cat" -> nonEmptyText, "score"-> of[Long], "summaryId"-> nonEmptyText, "dates" -> date("yyyy-MM-dd HH:mm:ss") )(Keyword.apply)(Keyword.unapply) ) def index = Action { Ok(html.index(ta)); } def newTask= Action { implicit request => ta.bindFromRequest.fold( errors => {println(errors) BadRequest(html.index(errors))}, keywo => { Keyword.create(keywo) Ok(views.html.data(Keyword.all())) } ) } models/keyword.scala case class Keyword(id: Pk[Long],word: String,blog: String,cat: String,score: Long, summaryId: String,dates: Date ) object Keyword { val keyw = { get[Pk[Long]]("keyword.id") ~ get[String]("keyword.word")~ get[String]("keyword.blog")~ get[String]("keyword.cat")~ get[Long]("keyword.score") ~ get[String]("keyword.summaryId")~ get[Date]("keyword.dates") map { case id~blog~cat~word~score~summaryId~dates => Keyword(id,word,blog,cat,score, summaryId,dates) } } def all(): List[Keyword] = DB.withConnection { implicit c => SQL("select * from keyword").as(Keyword.keyw *) } def create(key: Keyword){DB.withConnection{implicit c=> SQL("insert into keyword values({word},{blog}, {cat}, {score},{summaryId},{dates})").on('word-> key.word,'blog->key.blog, 'cat -> key.cat, 'score-> key.score, 'summaryId -> key.summaryId, 'dates->new Date()).executeUpdate } } views/index.scala.html @(taskForm: Form[Keyword]) @import helper._ @main("Todo list") { @form(routes.Application.newTask) { @inputText(taskForm("word")) @inputText(taskForm("blog")) @inputText(taskForm("cat")) @inputText(taskForm("score")) @inputText(taskForm("summaryId")) <input type="submit"> <a href="">Go Back</a> } } please give me some idea to store date into mysql databse and date is not a field of form

    Read the article

  • Disable Internet Explorer 8 Developer Tools

    - by Steve Brouillard
    Is there a way to either disable Internet Explorer 8 Developer Tools, or at least change the shortcut key mapping? I'm working on an ASP.NET AJAX app that has used the F12 key for a function for years (it's actually a hold over from the original DOS app). Customers have used this key for the sam function for nearly 15 years and we'd really like to avoid having to move that function. Cheers

    Read the article

  • rsync not working between NTFS/FAT and EXT

    - by wim
    I have music that I play in my car, from an FAT32 USB stick. The folder which I use to put songs on is stored on my EXT4 hard drive. I add/remove/retag songs regularly and occassionally want to rsync the changes to the USB stick. But for some unknown reason (maybe permissions?), rsync copies all the files every time rather than just changed ones. I am calling rsync like : rsync -vrlptgD source dest How can I make it work like I want it to (i.e. know when a file hasn't been changed and don't copy it)?

    Read the article

  • mozilla browser hot keys? [closed]

    - by Roger22
    Hello, Where can i find the key combinations for some actions, in Mozilla Firefox? For example, Ctrl+L moves the cursor to the address bar. I wanna move the cursor in the Google search box, from the right-top position). Which key is associated with this? And some other key combinations? Thanks!

    Read the article

  • how to change string values in dictionary to int values

    - by tom smith
    I have a dictionary such as: {'Sun': {'Satellites': 'Mercury,Venus,Earth,Mars,Jupiter,Saturn,Uranus,Neptune,Ceres,Pluto,Haumea,Makemake,Eris', 'Orbital Radius': '0', 'Object': 'Sun', 'RootObject': 'Sun', 'Radius': '20890260'}, 'Earth': {'Period': '365.256363004', 'Satellites': 'Moon', 'Orbital Radius': '77098290', 'Radius': '63710.41000.0', 'Object': 'Earth'}, 'Moon': {'Period': '27.321582', 'Orbital Radius': '18128500', 'Radius': '1737000.10', 'Object': 'Moon'}} I am wondering how to change just the number values to ints instead of strings. def read_next_object(file): obj = {} for line in file: if not line.strip(): continue line = line.strip() key, val = line.split(": ") if key in obj and key == "Object": yield obj obj = {} obj[key] = val yield obj planets = {} with open( "smallsolar.txt", 'r') as f: for obj in read_next_object(f): planets[obj["Object"]] = obj print(planets)

