Search Results

Search found 8925 results on 357 pages for 'customer care and billing'.

Page 297/357 | < Previous Page | 293 294 295 296 297 298 299 300 301 302 303 304  | Next Page >

• Does my API design violate RESTful principles?

  - by peta

  Hello everybody, I'm currently (I try to) designing a RESTful API for a social network. But I'm not sure if my current approach does still accord to the RESTful principles. I'd be glad if some brighter heads could give me some tips. Suppose the following URI represents the name field of a user account: people/{UserID}/profile/fields/name But there are almost hundred possible fields. So I want the client to create its own field views or use predefined ones. Let's suppose that the following URI represents a predefined field view that includes the fields "name", "age", "gender": utils/views/field-views/myFieldView And because field views are kind of higher logic I don't want to mix support for field views into the "people/{UserID}/profile/fields" resource. Instead I want to do the following: utils/views/field-views/myFieldView/{UserID} Though Leonard Richardson & Sam Ruby state in their book "RESTful Web Services" that a RESTful design is somehow like an "extreme object oriented" approach, I think that my approach is object oriented and therefore accords to RESTful principles. Or am I wrong? When not: Are such "object oriented" approaches generally encouraged when used with care and in order to avoid query-based REST-RPC hybrids? Thanks for your feedback in advance, peta

  Read the article

• Can NSCollectionView autoresize the width of its subviews to display one column

  - by littlecharva

  Hi, I have an NSCollectionView that contains a collection of CustomViews. Initially it tiled the subviews into columns and rows like a grid. I then set the Columns property in IB to 1, so now it just displays them one after another in rows. However, even though my CustomView is 400px wide, it's set to autoresize, the NSCollectionView is 400px wide, and it's set to 1 column, the subviews are drawn about 80px wide. I know I can get around this by calling: CGFloat width = [collectionView bounds].size.width; NSSize size = NSMakeSize(width, 85); [collectionView setMinItemSize:size]; [collectionView setMaxItemSize:size]; But putting this code in the awakeFromNib method of my WindowController only sets the correct width when the program launches. When I resize the window (and the NSCollectionView autoresizes as I've specified), the CustomViews stay at their initially set width. I'm happy to take care of resizing the subviews myself if need be, but I'm quite new to Cocoa and can't seem to find any articles explaining how to do such a thing. Can someone point me in the right direction? Anthony

  Read the article

• Developmnet process for an embedded project with significant Hardware change

  - by pierr

  Hi, I have a good idea about Agile development process but it seems it does not fit well with a embedded project with significant hardware change. I will describe below what we are currently doing (Ad-hoc way , no defined process yet). The change are divided to three categories and different process are used for them : complete hardware change example : use a different video codec IP a) Study the new IP b) RTL/FPGA simulation c) Implement the leagcy interface - go to b) d) Wait until hardware (tape out) is ready f) Test on the real Hardware hardware improvement example : enhance the image display quaulity by improving the underlie algorithm a)RTL/FPGA simulation b)Wait until hardware and test on the hardware Mino change exmaple : only change hardware register mapping a)Wait until hardware and test on the hardware The worry is it seems we don't have too much control and confidence about software maturity for the hardware change as the bring up schedule is always very tight and the customer desired a seemless change when updating to a new version hardware. How did you manage this kind of hardware hardware change? Did you solve that by a Hardware Abstraction Layer (HAL)? Did you have a automatical test for the HAL layer? How did you test when the hardware platform is not even ready? Do you have well documented process for this kind of change? Thanks for your insight.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Databinding question: DataGridView <=> XDocument (using LINQ-to-XML)

  - by Pretzel

  Learning LINQ has been a lot of fun so far, but despite reading a couple books and a bunch of online resources on the topic, I still feel like a total n00b. Recently, I just learned that if my query returns an Anonymous type, the DataGridView I'm populating will be ReadOnly (because, apparently Anonymous types are ReadOnly.) Right now, I'm trying to figure out the easiest way to: Get a subset of data from an XML file into a DataGridView, Allow the user to edit said data, Stick the changed data back into the XML file. So far I have Steps 1 and 2 figured out: public class Container { public string Id { get; set; } public string Barcode { get; set; } public float Quantity { get; set; } } // For use with the Distinct() operator public class ContainerComparer : IEqualityComparer<Container> { public bool Equals(Container x, Container y) { return x.Id == y.Id; } public int GetHashCode(Container obj) { return obj.Id.GetHashCode(); } } var barcodes = (from src in xmldoc.Descendants("Container") where src.Descendants().Count() > 0 select new Container { Id = (string)src.Element("Id"), Barcode = (string)src.Element("Barcode"), Quantity = float.Parse((string)src.Element("Quantity").Attribute("value")) }).Distinct(new ContainerComparer()); dataGridView1.DataSource = barcodes.ToList(); This works great at getting the data I want from the XML into the DataGridView so that the user has a way to manipulate the values. Upon doing a Step-thru trace of my code, I'm finding that the changes to the values made in DataGridView are not bound to the XDocument object and as such, do not propagate back. How do we take care of Step 3? (getting the data back to the XML) Is it possible to Bind the XML directly to the DataGridView? Or do I have to write another LINQ statement to get the data from the DGV back to the XDocument? Suggstions?

  Read the article

• Converting John Resig's JavaScript Templating Engine to work with PHP Templates

  - by Serhiy

  I'm trying to convert the John Resig's Templating Engine to work with PHP. Essentially what I would like to achieve is the ability to use certain Kohana Views via a JavaScript templating engine, that way I can use the same views for both a standard PHP request and a jQuery AJAX request. I'm starting with the basics and would like to be able to convert http://github.com/nje/jquery-tmpl/blob/master/jquery.tmpl.js To work with php like so... ### From This ### <li><a href="{%= link %}">{%= title %}</a> - {%= description %}</li> ### Into This ### <li><a href="<?= $link ?>"><?= $title ?></a> - <?= description ?></li> The RexEx in it is a bit over my head and it's apparently not as easy as changing the %} to ? in lines 148 to 158. Any help would be highly appreciated. I'm also not sure of how to take care of the $ difference that PHP variables have. Thanks, Serhiy

  Read the article

• Are SharePoint site templates really less performant than site definitions?

  - by Jim

  So, it seems in the SharePoint blogosphere that everybody just copies and pastes the same bullet points from other blogs. One bullet point I've seen is that SharePoint site templates are less performant than site definitions because site definitions are stored on the file system. Is that true? It seems odd that site templates would be less performant. It's my understanding that all site content lives in a database, whether you use a site template or a site definition. A site template is applied once to the database, and from then on the site should not care if the content was created using a site template or not. So, does anybody have an architectural reason why a site template would be less performant than a site definition? Edit: Links to the blogs that say there is a performance difference: From MSDN: Because it is slow to store templates in and retrieve them from the database, site templates can result in slower performance. From DevX: However, user templates in SharePoint can lead to performance problems and may not be the best approach if you're trying to create a set of reusable templates for an entire organization. From IT Footprint: Because it is slow to store templates in and retrieve them from the database, site templates can result in slower performance. Templates in the database are compiled and executed every time a page is rendered. From Branding SharePoint:Custom site definitions hold the following advantages over custom templates: Data is stored directly on the Web servers, so performance is typically better. At a minimum, I think the above articles are incomplete, and I think several are misleading based on what I know of SharePoints architecture. I read another blog post that argued against the performance differences, but I can't find the link.

  Read the article

• how to write this typical mysql query( ho to use subquery column into main query)

  - by I Like PHP

  I HAVE TWO TABLES shown below table_joining id join_id(PK) transfer_id(FK) unit_id transfer_date joining_date 1 j_1 t_1 u_1 2010-06-05 2010-03-05 2 j_2 t_2 u_3 2010-05-10 2010-03-10 3 j_3 t_3 u_6 2010-04-10 2010-01-01 4 j_5 NULL u_3 NULL 2010-06-05 5 j_6 NULL u_4 NULL 2010-05-05 table_transfer id transfer_id(PK) pastUnitId futureUnitId effective_transfer_date 1 t_1 u_3 u_1 2010-06-05 2 t_2 u_6 u_1 2010-05-10 3 t_3 u_5 u_3 2010-04-10 now i want to know total employee detalis( using join_id) which are currently working on unit u_3 . means i want only join_id j_1 (has transfered but effective_transfer_date is future date, right now in u_3) j_2 ( tansfered and right now in `u_3` bcoz effective_transfer_date has been passed) j_6 ( right now in `u_3` and never transfered) what i need to take care of below steps( as far as i know ) <1> first need to check from table_joining whether transfer_id is NULL or not <2> if transfer_id= is NULL then see unit_id=u_3 where joining_date <=CURDATE() ( means that person already joined u_3) <3> if transfer_id is NOT NULL then go to table_transfer using transfer_id (foreign key reference) <4> now see the effective_transfer_date regrading that transfer_id whether effective_transfer_date<=CURDATE() <5> if transfer date has been passed(means transfer has been done) then return futureUnitID otherwise return pastUnitID i used two separate query but don't know how to join those query?? for step <1 ans <2 SELECT unit_id FROM table_joining WHERE joining_date<=CURDATE() AND transfer_id IS NULL AND unit_id='u_3' for step<5 SELECT IF(effective_transfer_date <= CURDATE(),futureUnitId,pastUnitId) AS currentUnitID FROM table_transfer // here how do we select only those rows which have currentUnitID='u_3' ?? please guide me the process?? i m just confused with JOINS. i think using LEFT JOIN can return the data i need, but i m not getting how to implement ...please help me. Thanks for helping me alwayz

  Read the article

• Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

  - by Deepak Konidena

  Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

  Read the article

• Setup.exe files downloading without cab files over poor connections

  - by Colin

  We have customers who are trying to download a setup.exe file over mobile connections that appear to be very slow. They have reported that when they click on the downloaded setup.exe, the install wizard starts up, but part way through the wizard they get an error message indicating that a cab file is corrupt or missing. They couriered a problem tablet to us, and we downloaded the file without a problem but I could replicate the problem by using https to download the file (https is normally used to access the rest of the site, although it is not necessary for the download). When I did this the downloaded file was 2.8MB. It should be 8MB. I don't think that https is the root cause of the problem because I can see the download link in the browser history using http, so I know the customer tried to download using http. I think that the issue is that the poor connection is preventing a complete download, but the browser is acting as if it is complete. Is there a way to ensure the file is downloaded fully, or not at all? Why does the browser not indicate that the download is incomplete?

  Read the article

• Linq to SQL with INSTEAD OF Trigger and an Identity Column

  - by Bob Horn

  I need to use the clock on my SQL Server to write a time to one of my tables, so I thought I'd just use GETDATE(). The problem is that I'm getting an error because of my INSTEAD OF trigger. Is there a way to set one column to GETDATE() when another column is an identity column? This is the Linq-to-SQL: internal void LogProcessPoint(WorkflowCreated workflowCreated, int processCode) { ProcessLoggingRecord processLoggingRecord = new ProcessLoggingRecord() { ProcessCode = processCode, SubId = workflowCreated.SubId, EventTime = DateTime.Now // I don't care what this is. SQL Server will use GETDATE() instead. }; this.Database.Add<ProcessLoggingRecord>(processLoggingRecord); } This is the table. EventTime is what I want to have as GETDATE(). I don't want the column to be null. And here is the trigger: ALTER TRIGGER [Master].[ProcessLoggingEventTimeTrigger] ON [Master].[ProcessLogging] INSTEAD OF INSERT AS BEGIN SET NOCOUNT ON; SET IDENTITY_INSERT [Master].[ProcessLogging] ON; INSERT INTO ProcessLogging (ProcessLoggingId, ProcessCode, SubId, EventTime, LastModifiedUser) SELECT ProcessLoggingId, ProcessCode, SubId, GETDATE(), LastModifiedUser FROM inserted SET IDENTITY_INSERT [Master].[ProcessLogging] OFF; END Without getting into all of the variations I've tried, this last attempt produces this error: InvalidOperationException Member AutoSync failure. For members to be AutoSynced after insert, the type must either have an auto-generated identity, or a key that is not modified by the database after insert. I could remove EventTime from my entity, but I don't want to do that. If it was gone though, then it would be NULL during the INSERT and GETDATE() would be used. Is there a way that I can simply use GETDATE() on the EventTime column for INSERTs? Note: I do not want to use C#'s DateTime.Now for two reasons: 1. One of these inserts is generated by SQL Server itself (from another stored procedure) 2. Times can be different on different machines, and I'd like to know exactly how fast my processes are happening.

  Read the article

• WCF Certificates without Certificate Store

  - by Kane

  My team is developing a number of WPF plug-ins for a 3rd party thick client application. The WPF plug-ins use WCF to consume web services published by a number of TIBCO services. The thick client application maintains a separate central data store and uses a proprietary API to access the data store. The thick client and WPF plug-ins are due to be deployed onto 10,000 workstations. Our customer wants to keep the certificate used by the thick client in the central data store so that they don't need to worry about re-issuing the certificate (current re-issue cycle takes about 3 months) and also have the opportunity to authorise the use of the certificate. The proposed architecture offers a form of shared secret / authentication between the central data store and the TIBCO services. Whilst I don’t necessarily agree with the proposed architecture our team is not able to change it and must work with what’s been provided. Basically our client wants us to build into our WPF plug-ins a mechanism which retrieves the certificate from the central data store (which will be allowed or denied based on roles in that data store) into memory then use the certificate for creating the SSL connection to the TIBCO services. No use of the local machine's certificate store is allowed and the in memory version is to be discarded at the end of each session. So the question is does anyone know if it is possible to pass an in-memory certificate to a WCF (.NET 3.5) service for SSL transport level encryption? Note: I had asked a similar question (here) but have since deleted it and re-asked it with more information.

  Read the article

• reconstructing a tree from its preorder and postorder lists.

  - by NomeN

  Consider the situation where you have two lists of nodes of which all you know is that one is a representation of a preorder traversal of some tree and the other a representation of a postorder traversal of the same tree. I believe it is possible to reconstruct the tree exactly from these two lists, and I think I have an algorithm to do it, but have not proven it. As this will be a part of a masters project I need to be absolutely certain that it is possible and correct (Mathematically proven). However it will not be the focus of the project, so I was wondering if there is a source out there (i.e. paper or book) I could quote for the proof. (Maybe in TAOCP? anybody know the section possibly?) In short, I need a proven algorithm in a quotable resource that reconstructs a tree from its pre and post order traversals. Note: The tree in question will probably not be binary, or balanced, or anything that would make it too easy. Note2: Using only the preorder or the postorder list would be even better, but I do not think it is possible. Note3: A node can have any amount of children. Note4: I only care about the order of siblings. Left or right does not matter when there is only one child.

  Read the article

• CQRS - The query side

  - by mattcodes

  A lot of the blogsphere articles related to CQRS (command query repsonsibility) seperation seem to imply that all screens/viewmodels are flat. e.g. Name, Age, Location Of Birth etc.. and thus the suggestion that implementation wise we stick them into fast read source etc.. single table per view mySQL etc.. and pull them out with something like primitive SqlDataReader, kick that nasty nhibernate ORM etc.. However, whilst I agree that domain models dont mapped well to most screens, many of the screens that I work with are more dimensional, and Im sure this is pretty common in LOB apps. So my question is how are people handling screen where by for example it displays a summary of customer details and then a list of their orders with a [more detail] link etc.... I thought about keeping with the straight forward SQL query to the Query Database breaking off the outer join so can build a suitable ViewModel to View but it seems like overkill? Alternatively (this is starting to feel yuck) in CustomerSummaryView table have a text/big (whatever the type is in your DB) column called Orders, and the columns for the Order summary screen grid are seperated by , and rows by |. Even with XML datatype it still feeel dirty. Any thoughts on an optimal practice?

  Read the article

• PCA extended face recognition

  - by cMinor

  The state of the art says that we can use PCA to perform face recognition. like this, this or this I am working with a project that involves training a classifier to detect a person who is wearing glasess or hats or even a mustache. The purpose of doing this is to detect when a person that has robbed a bank, store, or have commeted some sort of crime(s) (we have their image in a database), enters a certain place ( historically we know these guys have robbed, so we should take care to avoid problems). We came first to have a distributed database with all images of criminals, then I thought to have a layer of them clasifying these criminals using accesories like hats, mustache or anything that hides their face etc... Then, to apply that knowledge to detect when a particular or a suspect person enters a comercial place. ( In practice when someone is going to rob not all the times they are using an accesorie...) What do you think about this idea of doing PCA to first detect principal components of the face and then the components of an accesory. I was thinking that maybe a probabilistic approach is better so we can compute the probability the criminal is the person that entered a place and call the respective authorities.

  Read the article

• GAE modeling relationship options

  - by Sway

  Hi there, I need to model the following situation and I can't seem to find a consistent example on how to do it "correctly" for the google app engine. Suppose I've got a simple situation like the following: [Company] 1 ----- M [Stare] A company has one to many stores. Each store has an address made up of a address line 1, city, state, country, postcode etc. Ok. Lets say we need to create say an "Audit". An Audit is for a company and can be across one to many stares. So something like: [Audit] 1 ------ 1 [Company] 1 ------ M [Store] Now we need to query all of the "audits" based on the Store "addresses" in order to send the "Auditors" to the right locations. There seem to be numerous articles like this one: http://code.google.com/appengine/articles/modeling.html Which give examples of creating a "ContactCompany" model class. However they also say that you should use this kind of relationship only when you "really need to" and with "care" for performance. I've also read - frequently - that you should denormalize as much as possible thereby moving all of the "query-able" data into the Audit class. So what would you suggest as the best way to solve this? I've seen that there is an Expando class but I'm not sure if that is the "best" option for this. Any help or thoughts on this would be totally appreciated. Thanks in advance, Matt

  Read the article

• Regex to extract portions of file name

  - by jakesankey

  I have text files formatted as such: R156484COMP_004A7001_20100104_065119.txt I need to consistently extract the R****COMP, the 004A7001 number, 20100104 (date), and don't care about the 065119 number. the problem is that not ALL of the files being parsed have the exact naming convention. some may be like this: R168166CRIT_156B2075_SU2_20091223_123456.txt or R285476COMP_SU1_125A6025_20100407_123456.txt So how could I use regex instead of split to ensure I am always getting that serial (ex. 004A7001), the date (ex. 20100104), and the R****COMP (or CRIT)??? Here is what I do now but it only gets the files formatted like my first example. if (file.Count(c => c == '_') != 3) continue; and further down in the code I have: string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); UPDATE: This is now where I am at -- I get an error to parse RNumberDate to an actual date format. "Cannot implicitly convert type 'RegularExpressions.Match' to 'string' string RNumber = Path.GetFileNameWithoutExtension(file); Match RNumberE = Regex.Match(RNumber, @"^(R|L)\d{6}(COMP|CRIT|TEST|SU[1-9])(?=_)", RegexOptions.IgnoreCase); Match RNumberD = Regex.Match(RNumber, @"(?<=_)\d{3}[A-Z]\d{4}(?=_)", RegexOptions.IgnoreCase); Match RNumberDate = Regex.Match(RNumber, @"(?<=_)\d{8}(?=_)", RegexOptions.IgnoreCase); DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy")

  Read the article

• Which parts of Sharepoint do I need to understand to build a publicly facing website?

  - by Petras

  I am building a publicly facing website that does the following. Users log in. And then view a list of their customers. They click on a customer to view their past purchases, order them, change them etc. This is not a shopping site by the way. It is a simple look up tool. Note that none of the data accessed by the website is in anything other than a SQL database - no office documents. Also, the login does not use users Windows credentials on a VPN or something like that. Typically I would build this using a standard ASP.NET MVC website. However the client says they want to use Sharepoint. As I understand it, Sharepoint is used for workflow and websites that are collaboration tools such as the components you can see here http://www.sharepointhosting.com/sharepoint-features.html Here are my questions: Would I be right in saying that WSS is completely inappropriate for this task as it comes with an overhead that provides no benefits? If I had to use it, would I need WSS or MOSS? If I had to use it, would I be right in saying the site would consist of : List item a) Web Parts b) And a custom site layout. How do I create one of these?

