Search Results

Search found 18702 results on 749 pages for 'digital input'.

Page 296/749 | < Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >

  • Passing Values from a View to itself with parameters getting null values ?

    - by vsj
    Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

    Read the article

  • simple GET validation

    - by Andrew
    I have GET[] input and would like to carry out their validation. The input data is always a number by. Schema. I want to make sure that the pass number and the appropriate amount - not to throw the sql query. at this moment I am using the procedures $cc = $_GET['cc']; if ($cc=='') $cc='9012';$find=array("..", "/", "\\"); $replace=array("", "", ""); $cc=str_replace($find, $replace, $cc); $eic = $_GET['eic']; .... ect. // where f.ex. 9012 is an real existing data (in dbase) to generate sucure sql question GET[] variable data schema $_GET[$cc] - always 4 digits $_GET[$eic] - always 4 digits $_GET[$iy] - always 4 digits $_GET[$ir] - always 1 digit Can you show me a better way to secure my GET?

    Read the article

  • JavaScript: Can I declare a variable by querying which function is called? (Newbie)

    - by belle3WA
    I'm working with an existing JavaScript-powered cart module that I am trying to modify. I do not know JS and for various reasons need to work with what is already in place. The text that appears for my quantity box is defined within an existing function: function writeitems() { var i; for (i=0; i<items.length; i++) { var item=items[i]; var placeholder=document.getElementById("itembuttons" + i); var s="<p>"; // options, if any if (item.options) { s=s+"<select id='options"+i+"'>"; var j; for (j=0; j<item.options.length; j++) { s=s+"<option value='"+item.options[j].name+"'>"+item.options[j].name+"</option>"; } s=s+"</select>&nbsp;&nbsp;&nbsp;"; } // add to cart s=s+method+"Quantity: <input id='quantity"+i+"' value='1' size='3'/> "; s=s+"<input type='submit' value='Add to Cart' onclick='addtocart("+i+"); return false;'/></p>"; } placeholder.innerHTML=s; } refreshcart(false); } I have two different types of quantity input boxes; one (donations) needs to be prefaced with a dollar sign, and one (items) should be blank. I've taken the existing additem function, copied it, and renamed it so that there are two identical functions, one for items and one for donations. The additem function is below: function additem(name,cost,quantityincrement) { if (!quantityincrement) quantityincrement=1; var index=items.length; items[index]=new Object; items[index].name=name; items[index].cost=cost; items[index].quantityincrement=quantityincrement; document.write("<span id='itembuttons" + index + "'></span>"); return index; } Is there a way to declare a global variable based on which function (additem or adddonation) is called so that I can add that into the writeitems function so display or hide the dollar sign as needed? Or is there a better solution? I can't use HTML in the body of the cart page because of the way it is currently coded, so I'm depending on the JS to take care of it. Any help for a newbie is welcome. Thanks!

    Read the article

  • two scp and ssh processes with single authentication

    - by Tomek Wyderka
    I need to scp and then ssh to the same host. Is it possible to authenticate just one time? Is it possible to input password once, then scp file, then ssh on that host and work interactively? Update I get HOSTNAME and SSH_PASSWORD. I never log in on that machine before. I need to send some files (probably using scp) and then log in using ssh and work on that HOST interactively. I want to save time and input password just once. I have lots of such hosts...

    Read the article

  • Python: How to use code.InteractiveConsole?

    - by Rosarch
    I'm trying to use InteractiveConsole to create a new front-end for a Python interpreter. These code fragments are from me playing around with InteractiveConsole in IDLE: >>> ses = code.InteractiveConsole() >>> ses.runsource("def foo():") True >>> ses.runsource(" return 2") File "<input>", line 1 SyntaxError: 'return' outside function (<input>, line 1) False Why does it raise a syntax error? How else can I finish writing the function? Also, for something like this: >>> ses.runsource("x = 1") False >>> ses.runsource("x") 1 False How can I capture the 1 value from above? False is the return value, but 1 is written to some stream.