    Read the article

  • Dynamically removing records when certain columns = 0; data cleansing

    - by cdburgess
    I have a simple card table: CREATE TABLE `users_individual_cards` ( `id` int(11) NOT NULL AUTO_INCREMENT, `user_id` char(36) NOT NULL, `individual_card_id` int(11) NOT NULL, `own` int(10) unsigned NOT NULL, `want` int(10) unsigned NOT NULL, `trade` int(10) unsigned NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `user_id` (`user_id`,`individual_card_id`), KEY `user_id_2` (`user_id`), KEY `individual_card_id` (`individual_card_id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1; I have ajax to add and remove the records based on OWN, WANT, and TRADE. However, if the user removes all of the OWN, WANT, and TRADE cards, they go to zero but it will leave the record in the database. I would prefer to have the record removed. Is checking after each "update" to see if all the columns = 0 the only way to do this? Or can I set a conditional trigger with something like: //psuedo sql AFTER update IF (OWN = 0, WANT = 0, TRADE = 0) DELETE What is the best way to do this? Can you help with the syntax?

    Read the article

  • No me arranca ubuntu 12.04

    - by MAgnum
    Buenos Dias, Tengo un Notebook Intel(R) Atom(TM) CPU N270 1.60GHz Version de la BIOS Intel V1585, tenia un sistema operativo de windows xp e intente instalar ubunto 12.04 por medio de live USB debido a que no tengo la adaptación de CD segui todos los pasos y le di instalar completamente formateando el sistema anterior, terminando la instalacion me salio un problema que no encontraba el sistema de arranque o algo asi el hecho es que me salia algo de SDA donde aparecia el modelo del HDD y como es Hitachi HTS543212L9A300 le di en esa y le di finalizar, pero al reiniciar cuando debe iniciar el sistema operativo se queda en negro y no carga nada =S he intentado volver a arrancar la usb pero no me deja hacer nada se me traba =S. soy principiante en este sistema operativo y quiera saber que solución me pueden decir para sacarme de este embrollo. tampoco me sale nada despues de usar ctrl+alt+F1 =S... Muchas gracias al alma caritativa que me quiera asesorar =D...

    Read the article

  • Dual Booting Windows 8 and Ubuntu 12.10 - thinkpad x230

    - by user110703
    I am having problems getting grub to load Windows 8 properly after installing Ubuntu 12.10 and Windows 8 on a solid state drive. Here's what I did: Fresh install of Windows 8 using USB recovery drive (partitioned SSD for UEFI) -- Tested windows install and it worked fine Built bootable USB with Ubuntu 12.10 64bit and installed Ubuntu -- Used Ubuntu's installer to partition the Windows 8 partition and install there Reboot - try to load windows 8 from grub -- Ubuntu loads correctly; windows load reports various problems with permissions and not being able to find files - I'll update what the actual errors are Tried to fix the boot problem using boot-repair: -- here's the output: http://paste.ubuntu.com/1384522/ So, this is my first time trying to setup a dual boot system and I think that UEFI is the main culprit in getting this to work correctly. What do I need to

    Read the article

  • Best way to model map values in Grails?

