Search Results

Search found 18702 results on 749 pages for 'digital input'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 296/749 | < Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • Firefox Back Button is occaisionally breaking the back button.

    - by Webjedi
    Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

    Read the article

  • program to determine number of duplicates in a sentence

    - by bhavna raghuvanshi
    public class duplicate { public static void main(String[] args)throws IOException { System.out.println("Enter words separated by spaces ('.' to quit):"); Set<String> s = new HashSet<String>(); Scanner input = new Scanner(System.in); while (true) { String token = input.next(); if (".".equals(token)) break; if (!s.add(token)) System.out.println("Duplicate detected: " + token); } System.out.println(s.size() + " distinct words:\n" + s); } } my program detects and prints duplicate words but i need to print the number of duplicate words also. pls help me do it.

    Read the article

  • php random image file name

    - by bush man
    Okay im using a snippet I found on google to take a users uploaded image and put it in my directory under Content But Im worried about duplicates so I was going have it upload the image as a Random number well here is my code you can probably understand what im going for through it anyways <label for="file">Profile Pic:</label> <input type="file" name="ProfilePic" id="ProfilePic" /><br /> <input type="submit" name="submit" value="Submit" /> $ProfilePicName = $_FILES["ProfilePic"]["name"]; $ProfilePicType = $_FILES["ProfilePic"]["type"]; $ProfilePicSize = $_FILES["ProfilePic"]["size"]; $ProfilePicTemp = $_FILES["ProfilePic"]["tmp_name"]; $ProfilePicError = $_FILES["ProfilePic"]["error"]; $RandomAccountNumber = mt_rand(1, 99999); echo $RandomAccountNumber; move_uploaded_file($ProfilePicTemp, "Content/".$RandomAccountNumber.$ProfilePicType); And then basicly after all this Im going try to get it to put that random number in my database

    Read the article

  • <button type="submit"> compatibility?

    - by Mark
    I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • Passing Values from a View to itself with parameters getting null values ?

    - by vsj
    Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

    Read the article

  • inputMismatchException Java reading doubles from plain text file

    - by user939287
    Using double variable = inputFile.nextDouble(); Gives the mismatch error and I can't figure out why... Anyone know what's up? The input file is just a bunch of doubles like 5.0... Okay here is the code snippet String fileName; Scanner scanner = new Scanner(System.in); System.out.println("\nEnter file name that contains the matrix and vector: "); fileName = scanner.nextLine(); Scanner inputFile = new Scanner(fileName); double a1 = inputFile.nextDouble(); the input file is a plain text document .txt in this format 5.0 4.0 -3.0 4.0 2.0 5.0 6.0 5.0 -2.0 -13.0 4.0 12.0 I don't understand why it wouldn't take those as doubles... As far as what its expecting the format of the file to be... I suppose binary? isn't that the default? I didn't specify in the code...

    Read the article

  • Problem with Initializing Consts

    - by UdiM
    This code, when compiled in xlC 8.0 (on AIX 6.1), produces the wrong result. It should print 12345, but instead prints 804399880. Removing the const in front of result makes the code work correctly. Where is the bug? #include <stdio.h> #include <stdlib.h> #include <string> long int foo(std::string input) { return strtol(input.c_str(), NULL, 0); } void bar() { const long int result = foo("12345"); printf("%u\n", result); } int main() { bar(); return 0; } Compilation command: /usr/vacpp/bin/xlC example.cpp -g