    Read the article

  • Why is Drupal writing to root and not sites/default/files?

    - by Candland
    I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • php random image file name

    - by bush man
    Okay im using a snippet I found on google to take a users uploaded image and put it in my directory under Content But Im worried about duplicates so I was going have it upload the image as a Random number well here is my code you can probably understand what im going for through it anyways <label for="file">Profile Pic:</label> <input type="file" name="ProfilePic" id="ProfilePic" /><br /> <input type="submit" name="submit" value="Submit" /> $ProfilePicName = $_FILES["ProfilePic"]["name"]; $ProfilePicType = $_FILES["ProfilePic"]["type"]; $ProfilePicSize = $_FILES["ProfilePic"]["size"]; $ProfilePicTemp = $_FILES["ProfilePic"]["tmp_name"]; $ProfilePicError = $_FILES["ProfilePic"]["error"]; $RandomAccountNumber = mt_rand(1, 99999); echo $RandomAccountNumber; move_uploaded_file($ProfilePicTemp, "Content/".$RandomAccountNumber.$ProfilePicType); And then basicly after all this Im going try to get it to put that random number in my database

    Read the article

  • inputMismatchException Java reading doubles from plain text file

    - by user939287
    Using double variable = inputFile.nextDouble(); Gives the mismatch error and I can't figure out why... Anyone know what's up? The input file is just a bunch of doubles like 5.0... Okay here is the code snippet String fileName; Scanner scanner = new Scanner(System.in); System.out.println("\nEnter file name that contains the matrix and vector: "); fileName = scanner.nextLine(); Scanner inputFile = new Scanner(fileName); double a1 = inputFile.nextDouble(); the input file is a plain text document .txt in this format 5.0 4.0 -3.0 4.0 2.0 5.0 6.0 5.0 -2.0 -13.0 4.0 12.0 I don't understand why it wouldn't take those as doubles... As far as what its expecting the format of the file to be... I suppose binary? isn't that the default? I didn't specify in the code...

    Read the article

  • How to empty a socket in python?

    - by luc
    I need to empty the data on a socket (making sure that there is nothing to receive). Unfortunately, there is no function for this in the python socket module. I've implemented something this way: def empty_socket(sock): """remove the data present on the socket""" input = [sock] while 1: inputready, o, e = select.select(input,[],[], 0.0) if len(inputready)==0: break for s in inputready: s.recv(1) What do you think? Is there a better way to do that? Update: I don't want to change the socket timeout. What's why i prefer a select to a read. Update: The original question was using the 'flush' term. It seems that 'empty' is a better term. Update - 2010-02-27 : I've noticed a bug after when the pair has closed. The inputready is always filled with the sockets. I fixed that by adding a maximum number of loops. Is there a better fix?

    Read the article

  • Getting the dynamic value of a checkbox in repeating region loop with Jquery

    - by John
    How do I get the values of a check box that is in a repeating region with its values dynamically generated from a recordset from the database.I want to retrieve the value when it is checked and after I click on a link.The problem is that it is retrieving only the first value of the recordset which is 1.This is the code: //jQuery $(document).ready(function(){ $("#clickbtn").click(function(){ $("input[type=checkbox][checked]").each(function(){ var value=$("#checkid").attr('value'); $("#textfield").attr('value',value); }); return false; }); }); //html <td width="22"><form id="form1" name="form1" method="post" action=""> <input type="checkbox" name="checkid" id="checkid" value="<?php echo $row_people['NameID']; ?>" /> </form></td> I would appreciate the help.