    - by Mulone
    Hi guys, I have to implement map values in my Grails app. I have a class that can contain 0..N OsmTags, and the key is unique. In Java I would model this with a Map in each object, but I don't know how to map classes in Grails. So I defined this class: class OsmTag { /** OSM tag name, e.g. natural */ String key /** OSM tag value, e.g. park */ String value static constraints = { key blank:false, size:2..80,matches:/[\S]+/, unique:false value blank:false, size:1..250,matches:/[\S]+/, unique:false } } That works ok, but it's actually quite ugly because the tag key is not unique. Is there a better way to model this issue? Cheers

    Read the article

  • MySQL access classes in PHP

    - by Mike
    I have a connection class for MySQL that looks like this: class MySQLConnect { private $connection; private static $instances = 0; function __construct() { if(MySQLConnect::$instances == 0) { //Connect to MySQL server $this->connection = mysql_connect(MySQLConfig::HOST, MySQLConfig::USER, MySQLConfig::PASS) or die("Error: Unable to connect to the MySQL Server."); MySQLConnect::$instances = 1; } else { $msg = "Close the existing instance of the MySQLConnector class."; die($msg); } } public function singleQuery($query, $databasename) { mysql_select_db(MySQLConfig::DB, $this->connection) or die("Error: Could not select database " . MySQLConfig::DB . " from the server."); $result = mysql_query($query) or die('Query failed.'); return $result; } public function createResultSet($query, $databasename) { $rs = new MySQLResultSet($query, MySQLConfig::DB, $this->connection ) ; return $rs; } public function close() { MySQLConnect::$instances = 0; if(isset($this->connection) ) { mysql_close($this->connection) ; unset($this->connection) ; } } public function __destruct() { $this->close(); } } The MySQLResultSet class looks like this: class MySQLResultSet implements Iterator { private $query; private $databasename; private $connection; private $result; private $currentRow; private $key = 0; private $valid; public function __construct($query, $databasename, $connection) { $this->query = $query; //Select the database $selectedDatabase = mysql_select_db($databasename, $connection) or die("Error: Could not select database " . $this->dbname . " from the server."); $this->result = mysql_query($this->query) or die('Query failed.'); $this->rewind(); } public function getResult() { return $this->result; } // public function getRow() // { // return mysql_fetch_row($this->result); // } public function getNumberRows() { return mysql_num_rows($this->result); } //current() returns the current row public function current() { return $this->currentRow; } //key() returns the current index public function key() { return $this->key; } //next() moves forward one index public function next() { if($this->currentRow = mysql_fetch_array($this->result) ) { $this->valid = true; $this->key++; }else{ $this->valid = false; } } //rewind() moves to the starting index public function rewind() { $this->key = 0; if(mysql_num_rows($this->result) > 0) { if(mysql_data_seek($this->result, 0) ) { $this->valid = true; $this->key = 0; $this->currentRow = mysql_fetch_array($this->result); } } else { $this->valid = false; } } //valid returns 1 if the current position is a valid array index //and 0 if it is not valid public function valid() { return $this->valid; } } The following class is an example of how I am accessing the database: class ImageCount { public function getCount() { $mysqlConnector = new MySQLConnect(); $query = "SELECT * FROM images;"; $resultSet = $mysqlConnector->createResultSet($query, MySQLConfig::DB); $mysqlConnector->close(); return $resultSet->getNumberRows(); } } I use the ImageCount class like this: if(!ImageCount::getCount()) { //Do something } Question: Is this an okay way to access the database? Could anybody recommend an alternative method if it is bad? Thank-you.

    Read the article

  • How can I boot into Windows from GRUB rescue WITHOUT CD drive?

    - by user103968
    I took this from another website's string where i found no good answer This is my situation: installed Ubuntu without a CD (using A USB) dual boot installation (Windows 7+Ubuntu) didn't like the installation and decided to boot into Windows and delete the Linux partitions forgot to fix the mbr from within Windows Now, when I boot, I am stuck in the GRUB rescue limbo. Simple question: How can I boot into Windows from GRUB rescue? I cannot boot from CD because I don't have a CD drive, therefore the usual solutions (recovery CD etc) do not work. Any hints? Is there a way i can maybe do this through a USB? Thanks

    Read the article

< Previous Page | 282 283 284 285 286 287 288 289 290 291 292 293  | Next Page >