  Read the article

• Exporting/Importing events to Outlook 2007 calendar - problem

  - by iandisme

  I work on a web app that involves scheduling. A user can view his schedule, and then download a meeting request file for a particular event. In Outlook 2003, simply opening this event would cause a meeting request to pop up and the user could accept, which would either add or update the event in their calendar. However, in Outlook 2007, the meeting request Accept function is disabled, and the reason given is that the user is the organizer and can't accept his own event request. The ICS file clearly shows that this is not the case. Has anyone experienced this same problem? Does anyone know how to work around it? (Using Outlook's import function is scarcely an option because it causes duplicate events to be created; the import function doesn't seem to care that the events have the same UID) Here is the ICS file: BEGIN:VCALENDAR PRODID:#{my app} VERSION:2.0 CALSCALE:GREGORIAN METHOD:REQUEST BEGIN:VEVENT DTSTAMP:20100324T150236Z UID:eeb639a1-f8e5-4eab-ab3c-232ad91364c6 SEQUENCE:2 ORGANIZER:#{myApp}.#{myDomain}.com DESCRIPTION: DTSTART;TZID=Europe/London:20110620T120010 DTEND;TZID=Europe/London:20110620T133010 SUMMARY:BREAK:Breakfast LOCATION:Room 101 END:VEVENT BEGIN:VTIMEZONE //Timezone info edited for brevity END:VTIMEZONE END:VCALENDAR

  Read the article

• pooling with Windsor

  - by AlonEl

  I've tried out the pooling lifestyle with Windsor. Lets say I want multiple CustomerTasks to work with a pool of ILogger's. when i try resolving more times than maxPoolSize, new loggers keeps getting created. what am i missing and what exactly is the meaning of min and max pool size? the xml configuration i use is (demo code): <component id="customertasks" type="WindsorTest.CustomerTasks, WindsorTestCheck" lifestyle="transient" /> <component id="logger.console" service="WindsorTest.ILogger, WindsorTestCheck" type="WindsorTest.ConsoleLogger, WindsorTestCheck" lifestyle="pooled" initialPoolSize="2" maxPoolSize="5" /> Code is: public interface ILogger { void Log(string message); } public class ConsoleLogger : ILogger { private static int count = 0; public ConsoleLogger() { Console.WriteLine("Hello from constructor number:" + count); count++; } public void Log(string message) { Console.WriteLine(message); } } public class CustomerTasks { private readonly ILogger logger; public CustomerTasks(ILogger logger) { this.logger = logger; } public void SaveCustomer() { logger.Log("Saved customer"); } }

  Read the article

• NHibernate with nothing but stored procedures

  - by ChrisB2010

  I'd like to have NHibernate call a stored procedure when ISession.Get is called to fetch an entity by its key instead of using dynamic SQL. We have been using NHibernate and allowing it to generate our SQL for queries and inserts/updates/deletes, but now may have to deploy our application to an environment that requires us to use stored procedures for all database access. We can use sql-insert, sql-update, and sql-delete in our .hbm.xml mapping files for inserts/updates/deletes. Our hql and criteria queries will have to be replaced with stored procedure calls. However, I have not figured out how to force NHibernate to use a custom stored procedure to fetch an entity by its key. I still want to be able to call ISession.Get, as in: using (ISession session = MySessionFactory.OpenSession()) { return session.Get<Customer>(customerId); } and also lazy load objects, but I want NHibernate to call my "GetCustomerById" stored procedure instead of generating the dynamic SQL. Can this be done? Perhaps NHibernate is no longer a fit given this new environment we must support.

  Read the article

• Table Design For SystemSettings, Best Model

  - by Chris L

  Someone suggested moving a table full of settings, where each column is a setting name(or type) and the rows are the customers & their respective settings for each setting. ID | IsAdmin | ImagePath ------------------------------ 12 | 1          | \path\to\images 34 | 0          | \path\to\images The downside to this is every time we want a new setting name(or type) we alter the table(via sql) and add the new (column)setting name/type. Then update the rows(so that each customer now has a value for that setting). The new table design proposal. The proposal is to have a column for setting name and another column for setting. ID | SettingName | SettingValue ---------------------------- 12 | IsAdmin        | 1 12 | ImagePath   | \path\to\images 34 | IsAdmin        | 0 34 | ImagePath   | \path\to\images The point they made was that adding a new setting was as easy as a simple insert statement to the row, no added column. But something doesn't feel right about the second design, it looks bad, but I can't come up with any arguments against it. Am I wrong?