    Read the article

  • Problem with Initializing Consts

    - by UdiM
    This code, when compiled in xlC 8.0 (on AIX 6.1), produces the wrong result. It should print 12345, but instead prints 804399880. Removing the const in front of result makes the code work correctly. Where is the bug? #include <stdio.h> #include <stdlib.h> #include <string> long int foo(std::string input) { return strtol(input.c_str(), NULL, 0); } void bar() { const long int result = foo("12345"); printf("%u\n", result); } int main() { bar(); return 0; } Compilation command: /usr/vacpp/bin/xlC example.cpp -g

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • Scanner class is skipping lines

    - by user2403304
    I'm new to programing and I'm having a problem with my scanner class. This code is in a loop and when the loop comes around the second, third whatever time I have it set to it skips the first title input. I need help please why is it skipping my title scanner input in the beginning? System.out.println("Title:"); list[i].title=keyboard.nextLine(); System.out.println("Author:"); list[i].author=keyboard.nextLine(); System.out.println("Album:"); list[i].album=keyboard.nextLine(); System.out.println("Filename:"); list[i].filename=keyboard.nextLine();

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • finding the value of radio button with jquery

    - by oo
    i have this code below to show different divs when i choose certain radio buttons: if ($("input[@name='exerciseRB']:checked").val() == 'New') { $("#newExercise").show(); $("#existingExercise").hide(); } else { $("#newExercise").hide(); $("#existingExercise").show(); } at first, i just had two radio buttons (both named exerciseRB and everything works fine. Now, later in my web page i added two new radio buttons (with the name lessonRB). The issue is that once i added these other new radio buttons when i look up this in firebug: $("input[@name='exerciseRB']:checked") i actually get an array back with both the exerciseRB item as well as the lessonRB item. Its almost as if the @name='exerciseRB' is being ignored. any ideas here?

    Read the article

  • how to use OR in jquery

    - by user1493339
    1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

    Read the article

  • removeClass doesn't work on the second DIV tag

    - by kwokwai
    Hi all, I am learning JQuery and writing a simple data validation for the two fields in a HTML form: <FORM name="addpost" id="addpost" method="post" action="/add"> <TABLE BORDER=0 width="100%"> <TR> <TD>Topic</TD> <TD> <DIV ID="topic"> <INPUT type=text name="topic" id="topic" size="72" maxlength="108"/> </DIV> </TD> </TR> <TR> <TD>Comments</TD> <TD> <DIV ID="topiccontent"> <TEXTAREA rows="12" cols="48" name="content" ID="content"> </TEXTAREA> </DIV> </TD> </TR> <TR> <TD> <INPUT type="submit" value="Send"> </TD> </TR> </TABLE> </FORM> Here is the JQuery script for checking the data input from the form above: $('#addpost').submit(function(){ if($('#topic').val()==""){ $('#topic').addClass('hierror'); return false;} else{$('#topic').removeClass('hierror');} if($('#topiccontent').val()==""){ $('#topiccontent').addClass('hierror'); return false;} else{$('#topiccontent').removeClass('hierror');} }); Here is the CSS for the hierror class: .hierror{border-style:solid; border-width:12px; border-color:#FF0000;} ('#topic').removeClass('hierror') works but ('#topiccontent').removeClass('hierror') doesn't. Could you help me please?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Color getAlpha() not working as intended

    - by Arvy
    I was making a program where I load an image and after that I do something with opaque pixels. Transparent pixels showed up as black pixels, but after some time I found the cause: Color c = new Color (input.getRGB(x, y)); Works-> if ((input.getRGB(x, y) & 0xFF000000) != 0x00000000) { do_smth();} Returns true at all times-> if (c.getAlpha() != 0) { do_smth(); } So why it does not work?

    Read the article

  • PHP setcookie warning

    - by Ranking
    Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

    Read the article

  • JComboBox to string

    - by gabrielle fregil
    I have a String array of names, and then I added it into an editable JComboBox. The user can either pick his/her name from the choices or just input his/her name if not in the choices. How do I put the user input into a new string variable? String [] chooseName = { Mark, John, Allison, Jessica }; JComboBox combo = new JComboBox (chooseName); combo.setEditable(true); String chosenName = /* how do i place what the user inputed here? */

    Read the article

< Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >