Search Results

Search found 44763 results on 1791 pages for 'first responder'.

Page 290/1791 | < Previous Page | 286 287 288 289 290 291 292 293 294 295 296 297  | Next Page >

  • Why is it when I set "closeOnEscape" to false and then "closeOnEscape" to true jquery dialog escape

    - by chobo2
    Hi I am using jquery ui 1.8 and I have a model dialog that popups up and if a user clicks on a checkbox another one comes up. This requires them to say "yes" or "no" so I removed the "X" on the dialog and put closeOnEscape to false. However I noticed when I did that the model dialog underneath it would close when they hit escape. So now when the one that pops up when the checkbox is checked I disable closeOnEscape on the first dialog box. When they close it I enable again yet it does not work. I am not sure why $("#Dialog").dialog( "option", "closeOnEscape", true); I even do this in firebug. I just open my first dialog up Do this in firebugs console $("#Dialog").dialog( "option", "closeOnEscape", false); Then verify that escape is now disabled. I then try to enable it again $("#Dialog").dialog( "option", "closeOnEscape", true); Yet it never enables.

    Read the article

  • Can I have different name and id attributes on a form element?

    - by ewitkows
    Hi all, I have a web form with usual elements (first name, last name, etc). The Postback URL is a different website altogether as the form is intented to post lead information to another website. The site that accepts the lead is expecting First Name to come over as "FName", and Last Name to come over as "LName". Is there any way I can set the ID of a textbox to "txtFName", but submit it over the wire as "FName"? I tried changing the name attribute, but at runtime it sets the name = id.

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • How to change the position of the Horizontal line dynamically ?

    - by Hari
    I am making asp.net website. In that there is a link button (named Landline number).Below that there are three textboxes. And after that there is one horizontal line. Now at a first time only link button and horizontal will be visible, and textboxes which is bellowed to link button will not be visible. Now if user will click on the link button then textboxes which is bellowed to link button will be visible. Then horizontal line which is at the first time bellowed to the link button should be adjust to its location and should go after textboxes. And if user clicks to link button again then textboxes should be visible false. And horizontal line should be displayed its original position that is bellowed to the link button. Of course I am able to do with visibility of textboxes but I can not understand how to change the position of the horizontal line dynamically?

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • (conditional) Multiple Event Handlers C#

    - by gjk
    A portion of my program requires a "flag" retrieval, that is I am fetching a value that is either True or False, and based on this return value two things could follow. 1) The flag is true, aka "go ahead", and I retrieve data from a database. 2) The flag is false, and I want to prevent the data from being retrieved. Now, this check has to be performed before any function that would call upon the database in question. I decided to implement this check in the form of an event handler attached to GUI objects that would trigger this data inquiry. This check event handler is called first upon necessary events, and my question is: How do I stop subsequent event handlers from firing if the FIRST event handler (my flag checker) comes up FALSE? Thanks

    Read the article

  • ontouch - Switching positions of two views(images) in Android

    - by idish
    I've been looking for that 2 days long and haven't found anything related to it. I'll give an example for my goal. Let's say I have 2 images positioned side by side horizontally. I want the user to be able to switch their positions onlongtouch listener. so let's say that the first image was on the left and the second was on the right side, after switching positions between them, the first image would be in the right and the second would be on the left side. Basically, it is just like in the launcher where you can switch apps positions. Please, if anything is not clear for you, I would like to know, and I'll try to explain it better, thank you.

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • null pointer exception in textview of setcontent

    - by kitokid
    I am getting the java.lang.NullPointerException on createTabContent for the following code. There are two tabspecs. When I called and set the tab , changed the tabs for the first time it is ok. But when i called again while I am on the second tab, its hit the null pointer exception for line : NoStudentText.setVisibility(View.VISIBLE); I will show No Student Text if there is no data for the student list. It shows the text for the first time call. But If I do second time call to that tab, got the error. tspecStudent.setContent(new TabContentFactory() { public View createTabContent(String arg0) { if(listStudent != null && listStudent .size() > 0) { //show the student list } else { TextView noStudentText = (TextView)findViewById(R.id.NoStudentText); noStudentText.setVisibility(View.VISIBLE); return noStudentText; } } });

    Read the article

  • jQuery Load MySQL Fetch Array

    - by Robert Hanson
    I'm a beginner in jQuery area and I have simple question like this : I want to load (AJAX) MySQL result in array, let's say : $row[0] = first name $row[1] = last name $row[2] = phone number I have no problem with PHP part, but I have difficulties to display each of that array content on different id. because syntax I found loads everything processed by PHP : <script type="text/javascript"> $(document).ready(function(){ $('#mysql-result').load('ajax.php'); }); </script> how to get 'First Name', 'Last Name' and 'Phone Number' from PHP with only one time load and still I can put the result in different . thank you.

    Read the article

  • xsl:variable xsl:copy-of select

    - by user1901345
    I have the following XML: Picture 1 Picture 2 Picture 3 While this XSL does what is expected (output the attr of the first picture): It seems to be not possible to do the same inside the variable declaration using xsl:copy-of: Curious: If I just select "$FirstPicture" instead of "$FirstPicture/@attr" in the second example, it outputs the text node of Picture 1 as expected... Before you all suggest me to rewrite the code: This is just a simplified test, my real aim is to use a named template to select a node into the variable FirstPicture and reuse it for further selections. I hope someone could help me to understand the behavior or could suggest me a proper way to select a node with code which could be easily reused (the decission which node is the first one is complex in my real application). Thanks.

    Read the article

  • Shall I optimize or let compiler to do that?

    - by Knowing me knowing you
    What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • How do customize the g:sortableColumn?

    - by kakaotalk
    Well, I have one column in my list that I need to customize, the thing is grails' own g:sortable doesn't work. For instance, my first column shows employee ids, then my second column, shows the employees full name where full name is a combination of first name and last name. I got it to work, sorting and all, but when I try to place it in a table with g:sortable, the g:sortable just wouldn't work. I'm thinking about passing params around but it's a bit tricky. Any suggestions? I've looked around the internet, and seems like nothing. :\

    Read the article

  • JQuery within a partial view not being called

    - by XN16
    I have a view that has some jQuery to load a partial view (via a button click) into a div in the view. This works without a problem. However within the partial view I have a very similar bit of jQuery that will load another partial view into a div in the first partial view, but this isn't working, it almost seems like the jQuery in the first partial view isn't being loaded. I have tried searching for solutions, but I haven't managed to find an answer. I have also re-created the jQuery function in a @Ajax.ActionLink which works fine, however I am trying to avoid the Microsoft helpers as I am trying to learn jQuery. Here is the first partial view which contains the jQuery that doesn't seem to work, it also contains the @Ajax.ActionLink that does work: @model MyProject.ViewModels.AddressIndexViewModel <script> $(".viewContacts").click(function () { $.ajax({ url: '@Url.Action("CustomerAddressContacts", "Customer")', type: 'POST', data: { addressID: $(this).attr('data-addressid') }, cache: false, success: function (result) { $("#customerAddressContactsPartial-" + $(this).attr('data-addressid')) .html(result); }, error: function () { alert("error"); } }); return false; }); </script> <table class="customers" style="width: 100%"> <tr> <th style="width: 25%"> Name </th> <th style="width: 25%"> Actions </th> </tr> </table> @foreach (Address item in Model.Addresses) { <table style="width: 100%; border-top: none"> <tr id="[email protected]"> <td style="width: 25%; border-top: none"> @Html.DisplayFor(modelItem => item.Name) </td> <td style="width: 25%; border-top: none"> <a href="#" class="viewContacts standardbutton" data-addressid="@item.AddressID">ContactsJQ</a> @Ajax.ActionLink("Contacts", "CustomerAddressContacts", "Customer", new { addressID = item.AddressID }, new AjaxOptions { UpdateTargetId = "customerAddressContactsPartial-" + @item.AddressID, HttpMethod = "POST" }, new { @class = "standardbutton"}) </td> </tr> </table> <div id="[email protected]"></div> } If someone could explain what I am doing wrong here and how to fix it then I would be very grateful. Thanks very much.

    Read the article

  • Strange Locking Behaviour in SQL Server 2005

    - by SQL Learner
    Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

    Read the article

  • JDBC Pagination

    - by Zeeshan
    Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

    Read the article

  • How to deal with delegate method calling back the object who send the message ?

    - by olipion
    I have two object: @protocol ObjectADelegate - (void)objectAfirst:(ObjectA *)obj; - (void)objectAsecond:(ObjectA *)obj; @end @interface ObjectA : NSObject { id<ObjectADelegate> delegate; - (void)callSecond { [self.delegate objectAsecond:self]; } @end @interface ObjectB : NSObject <ObjectADelegate>{ ObjectA *myObjectA; } @implementation ObjectB - (void)objectAfirst:(ObjectA *)obj { // First is finished, do second [obj callSecond]; } - (void)objectASecond:(ObjectA *)obj { // Do my stuff } @end As you can see in the code, when ObjectA send the message objectAfirst to its delegate, objectb use again objectA methods that result in objecta calling back objectb. It means that what first fire objectAfirst is not finished but objectA send the objectAsecond message. Could it be a problem ? Any way to let delay message handling in objectB ? for example, something like using [obj performSelector:@selector(callSecond) afterDelay:0.01]; instead of [obj callSecond]; ?

    Read the article

< Previous Page | 286 287 288 289 290 291 292 293 294 295 296 297  | Next Page >