  Read the article

• Scrolling down to next element via keypress & scrollTo plugin - jQuery

  - by lyrae

  I am using jQuery's scrollTo plugin to scroll up and down my page, using UP arrow and DOWN arrow. i have a bunch of div with class "screen", as so: <div class="screen-wrapper">...</div> What I am trying to do is, when i press UP or DOWN, the window scrolls to the next, or previous div with class of "screen". I have the keypresses taken care of. According to the plugin docs, to scroll a window, you use $.scrollTo(...); Here's the code I have: $(document).keypress(function(e){ switch (e.keyCode) { case 40: // down n = $('.screen-wrapper').next() $.scrollTo( n, 800 ); break; case 38: // up break; case 37: // left break; case 39: // right break; } }); And if it helps, here's the HTML div. I have a few of these on the page, and essentially, am trying to scroll to next one by pressing down arrow: <div class='screen-wrapper'> <div class='screen'> <div class="sections"> <ul> <li><img src="images/portfolio/sushii-1.png " /></li> <li><img src="images/portfolio/sushii-2.png" /></li> <li><img src="images/portfolio/sushii-3.png" /></li> </ul> </div> <div class="next"></div> <div class="prev"></div> </div> And also if it needed, I can provide a link where this is being used if it'll help someone get a better idea. edit And, i forgot to mention what the real question here is. The question/problem is that it won't scroll down past the first element, as seth mentioned.

  Read the article

• perl dynamic path given to 'use lib'

  - by Ed Hyer

  So, my code (Perl scripts and Perl modules) sits in a tree like this: trunk/ util/ process/ scripts/ The 'util' directory has, well, utilities, that things in the 'process/' dir need. They get access like this: use FindBin; use lib "$FindBin::Bin/../util"; use UtilityModule qw(all); That construct doesn't care where you start, as long as you're at the same level in the tree as "util/". But I decided that 'scripts/' was getting too crowded, so I created scripts/scripts1 scripts/scripts2 Now I see that this doesn't work. If I run a script 'trunk/scripts/scripts1/call_script.pl', and it calls '/trunk/process/process_script.pl', then 'process_script.pl' will fail trying to get the routines from UtilityModule(), because the path that FindBin returns is the path of the top-level calling script. The first ten ways I thought of to solve this all involved something like: use lib $path_that_came_from_elsewhere; but that seems to be something Perl doesn't like to do, except via that FindBin trick. I tried some things involving BEGIN{} blocks, but i don't really know what I'm doing there, and will likely just end up refactoring. But if someone has some clever insight into this type of problem, this would be a good chance to earn some points!

  Read the article

• Configure IIS7 to server static content through ASP.NET Runtime

  - by Anton Gogolev

  I searched high an low and still cannot find a definite answer. How do I configure IIS 7.0 or a Web Application in IIS so that ASP.NET Runtime will handle all requests -- including ones to static files like *.js, *.gif, etc? What I'm trying to do is as follows. We have kind of SaaSy site, which we can "skin" for every customer. "Skinnig" means developing a custom master page and using a bunch of *.css and other images. Quite naturally, I'm using VirtualPathProvider, which operates like this: public override System.Web.Hosting.VirtualFile GetFile(string virtualPath) { if(PhysicalFileExists(virtualPath)) { var virtualFile = base.GetFile(virtualPath); return virtualFile; } if(VirtualFileExists(virtualPath)) { var brandedVirtualPath = GetBrandedVirtualPath(virtualPath); var absolutePath = HttpContext.Current.Server.MapPath(brandedVirtualPath); Trace.WriteLine(string.Format("Serving '{0}' from '{1}'", brandedVirtualPath, absolutePath), "BrandingAwareVirtualPathProvider"); var virtualFile = new VirtualFile(brandedVirtualPath, absolutePath); return virtualFile; } return null; } The basic idea is as follows: we have a branding folder inside our webapp, which in turn contains folders for each "brand", with "brand" being equal to host name. That is, requests to http://foo.example.com/ should use static files from branding/foo_example_com, whereas http://bar.example.com/ should use content from branding/bar_example_com. Now what I want IIS to do is to forward all requests to static files to StaticFileHandler, which would then use this whole "infrastructure" and serve correct files. However, try as I might, I cannot configure IIS to do this.

  Read the article

< Previous Page | 293 294 295 296 297 298 299 300 301 302 303 304  | Next Page >