    Read the article

  • Couldn't match expected type - Haskell Code

    - by wvyar
    I'm trying to learn Haskell, but the small bit of sample code I tried to write is running into a fairly large amount of "Couldn't match expected type" errors. Can anyone give me some guidance as to what I'm doing wrong/how I should go about this? These are the errors, but I'm not really sure how I should be writing my code. toDoSchedulerSimple.hs:6:14: Couldn't match expected type `[t0]' with actual type `IO String' In the return type of a call of `readFile' In a stmt of a 'do' block: f <- readFile inFile In the expression: do { f <- readFile inFile; lines f } toDoSchedulerSimple.hs:27:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter task name: " In the expression: do { putStr "Enter task name: "; task <- getLine; return inFileArray : task } toDoSchedulerSimple.hs:34:9: Couldn't match expected type `IO ()' with actual type `[a0]' In a stmt of a 'do' block: putStrLn "Your task is: " ++ (inFileArray !! i) In the expression: do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } In an equation for `getTask': getTask inFileArray = do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } toDoSchedulerSimple.hs:41:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter the task you would like to end: " In the expression: do { putStr "Enter the task you would like to end: "; task <- getLine; filter (endTaskCheck task) inFileArray } toDoSchedulerSimple.hs:60:53: Couldn't match expected type `IO ()' with actual type `[String] -> IO ()' In a stmt of a 'do' block: schedulerSimpleMain In the expression: do { (getTask inFileArray); schedulerSimpleMain } In a case alternative: "get-task" -> do { (getTask inFileArray); schedulerSimpleMain } This is the code itself. I think it's fairly straightforward, but the idea is to run a loop, take input, and perform actions based off of it by calling other functions. import System.Random (randomRIO) import Data.List (lines) initializeFile :: [char] -> [String] initializeFile inFile = do f <- readFile inFile let parsedFile = lines f return parsedFile displayHelp :: IO() displayHelp = do putStrLn "Welcome to To Do Scheduler Simple, written in Haskell." putStrLn "Here are some commands you might find useful:" putStrLn " 'help' : Display this menu." putStrLn " 'quit' : Exit the program." putStrLn " 'new-task' : Create a new task." putStrLn " 'get-task' : Randomly select a task." putStrLn " 'end-task' : Mark a task as finished." putStrLn " 'view-tasks' : View all of your tasks." quit :: IO() quit = do putStrLn "We're very sad to see you go...:(" putStrLn "Come back soon!" createTask :: [String] -> [String] createTask inFileArray = do putStr "Enter task name: " task <- getLine return inFileArray:task getTask :: [String] -> IO() getTask inFileArray = do i <- randomRIO (0, (length inFileArray - 1)) putStrLn "Your task is: " ++ (inFileArray !! i) endTaskCheck :: String -> String -> Bool endTaskCheck str1 str2 = str1 /= str2 endTask :: [String] -> [String] endTask inFileArray = do putStr "Enter the task you would like to end: " task <- getLine return filter (endTaskCheck task) inFileArray viewTasks :: [String] -> IO() viewTasks inFileArray = case inFileArray of [] -> do putStrLn "\nEnd of tasks." _ -> do putStrLn (head inFileArray) viewTasks (tail inFileArray) schedulerSimpleMain :: [String] -> IO() schedulerSimpleMain inFileArray = do putStr "SchedulerSimple> " input <- getLine case input of "help" -> displayHelp "quit" -> quit "new-task" -> schedulerSimpleMain (createTask inFileArray) "get-task" -> do (getTask inFileArray); schedulerSimpleMain "end-task" -> schedulerSimpleMain (endTask inFileArray) "view-tasks" -> do (viewTasks inFileArray); schedulerSimpleMain _ -> do putStrLn "Invalid input."; schedulerSimpleMain main :: IO() main = do putStr "What is the name of the schedule? " sName <- getLine schedulerSimpleMain (initializeFile sName) Thanks, and apologies if this isn't the correct place to be asking such a question.

    Read the article

  • Why is Drupal writing to root and not sites/default/files?

    - by Candland
    I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

    Read the article

  • How to add attributes to a HTML element in a valid way?

    - by Click Upvote
    I want to be able to add an attribute to a HTML element to be able to identify what its referring to. E.g if I have a list of names and a checkbox next to each name, like this: <div id="users"> Bob smith <input type=checkbox /> </div> And when a checkbox is clicked and the event handler function for it is called, I want to be able to identify which user was selected/unselected. Ideally I'm looking for something like this: <input type=checkbox data-userId = "xxx" /> Then when its clicked: function handleClick() { var userId = $(this).attr('data-userId'); } However I'm looking to do this in a way that won't break my HTML validation, and would still be valid HTML and work in all browsers. Any suggestions?

    Read the article

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • HTML5 Video Javascript

    - by user373721
    Hi, I am not experienced in Javascript, I have the following script to play video files on Andriod phone, and it works fine. <script type="text/javascript"> function PlayMyVideo(arg) { var myVideo = document.getElementById([arg]); myVideo.play(); } </script> <video id="what" src="what.mp4" poster="" /> <input type="button" onclick="PlayMyVideo('what')" value="Play" /> I am trying to write the tag on the fly: <script type="text/javascript"> function PlayVideo() { new_video = document.createElement('video'); new_video.setAttribute('scr', 'what.mp4'); new_video.play(); } </script> <input type="button" onclick="PlayVideo()" value="Play2" /> Nothing happen, would appreciate your suggestions. Thanks in advance

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • move text from one div to another with javascript or mootools

    - by Ke
    Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • how to use OR in jquery

    - by user1493339
    1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

    Read the article

  • JComboBox to string

    - by gabrielle fregil
    I have a String array of names, and then I added it into an editable JComboBox. The user can either pick his/her name from the choices or just input his/her name if not in the choices. How do I put the user input into a new string variable? String [] chooseName = { Mark, John, Allison, Jessica }; JComboBox combo = new JComboBox (chooseName); combo.setEditable(true); String chosenName = /* how do i place what the user inputed here? */

    Read the article

  • What is the differance between those two Strings in Java

    - by user1816808
    why when we declare string in java we can't use == to compare this string and always will turn to false while if we initialize the string from the beginning it will be true . for example : import java.util.Scanner; public class MyString { /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Scanner input = new Scanner(System.in); String s = input.nextLine(); if(s=="Hello") system.out.println("Hello"); String d = "Hello"; if(d=="Hello") system.out.println("Hello"); } } I need an explanation please ??

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >