Search Results

Search found 137 results on 6 pages for 'atg'.

Page 3/6 | < Previous Page | 1 2 3 4 5 6  | Next Page >

  • Webcast Replay Available: E-Business Suite Release 12.1 Upgrade Best Practices - Technical Insight

    - by BillSawyer
    I am pleased to release the replay and presentation for the latest ATG Live Webcast: E-Business Suite Release 12.1 Upgrade Best Practices - Technical Insight (Presentation)Udayan Parvate, Director, E-Business Suite Release Engineering and Uday Moogala, Senior Principal Engineer, Applications Performance discussed the best practices that you can apply when upgrading your E-Business Suite instance to Release 12.1 and beyond. They discussed upgrade paths, resources, and practices to minimize downtime during the upgrade. (April 2012)Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • ATG Live Webcast March 29: Diagnosing E-Business Suite JVM and Forms Performance Issues (Performance Series Part 4 of 4)

    - by BillSawyer
    The next webcast in our popular EBS series on performance management is going to be a showstopper.  Dave Suri, Project Lead, Applications Performance and Gustavo Jimenez, Senior Development Manager will discuss some of the steps involved in triaging and diagnosing E-Business Suite systems related to JVM and Forms components. Please join us for our next ATG Live Webcast on Mar. 29, 2012: Triage and Diagnostics for E-Business Suite JVM and Forms The topics covered in this webcast will be: Overall Menu/Sections Architecture Patches/Certified browsers/jdk versions JVM Tuning JVM Tools (jstat,eclipse mat, ibm tda) Forms Tools (strace/FRD) Java Concurrent Program options location Case studies Case Studies JVM Thread dump case for Oracle Advanced Product Catalog Forms FRD trace relating to Saving an SR Java Concurrent Program for BT Date:               Thursday, March 29, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:  Dave Suri, Project Lead, Applications Performance                        Gustavo Jimenez, Senior Development ManagerWebcast Registration Link (Preregistration is optional but encouraged)To hear the audio feed:   Domestic Participant Dial-In Number:            877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              99342To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  597073984 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here.If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com. 

    Read the article

  • Webcast Replay Available: E-Business Suite Data Protection

    - by BillSawyer
    I am pleased to release the replay and presentation for the latest ATG Live Webcast: E-Business Suite Data Protection (Presentation)   Robert Armstrong, Product Strategy Security Architect and Eric Bing, Senior Director discussed the best practices and recommendations for securing your E-Business Suite data.Finding other recorded ATG webcasts The catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • ATG Live Webcast Nov. 15th: Best Practices for Using EBS SDK for Java with Oracle ADF

    - by Bill Sawyer
    Oracle E-Business Suite delivers functionality for handling the core business of your organization. This webcast provides best practices for how to use Oracle Application Development Framework (Oracle ADF) with the Oracle E-Business Suite SDK for Java.  Topics include: Session management with ADF Handling security Embedding ADF regions in OA Framework pages Best practices and more Date:               Thursday, November 15, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Sara Woodhull, Principal Product Manager, E-Business Suite ATG                         Juan Camilo Ruiz, Principal Product Manager, ADF Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:    Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103192To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591862924 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • ATG Live Webcast Dec. 13th: EBS Future Directions: Deployment and System Administration

    - by Bill Sawyer
    This webcast provides an overview of the improvements to Oracle E-Business Suite deployment and system administration that are planned for the upcoming EBS 12.2 release.   It is targeted to system administrators, DBAs, developers, and implementers. This webcast, led by Max Arderius, Manager Applications Technology Group, compares existing deployment and system administration tools for EBS 12.0 and 12.1 with the upcoming functionality planned for EBS 12.2. This was a very popular session at OpenWorld 2012, and I am pleased to bring it to the ATG Live Webcast series.  This session will cover: Understanding the Oracle E-Business Suite 12.2 Architecture Installing & Upgrading EBS 12.2 Online Patching in EBS 12.2 Cloning in EBS 12.2 Date:             Thursday, December 13, 2012Time:             8:00 AM - 9:00 AM Pacific Standard TimePresenter:   Max Arderius, Manager Applications Technology Group Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103194To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  593672805If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • ATG Live Webcast Nov. 8th: Advanced Management of EBS with Oracle Enterprise Manager

    - by Bill Sawyer
    The task of managing and monitoring Oracle E-Business Suite environments can be very challenging. The Application Management Pack plug-in is part of Oracle Enterprise Manager 12c Application Management Suite for Oracle E-Business Suite. The Application Management Pack plug-in is designed to monitor and manage all the different technologies that constitute Oracle E-Business Suite applications, including midtier, configuration, host, and database management—to name just a few. Customers that have implemented Oracle Enterprise Manager have experienced dramatic improvements in system visibility, diagnostic capability, and administrator productivity. This webcast will highlight the key features and benefits of Oracle Enterprise Manager, the latest version of the Oracle Application Management Suite for Oracle E-Business Suite. Advanced Management of Oracle E-Business Suite with Oracle Enterprise Manager Date:                Thursday, November 8, 2012Time:               8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Angelo Rosado, Principal Product Manager, E-Business Suite ATG                         Lauren Cohn, Principal Curriculum Developer, E-Business Suite ATGWebcast Registration Link (Preregistration is optional but encouraged)To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103191To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591460967 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • Oracle Accelerate : Packaged CX Solutions for Growing Companies

    - by Richard Lefebvre
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Oracle Accelerate is Oracle's approach for providing simple to deploy, packaged, enterprise-class software solutions to growing midsize organizations through its network of expert partners. They come with a fixed price, a fixed scope and can be industry- or country-specific. Here is a suggestion of Oracle Accelerate solutions specially tailored for EMEA based customers looking for growing their business with CX technology: Oracle Sales Cloud Birchman Consulting's Oracle Accelerate Solution for Oracle Sales Cloud CSolutor Oracle Accelerate Solution for Oracle Sales Cloud CapricornVentis Oracle Accelerate Solution for Oracle Sales Cloud Oracle Sales Cloud for vertical industries Enigen’s Oracle Accelerate solution for Oracle Fusion CRM for Professional Services BPI's Oracle Accelerate solution for Oracle Sales Cloud for Business Services Companies BPI's Oracle Accelerate Solution for Oracle Sales Cloud for Insurance Companies BPI's Oracle Accelerate solution for Oracle Sales Cloud for Engineering & Construction Companies BPI's Oracle Accelerate Solution for Oracle Sales Cloud for Telecommunications Companies Fellow Consulting's Oracle Accelerate Solution for Oracle Sales Cloud for Consumer Goods industry Fellow Consulting's Oracle Accelerate Solution for Oracle Sales Cloud for Wholesale Distribution Fellow Consulting's Oracle Accelerate Solution for Oracle Sales Cloud for Life Science industry Oracle Service Cloud (RightNow) CapricornVentis Oracle Accelerate Solution for Oracle RightNow Cloud Service for Retail Industry for Ireland CapricornVentis Oracle Accelerate Solution for Oracle RightNow Cloud Service for Retail Industry for the United Kingdom Enigen’s Oracle Accelerate Solution for Oracle RightNow Service Cloud for the United Kingdom DNASTREAM’s RapidLaunch Oracle Accelerate solution for RightNow Oracle Commerce (ATG) ProgiCommerce - an Oracle Accelerate solution for ATG Commerce delivered by PROGIWEB Spindrift Momentum - an Oracle Accelerate Solution for ATG Commerce for Retail Industry e2x RoadRunner - the ATG Oracle Accelerate solution for Manufacturing Industry e2x RoadRunner - the ATG Oracle Accelerate solution for Telecommunications Industry e2x RoadRunner - the ATG Oracle Accelerate solution for Retail Web Commerce

    Read the article

  • ATG Live Webcast March 21 Reminder: Network, WAN, and PC Performance Tuning (Performance Series Part 3 of 3)

    - by BillSawyer
    A quick reminder about tomorrow's webcast:  Andy Tremayne, Senior Architect, Applications Performance, and co-author of Oracle Applications Performance Tuning Handbook from Oracle Press, and Uday Moogala, Senior Principal Engineer, Applications Performance, will discuss network performance for E-Business Suite. Andy and Uday will cover tuning the client and tuning the network. They will share real-life examples of network performance, and show you tools and techniques that you can use to estimate or simulate performance on your own network.The agenda for the Performance Tuning - Part 3 of 3 webcast includes the following topics: Tuning the Client Tuning the Network Date:               Thursday, March 21, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:  Andy Tremayne, Senior Architect, Applications Performance                        Uday Moogala, Senior Principal Engineer, Applications PerformanceWebcast Registration Link (Preregistration is optional but encouraged)To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              99341To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591264961If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here.

    Read the article

  • ATG Live Webcast Nov. 29th: Endeca "Evolutionizes" E-Business Suite

    - by Bill Sawyer
    If you have ever wanted any of the following within Oracle E-Business Suite: Complete Data View Advanced Searching Across Organizations and Flexfields Advanced Visualization including Charts, Metrics, and Cross Tabs Guided Navigation Then you might want to attend this webcast to learn more about Oracle Endeca's integration with Oracle E-Business Suite. Oracle Endeca includes an unstructured data correlation and analytics engine, together with catalog search and guided navigation capabilities. This webcasts focuses on the details behind Oracle Endeca's integration with Oracle E-Business Suite. It demonstrates how you can extend the use of Oracle Endeca into other areas of Oracle E-Business Suite. Date:             Thursday, November 29, 2012Time:             8:00 AM - 9:00 AM Pacific Standard TimePresenter:   Osama Elkady, Senior DirectorWebcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103192To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  595335921If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • ATG Live Webcast Dec. 6th: Minimizing EBS Maintenance Downtimes

    - by Bill Sawyer
    This webcast provides an overview of the plans and decisions you can make, and the actions you can take, that will help you minimize maintenance downtimes for your E-Business Suite instances. It is targeted to system administrators, DBAs, developers, and implementers. This session, led by Elke Phelps, Senior Principal Product Manager, and Santiago Bastidas, Principal Product Manager, will cover best practices, tools, utilities, and tasks to minimize your maintenance downtimes during the four key maintenance phases. Topics will include: Pre-Patching: Reviewing the list of patches and analyzing their impact Patching Trials: Testing the patch prior to actual production deployment Patch Deployment: Applying patching to your system Post Patching Analysis: Validating the patch application Date:                Thursday, December 6, 2012Time:               8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Elke Phelps, Senior Principal Product Manager                         Santiago Bastidas, Principal Product Manager Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:    Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103200To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  595757500 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • Upcoming Webcast: ATG Live Webcast April 5: Managing Your Oracle E-Business Suite with Oracle Enterprise Manager

    - by Oracle_EBS
    Please consider attending the following Webcast announced today on Steven Chan's E-Business Blog linked below.  Please visit his blog to learn more and to register. Managing Your Oracle E-Business Suite with Oracle Enterprise Manager   The topics covered in this webcast will be: Manage your EBS system configurations Monitor your EBS environment's performance and uptime Keep multiple EBS environments in sync with their patches and configurations Create patches for your EBS customizations and apply them with Oracle's own patching tools Visit here to learn more and join today!

    Read the article

  • Webcast Replay Available: Performance Tuning E-Business Suite Concurrent Manager (Performance Series Part 2 of 3)

    - by BillSawyer
    I am pleased to release the replay and presentation for the latest ATG Live Webcast: Performance Tuning E-Business Suite Concurrent Manager (Performance Series Part 2 of 3) (Presentation)Andy Tremayne, Senior Architect, Applications Performance, and co-author of Oracle Applications Performance Tuning Handbook from Oracle Press, and Uday Moogala, Senior Principal Engineer, Applications Performance discussed two major components of E-Business Suite performance tuning:  concurrent management and tracing. They dispel some myths surrounding these topics, and shared with you the recommended best practices that you can use on your own E-Business Suite instance.Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • Summary of Oracle E-Business Suite Technology Webcasts and Training

    - by BillSawyer
    Last Updated: November 16, 2011We're glad to hear that you've been finding our ATG Live Webcast series to be useful.  If you missed a webcast, you can download the presentation materials and listen to the recordings below. We're collecting other learning-related materials right now.  We'll update this summary with pointers to new training resources on an ongoing basis.  ATG Live Webcast Replays All of the ATG Live Webcasts are hosted by the Oracle University Knowledge Center.  In order to access the replays, you will need a free Oracle.com account. You can register for an Oracle.com account here.If you are a first-time OUKC user, you will have to accept the Terms of Use. Sign-in with your Oracle.com account, or if you don't already have one, use the link provided on the sign-in screen to create an account. After signing in, accept the Terms of Use. Upon completion of these steps, you will be directed to the replay. You only need to accept the Terms of Use once. Your acceptance will be noted on your account for all future OUKC replays and event registrations. 1. E-Business Suite R12 Oracle Application Framework (OAF) Rich User Interface Enhancements (Presentation) Prabodh Ambale (Senior Manager, ATG Development) and Gustavo Jiminez (Development Manager, ATG Development) offer a comprehensive review of the latest user interface enhancements and updates to OA Framework in EBS 12.  The webcast provides a detailed look at new features designed to enhance usability, including new capabilities for personalization and extensions, and features that support the use of dashboards and web services. (January 2011) 2. E-Business Suite R12 Service Oriented Architectures (SOA) Using the E-Business Suite Adapter (Presentation, Viewlet) Neeraj Chauhan (Product Manager, ATG Development) reviews the Service Oriented Architecture (SOA) capabilities within E-Business Suite 12, focussing on using the E-Business Suite Adapter to integrate EBS with third-party applications via web services, and orchestrate services and distributed transactions across disparate applications. (February 2011) 3. Deploying Oracle VM Templates for Oracle E-Business Suite and Oracle PeopleSoft Enterprise Applications Ivo Dujmovic (Director, ATG Development) reviews the latest capabilities for using Oracle VM to deploy virtualized EBS database and application tier instances using prebuilt EBS templates, wire those virtualized instances together using the EBS virtualization kit, and take advantage of live migration of user sessions between failing application tier nodes.  (February 2011) 4. How to Reduce Total Cost of Ownership (TCO) Using Oracle E-Business Suite Management Packs (Presentation) Angelo Rosado (Product Manager, ATG Development) provides an overview of how EBS sysadmins can make their lives easier with the Management Packs for Oracle E-Business Suite Release 12.  This session highlights key features in Application Management Pack (AMP) and Application Change Management Pack) that can automate or streamline system configurations, monitor EBS performance and uptime, keep multiple EBS environments in sync with patches and configurations, and create patches for your own EBS customizations and apply them with Oracle's own patching tools.  (June 2011) 5. Upgrading E-Business Suite 11i Customizations to R12 (Presentation) Sara Woodhull (Principal Product Manager, ATG Development) provides an overview of how E-Business Suite developers can manage and upgrade existing EBS 11i customizations to R12.  Sara covers methods for comparing customizations between Release 11i and 12, managing common customization types, managing deprecated technologies, and more. (July 2011) 6. Tuning All Layers of E-Business Suite (Part 1 of 3) (Presentation) Lester Gutierrez, Senior Architect, and Deepak Bhatnagar, Senior Manager, from the E-Business Suite Application Performance team, lead Tuning All Layers of E-Business Suite (Part 1 of 3). This webcast provides an overview of how Oracle E-Business Suite system administrators, DBAs, developers, and implementers can improve E-Business Suite performance by following a performance tuning framework. Part 1 focuses on the performance triage approach, tuning applications modules, upgrade performance best practices, and tuning the database tier. This ATG Live Webcast is an expansion of the performance sessions at conferences that are perennial favourites with hardcore Apps DBAs. (August 2011)  7. Oracle E-Business Suite Directions: Deployment and System Administration (Presentation) Max Arderius, Manager Applications Technology Group, and Ivo Dujmovic, Director Applications Technology group, lead Oracle E-Business Suite Directions: Deployment and System Administration covering important changes in E-Business Suite R12.2. The changes discussed in this presentation include Oracle E-Business Suite architecture, installation, upgrade, WebLogic Server integration, online patching, and cloning. This webcast provides an overview of how Oracle E-Business Suite system administrators, DBAs, developers, and implementers can prepare themselves for these changes in R12.2 of Oracle E-Business Suite. (October 2011) Oracle University Courses For a general listing of all Oracle University courses related to E-Business Suite Technology, use the Oracle University E-Business Suite Technology course catalog link. Oracle University E-Business Suite Technology Course Catalog 1. R12 Oracle Applications System Administrator Fundamentals In this course students learn concepts and functions that are critical to the System Administrator role in implementing and managing the Oracle E-Business Suite. Topics covered include configuring security and user management, configuring flexfields, managing concurrent processing, and setting up other essential features such as profile options and printing. In addition, configuration and maintenance of an Oracle E-Business Suite through Oracle Applications Manager is discussed. Students also learn the fundamentals of Oracle Workflow including its setup. The System Administrator Fundamentals course provides the foundation needed to effectively control security and ensure smooth operations for an E-Business Suite installation. Demonstrations and hands-on practice reinforce the fundamental concepts of configuring an Oracle E-Business Suite, as well as handling day-to-day system administrator tasks. 2. R12.x Install/Patch/Maintain Oracle E-Business Suite This course will be applicable for customers who have implemented Oracle E-Business Suite Release 12 or Oracle E-Business Suite 12.1. This course explains how to go about installing and maintaining an Oracle E-Business Suite Release 12.x system. Both Standard and Express installation types are covered in detail. Maintenance topics include a detailed examination of the standard tools and utilities, and an in-depth look at patching an Oracle E-Business Suite system. After this course, students will be able to make informed decisions about how to install an Oracle E-Business Suite system that meets their specific requirements, and how to maintain the system afterwards. The extensive hands-on practices include performing an installation on a Linux system, navigating the file system to locate key files, running the standard maintenance tools and utilities, applying patches, and carrying out cloning operations. 3. R12.x Extend Oracle Applications: Building OA Framework Applications This class is a hands-on lab-intensive course that will keep the student busy and active for the duration of the course. While the course covers the fundamentals that support OA Framework-based applications, the course is really an exercise in J2EE programming. Over the duration of the course, the student will create an OA Framework-based application that selects, inserts, updates, and deletes data from a R12 Oracle Applications instance. 4. R12.x Extend Oracle Applications: Customizing OA Framework Applications This course has been significantly changed from the prior version to include additional deployments. The course doesn't teach the specifics of configuration of each product. That is left to the product-specific courses. What the course does cover is the general methods of building, personalizing, and extending OA Framework-based pages within the E-Business Suite. Additionally, the course covers the methods to deploy those types of customizations. The course doesn't include discussion of the Oracle Forms-based pages within the E-Business Suite. 5. R12.x Extend Oracle Applications: OA Framework Personalizations Personalization is the ability within an E-Business Suite instance to make changes to the look and behavior of OA Framework-based pages without programming. And, personalizations are likely to survive patches and upgrades, increasing their utility. This course will systematically walk you through the myriad of personalization options, starting with simple examples and increasing in complexity from there. 6. E-Business Suite: BI Publisher 5.6.3 for Developers Starting with the basic concepts, architecture, and underlying standards of Oracle XML Publisher, this course will lead a student through a progress of exercises building their expertise. By the end of the course, the student should be able to create Oracle XML Publisher RTF templates and data templates. They should also be able to deploy and maintain a BI Publisher report in an E-Business Suite instance. Students will also be introduced to Oracle BI Publisher Enterprise. 7. R12.x Implement Oracle Workflow This course provides an overview of the architecture and features of Oracle Workflow and the benefits of using Oracle Workflow in an e-business environment. You can learn how to design workflow processes to automate and streamline business processes, and how to define event subscriptions to perform processing triggered by business events. Students also learn how to respond to workflow notifications, how to administer and monitor workflow processes, and what setup steps are required for Oracle Workflow. Demonstrations and hands-on practice reinforce the fundamental concepts. 8. R12.x Oracle E-Business Suite Essentials for Implementers Oracle R12.1 E-Business Essentials for Implementers is a course that provides a functional foundation for any E-Business Suite Fundamentals course.

    Read the article

  • Webcast Replay Available: Technical Preview of EBS 12.2 Online Patching

    - by BillSawyer
    I am pleased to release the replay and presentation for ATG Live Webcast: Technical Preview of EBS 12.2 Online Patching (Presentation) Kevin Hudson, Senior Director and one of the Online Patching architects, discussed one of the cornerstone new features in our upcoming Oracle E-Business Suite 12.2 release. This ground-breaking feature is based upon Edition-Based Redefinition, a new 11gR2 Database feature that was built to Oracle Applications division specifications to allow the E-Business Suite's database tier to be patched while the environment is running.  Online Patching combines the use of Edition-Based Redefinition and new E-Business Suite technologies to allow patching to the E-Business Suite's database and application tier servers while the environment is being actively used by its end-users. (June 2012) Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • Webcast Replay Available: Scrambling Sensitive Data in E-Business Suite Release 12 Cloned Environments

    - by BillSawyer
    I am pleased to release the replay and presentation for ATG Live Webcast Scrambling Sensitive Data in EBS 12 Cloned Environments (Presentation) Eric Bing, Senior Director, Jagan Athreya, Enterprise Manager Product Management, and Elke Phelps, Senior Principal Product Manager, discussed the Oracle E-Business Suite Template for Data Masking Pack, and how it can be used in situations where confidential or regulated data needs to be shared with other non-production users who need access to some of the original data, but not necessarily every table.  Examples of non-production users include internal application developers or external business partners such as offshore testing companies, suppliers or customers. (July 2012) Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Choosing the Right JDeveloper Release for Your EBS Environment

    - by Sara Woodhull
    Oracle E-Business Suite developers use a special build of Oracle JDeveloper. This build contains the correct Oracle Application Framework (OA Framework or OAF) libraries corresponding to a specific version of Oracle E-Business Suite (specifically, to an ATG patch level). For customers and developers who are building OA Framework components and extensions to Oracle E-Business Suite, one of the first questions is "How do I find the right version of JDeveloper?"Oracle makes these OA Framework/JDeveloper builds available in separate patches when a new ATG patch level is released.   A handy My Oracle Support Document shows the ATG patch levels and the corresponding patch containing the correct version of JDeveloper with the right versions of OA Framework libraries:How to find the correct version of JDeveloper to use with eBusiness Suite 11i or Release 12.x (Doc ID 416708.1)

    Read the article

  • EBS Seed Data Comparison Reports Now Available

    - by Steven Chan (Oracle Development)
    Earlier this year we released a reporting tool that reports on the differences in E-Business Suite database objects between one release and another.  That's a very useful reference, but EBS defaults are delivered as seed data within the database objects themselves. What about the differences in this seed data between one release and another? I'm pleased to announce the availability of a new tool that provides comparison reports of E-Business Suite seed data between EBS 11.5.10.2, 12.0.4, 12.0.6, 12.1.1, and 12.1.3.  This new tool complements the information in the data model comparison tool.  You can download the new seed data comparison tool here: EBS ATG Seed Data Comparison Report (Note 1327399.1) The EBS ATG Seed Data Comparison Report provides report on the changes between different EBS releases based upon the seed data changes delivered by the product data loader files (.ldt extension) based on EBS ATG loader control (.lct extension) files.  You can use this new tool to report on the differences in the following types of seed data: Concurrent Program definitions Descriptive Flexfield entity definitions Application Object Library profile option definitions Application Object Library (AOL) key flexfield, function, lookups, value set definitions Application Object Library (AOL) menu and responsibility definitions Application Object Library messages Application Object Library request set definitions Application Object Library printer styles definitions Report Manager / WebADI component and integrator entity definitions Business Intelligence Publisher (BI Publisher) entity definitions BIS Request Set Generator entity definitions ... and more Your feedback is welcomeThis new tool was produced by our hard-working EBS Release Management team, and they're actively seeking your feedback.  Please feel free to share your experiences with it by posting a comment here.  You can also request enhancements to this tool via the distribution list address included in Note 1327399.1.Related Articles Oracle E-Business Suite Release 12.1.3 Now Available New Whitepaper: Upgrading EBS 11i Forms + OA Framework Personalizations to EBS 12 EBS 12.0 Minimum Requirements for Extended Support Finalized Five Key Resources for Upgrading to E-Business Suite Release 12 E-Business Suite Release 12.1.1 Consolidated Upgrade Patch 1 Now Available New Whitepaper: Planning Your E-Business Suite Upgrade from Release 11i to 12.1

    Read the article

  • What’s New for Oracle Commerce? Executive QA with John Andrews, VP Product Management, Oracle Commerce

    - by Katrina Gosek
    Oracle Commerce was for the fifth time positioned as a leader by Gartner in the Magic Quadrant for E-Commerce. This inspired me to sit down with Oracle Commerce VP of Product Management, John Andrews to get his perspective on what continues to make Oracle a leader in the industry and what’s new for Oracle Commerce in 2013. Q: Why do you believe Oracle Commerce continues to be a leader in the industry? John: Oracle has a great acquisition strategy – it brings best-of-breed technologies into the product fold and then continues to grow and innovate them. This is particularly true with products unified into the Oracle Commerce brand. Oracle acquired ATG in late 2010 – and then Endeca in late 2011. This means that under the hood of Oracle Commerce you have market-leading technologies for cross-channel commerce and customer experience, both designed and developed in direct response to the unique challenges online businesses face. And we continue to innovate on capabilities core to what our customers need to be successful – contextual and personalized experience delivery, merchant-inspired tools, and architecture for performance and scalability. Q: It’s not a slow moving industry. What are you doing to keep the pace of innovation at Oracle Commerce? John: Oracle owes our customers the most innovative commerce capabilities. By unifying the core components of ATG and Endeca we are delivering on this promise. Oracle Commerce is continuing to innovate and redefine how commerce is done and in a way that drive business results and keeps customers coming back for experiences tailored just for them. Our January and May 2013 releases not only marked the seventh significant releases for the solution since the acquisitions of ATG and Endeca, we also continue to demonstrate rapid and significant progress on the unification of commerce and customer experience capabilities of the two commerce technologies. Q: Can you tell us what was notable about these latest releases under the Oracle Commerce umbrella? John: Specifically, our latest product innovations give businesses selling online the ability to get to market faster with more personalized commerce experiences in the following ways: Mobile: the latest Commerce Reference Application in this release offers a wider range of examples for online businesses to leverage for iOS development and specifically new iPad reference capabilities. This release marks the first release of the iOS Universal application that serves both the iPhone and iPad devices from a single download or binary. Business users can now drive page content management and layout of search results and category pages, as well as create additional storefront elements such as categories, facets / dimensions, and breadcrumbs through Experience Manager tools. Cross-Channel Commerce: key commerce platform capabilities have been added to support cross-channel commerce, including an expanded inventory model to maintain inventory for stores, pickup in stores and Web-based returns. Online businesses with in-store operations can now offer advanced shipping options on the web and make returns and exchange logic easily available on the web. Multi-Site Capabilities: significant enhancements to the Commerce Platform multi-site architecture that allows business users to quickly launch and manage multiple sites on the same cluster and share data, carts, and other components. First introduced in 2010, with this latest release business users can now partition or share customer profiles, control users’ site-based access, and manage personalization assets using site groups. Internationalization: continued language support and enhancements for business user tools as well and search and navigation. Guided Search now supports 35 total languages with 11 new languages (including Danish, Arabic, Norwegian, Serbian Cyrillic) added in this release. Commerce Platform tools now include localized support for 17 locales with 4 new languages (Danish, Portuguese (European), Finnish, and Thai). No development or customization is required in order for business users to use the applications in any of these supported languages. Business Tool Experience: valuable new Commerce Merchandising features include a new workflow for making emergency changes quickly and increased visibility into promotions rules and qualifications in preview mode. Oracle Commerce business tools continue to become more and more feature rich to provide intuitive, easy- to-use (yet powerful) capabilities to allow business users to manage content and the shopping experience. Commerce & Experience Unification: demonstrable unification of commerce and customer experience capabilities include – productized cartridges that provide supported integration between the Commerce Platform and Experience Management tools, cross-channel returns, Oracle Service Cloud integration, and integrated iPad application. The mission guiding our product development is to deliver differentiated, personalized user experiences across any device in a contextual manner – and to give the business the best tools to tune and optimize those user experiences to meet their business objectives. We also need to do this in a way that makes it operationally efficient for the business, keeping the overall total cost of ownership low – yet also allows the business to expand, whether it be to new business models, geographies or brands. To learn more about the latest Oracle Commerce releases and mission, visit the links below: • Hear more from John about the Oracle Commerce mission • Hear from Oracle Commerce customers • Documentation on the new releases • Listen to the Oracle ATG Commerce 10.2 Webcast • Listen to the Oracle Endeca Commerce 3.1.2 Webcast

    Read the article

  • E-Business Suite Sessions at Sangam 2013 in Hyderabad

    - by Sara Woodhull
    The Sangam 2013 conference, sponsored jointly by the All-India Oracle Users' Group (AIOUG) and India Oracle Applucations Users Group (IOAUG), will be in Hyderabad, India on November 8-9, 2013.  This year, the E-Business Suite Applications Technology Group (ATG) will offer two speaker sessions and a walk-in usability test of upcoming EBS user interface features.  It's only about two weeks away, so make your plans to attend if you are in India. Sessions Oracle E-Business Suite Technology: Latest Features and Roadmap Veshaal Singh, Senior Director, ATG Development Friday, Nov. 9, 11:00-12:00 This Oracle development session provides an overview of Oracle's product strategy for Oracle E-Business Suite technology, the capabilities and associated business benefits of recent releases, and a review of capabilities on the product roadmap. This is the cornerstone session for Oracle E-Business Suite technology. Come hear about the latest new usability enhancements of the user interface; systems administration and configuration management tools; security-related updates; and tools and options for extending, customizing, and integrating Oracle E-Business Suite with other applications. Integration Options for Oracle E-Business Suite Rekha Ayothi, Lead Product Manager, ATG Friday, Nov. 9, 2:00-3:00 In this Oracle development session, you will get an understanding of how, when and where you can leverage Oracle's integration technologies to connect end-to-end business processes across your enterprise, including your Oracle Applications portfolio. This session offers a technical look at Oracle E-Business Suite Integrated SOA Gateway, Oracle SOA Suite, Oracle Application Adapters for Data Integration for Oracle E-Business Suite, and other options for integrating Oracle E-Business Suite with other applications. Usability Testing There will be multiple opportunities to participate in usability testing at Sangam '13.  The User Experience team is running a one-on-one usability study that requires advance registration.  In addition, we will be hosting a special walk-in usability lab to get feedback for new Oracle E-Business Suite OA Framework features.  The walk-in lab is a shorter usability experience that does not require any pre-registration.  In both cases, Oracle wants your feedback!  Even if you only have a few minutes, come by the User Experience Lab, meet the team, and try the walk-in lab.

    Read the article

  • The Internet of Things & Commerce: Part 3 -- Interview with Kristen J. Flanagan, Commerce Product Management

    - by Katrina Gosek, Director | Commerce Product Strategy-Oracle
    Internet of Things & Commerce Series: Part 3 (of 3) And now for the final installment my three part series on the Internet of Things & Commerce. Post one, “The Next 7,000 Days”, introduced the idea of the Internet of Things, followed by a second post interviewing one of our chief commerce innovation strategists, Brian Celenza.  This final post in the series is an interview with Kristen J. Flanagan, lead product manager for Oracle Commerce omnichannel strategy. She takes us through the past, present, and future of how our Commerce Solution is re-imagining the way physical and digital shopping come together. ------- QUESTION: It’s your job to stay on top of what our customers’ need to not only run their online businesses effectively, but also to make sure they have product capabilities they can innovate and grow on. What key trend has been top-of-mind for you and our customers around this collision of physical and digital shopping? Kristen: I’ll agree with Brian Celenza that hands down mobile has forced a major disruption in shopping and selling behavior. A few years ago, mobile exploded at a pace I don't think anyone was expecting. Early on, we saw our customers scrambling to establish a mobile presence---mostly through "screen scraping" technologies. As smartphones continued to advance (at lightening speed!), our customers started to investigate ways to truly tap in to their eCommerce capabilities to deliver the mobile experience. They started looking to us for a means of using the eCommerce services and capabilities to deliver a mobile experience that is tailored for mobile rather than the desktop experience on a smaller screen. In the future, I think we'll see customers starting to really understand what their shoppers need and expect from a mobile offering and how they can adapt their content and delivery of that content to meet those needs. And, mobile shopping doesn’t stop at the consumer / buyer. Because the in-store experience is compelling and has advantages that digital just can't offer, we're also starting to see the eCommerce services being leveraged for mobile for in-store sales associates. Brick-and-mortar retailers are interested in putting the omnichannel product catalog, promotions, and cart into the hands of knowledgeable associates. Retailers are now looking to connect and harness the eCommerce data in-store so that shoppers have a reason to walk-in. I think we'll be seeing a lot more customers thinking about melding the in-store and digital experiences to present a richer offering for shoppers.    QUESTION: What are some examples of what our customers are doing currently to bring these concepts to reality? Kristen: Well, without question, connecting digital and brick-and-mortar worlds is becoming tablestakes for selling experiences. If a brand has a foot in both worlds (i.e., isn’t a pureplay online retailer), they have to connect the dots because shoppers – whether consumers or B2B buyers –don't think in clearly defined channels anymore. The expectation is connectedness – for on- and offline experiences, promotions, products, and customer data. What does this mean practically for businesses selling goods on- and offline? It touches a lot of systems: inventory info on the eCommerce site, fulfillment options across channels (buy online/pickup in store), order information (representing various channels for a cohesive view of shopper order history), promotions across digital and store, etc.  A few years ago, the main link between store and digital was the smartphone. We all remember when “apps” became a thing and many of our customers were scrambling to get a native app out there. Now we're seeing more strategic thinking around the benefits of mobile web vs. native and how that ties in to the purpose and role of mobile within the digital channel. Put it more broadly, how these pieces fit together in the overall brand puzzle.  The same could be said for “showrooming.” Where it was a major concern (i.e., shoppers using stores to look at merchandise and then order online from Amazon), in recent months, it’s emerged that the inverse is now becoming a a reality as well. "Webrooming" (using digital sites to do research before making a purchase in the store) is a new behavior pure play retailers are challenged with. There are many technologies, behaviors, and information that need to tie together to offer a holistic omnichannel shopping experience. As a result, brands are looking for ways to connect the digital and in-store experiences to bridge the gaps: shared assortments across channels, assisted selling apps that arm associates with information about shoppers, shared promotions, inventory, etc. QUESTION: How has Oracle Commerce been built to help brands make the link between in-store and digital over the last few years? Kristen: Over the last seven years, the product has been in step with the changes in industry needs. Here is a brief history of the evolution: Prior to Oracle’s acquisition of ATG and Endeca, key investments were made to cross-channel functionality that we are still building on today. Commerce Service Center (v2007.1) ATG introduced the Commerce Service Center in 2007.1 and marked the first entry into what was then called “cross-channel.” The Commerce Service Center is a call-center-agent-facing application that enables agents to see shopper orders, online catalog, promotions, and pricing. It is tightly integrated with the eCommerce capabilities of the platform and commerce engine and provided a means of connecting data from the call center and online channels.  REST services framework (v9.1)  In v9.1 we introduced the REST services framework and interface in the Platform that enabled customers to use ATG web services in other applications. This framework has become the basis for our subsequent omni-channel features and functionality. Multisite Architecture (v10) With the v10 release, we introduced the Multisite Architecture, which enabled customers to manage multiple sites (and channels) within a single instance of the BCC. Customers could create site- and channel-specific catalogs, promotions, targeters, and scenarios. Endeca Page Builder (2.x) / Experience Manager (3.x) With the introduction of Endeca for Mobile (now part of the core platform, available through the reference store – see blow) on top of Page Builder (and then eventually Experience Manager), Endeca gave business users the tools to create and manage native and mobile web applications. And since the acquisition of both ATG (2011) and Endeca (2012), Oracle Commerce has leveraged the best of each leading technology’s capabilities for omnichannel commerce to continue to drive innovation for our customers. Service enablement of core Oracle Commerce capabilities (v10.1.1, 10.2, & 11) After the establishment of the REST services framework and interface, we followed up in subsequent releases with service enablement of core Oracle Commerce capabilities throughout the iOS native app and the enablement of the core Commerce Service Center features. The result is that customers can leverage these services for their integrations with other systems, as well as their omnichannel initiatives.  Mobile web reference application (v10.1) In 10.1 we introduced the shopper-facing mobile reference application that showed how to use Oracle Commerce to deliver a mobile web experience for shoppers. This included the use of Experience Manager and cartridges to drive those experiences on select pages.  Native (iOS) reference application (v10.1.1)  We came out with the 10.1.1 shopper-facing native iOS ref app that illustrated how to use the Commerce REST services to deliver an iOS app. Also included Experience Manager-driven pages.   Assisted Selling reference application (v10.2.1)  The Assisted Selling reference application is our first reference application designed for the in-store associate. This iOS app shows customers how they can use Oracle Commerce data and information to provide a high-touch, consultative sales environment as well as to put the endless aisle into hands of their associates. Shoppers can start a cart online, and in-store associates can access that cart via the application to provide more information or add products and then transact using the ATG engine. Support for Retail promotions (v11) As part of the v11 release, we worked with teams in the Oracle Retail Global Business Unit (RGBU) to assess which promotion types and capabilities are supported across our products. Those products included Oracle Commerce, Oracle Point of Service (ORPOS), and Oracle Retail Price Management (RPM). The result is that customers can now more easily support omnichannel use cases between the store and digital.  Making sure Oracle Commerce can help support the omnichannel needs of our customers is core to our product strategy. With 89% of consumers now use two or more channels to make a single purchase, ensuring that cross-channel interactions are linked is critical to a great customer experience – and to sales. As Oracle Commerce evolves, we want to make it simple for organizations to create, deliver, and scale experiences across touchpoints with our create once, deploy commerce anywhere framework. We have a flexible, services-oriented architecture that allows data, content, catalogs, cart, experiences, personalization, and merchandising to be shared across touchpoints and easily extended in to new environments like mobile, social, in-store, Call Center, and new Websites. [For the latest downloads and Oracle Commerce documentation, please visit the Oracle Technical Network.] ------ Thank you to both Brian and Kristen for their contributions and to this blog series and their continued thought leadership for Oracle Commerce. We are all looking forward to the coming years of months of new shopping behaviors and opportunities to innovate. Because – if the digital fabric of our everyday lives continues to change at the same pace – the next five years (that just under 2,000 days), will be dramatic. ---------- THIS DOCUMENT IS FOR INFORMATIONAL PURPOSES ONLY AND MAY NOT BE INCORPORATED INTO A CONTRACT OR AGREEMENT

    Read the article

  • You Can Deliver an Engaging Online Experience Across All Phases of the Customer Journey

    - by Christie Flanagan
    Engage. Empower. Optimize. Today’s customers have higher expectations and more choices than ever before.  To succeed in this environment, organizations must deliver an engaging online experience that is personalized, interactive and consistent across all phases of the customer journey. This requires a new approach that connects and optimizes all customer touch points as they research, select and transact with your brand.  Oracle WebCenter Sites combines with other customer experience applications such as Oracle ATG Commerce, Oracle Endeca, Oracle Real-Time Decisions and Siebel CRM to deliver a connected customer experience across your websites and campaigns. Attend this Webcast to learn how Oracle WebCenter: Works with Oracle ATG Commerce and Oracle Endeca to deliver consistent and engaging browsing, shopping and search experiences across all of your customer facing websites Enables you to optimize the performance of your online initiatives through integration with Oracle Real-Time Decisions for automated targeting and segmentation Connects with Siebel CRM to maintain a single view of the customer and integrate campaigns across channels Register now for the Webcast.

    Read the article

  • most popular j2ee based websites

    - by krishna
    J2EE as I understand is used to build Enterprise applications. My question is :What are the most popular public facing(internet) sites using j2ee stack. The one's that I know of are : linkedIn.com ,evite.com and sun ibm and oracle (obviously) Eclipse.org uses php, I wonder why? If you have worked on/know any other sites, can your share your experience and also the technologies used(if that's not an issue)? EDIT:It doesn't have to use the full stack. EDIT : There are quite a few ecommerce websites like bestbuy.com. I know this bcos I worked with the ATG(atg.com) ecommerce suite and their website lists their clients. Iam looking for those kind of examples and also your experience working on them. Please limit to only internet sites

    Read the article

  • E-Business Suite Technology Sessions at OpenWorld 2012

    - by Max Arderius
    Oracle OpenWorld 2012 is almost here! We're looking forward to updating you on our products, strategy, and roadmaps. This year, the E-Business Suite Applications Technology Group (ATG) will participate in 25 speaker sessions, two Meet the Experts round-table discussions, five demoground booths and seven Special Interest Group meetings as guest speakers. We hope to see you at our sessions.  Please join us to hear the latest news and connect with senior ATG development staff. Here's a downloadable listing of all Applications Technology Group-related sessions with times and locations: FOCUS ON Oracle E-Business Suite - Applications Tools and Technology (PDF) General Sessions GEN8474 - Oracle E-Business Suite - Strategy, Update, and RoadmapCliff Godwin, SVP, Oracle Monday, Oct 1, 12:15 PM - 1:15 PM - Moscone West 2002/2004 In this session, hear Oracle E-Business Suite General Manager Cliff Godwin deliver an update on the Oracle E-Business Suite product line. This session covers the value delivered by the current release of Oracle E-Business Suite, the momentum, and how Oracle E-Business Suite applications integrate into Oracle’s overall applications strategy. You’ll come away with an understanding of the value Oracle E-Business Suite applications deliver now and will deliver in the future. GEN9173 - Optimize and Extend Oracle Applications - The Path to Oracle Fusion ApplicationsNadia Bendjedou, Oracle; Corre Curtice, Bhavish Madurai (CSC) Tuesday, Oct 2, 10:15 AM - 11:15 AM - Moscone West 3002/3004 One of the main objectives of this session is to help organizations build their IT roadmap for the next five years and be aligned with the Oracle Applications strategy in general and the Oracle Fusion Applications strategy in particular. Come hear about some of the common sense, practical steps you can take to optimize the performance of your Oracle Applications today and prepare your path to Oracle Fusion Applications for when your organization is ready to embrace them. Each step you take in adopting Oracle Fusion technology gets you partway to Oracle Fusion Applications. Conference Sessions CON9024 - Oracle E-Business Suite Technology: Latest Features and Roadmap Lisa Parekh, Oracle Monday, Oct 1, 10:45 AM - 11:45 AM - Moscone West 2016 This Oracle development session provides a comprehensive overview of Oracle’s product strategy for Oracle E-Business Suite technology, the capabilities and associated business benefits of recent releases, and a review of capabilities on the product roadmap. This is the cornerstone session for the Oracle E-Business Suite technology stack. Come hear about the latest new usability enhancements of the user interface; systems administration and configuration management tools; security-related updates; and tools and options for extending, customizing, and integrating Oracle E-Business Suite with other applications. CON9021 - Oracle E-Business Suite Future Directions: Deployment and System AdministrationMax Arderius, Oracle Monday, Oct 1, 3:15 PM - 4:15 PM - Moscone West 2016  What’s coming in the next major version of Oracle E-Business Suite 12? This Oracle Development session covers the latest technology stack, including the use of Oracle WebLogic Server (Oracle Fusion Middleware 11g) and Oracle Database 11g Release 2 (11.2). Topics include an architectural overview of the latest updates, installation and upgrade options, new configuration options, and new tools for hot cloning and automated “lights-out” cloning. Come learn how online patching (based on the Oracle Database 11g Release 2 Edition-Based Redefinition feature) will reduce your database patching downtimes to however long it takes to bounce your database server. CON9017 - Desktop Integration in Oracle E-Business Suite 12.1 Padmaprabodh Ambale, Gustavo Jimenez, Oracle Monday, Oct 1, 4:45 PM - 5:45 PM - Moscone West 2016 This presentation covers the latest functional enhancements in Oracle Web Applications Desktop Integrator and Oracle Report Manager, enhanced Microsoft Office support, and greater support for building custom desktop integration solutions. The session also presents tips and tricks for upgrading from Oracle Applications Desktop Integrator to Oracle Web Applications Desktop Integrator and Oracle Report Manager. CON9023 - Oracle E-Business Suite Technology Certification Primer and Roadmap Steven Chan, Oracle Tuesday, Oct 2, 10:15 AM - 11:15 AM - Moscone West 2016  Is your Oracle E-Business Suite technology stack up to date? Are you taking advantage of all the latest options and capabilities? This Oracle development session summarizes the latest certifications and roadmap for the Oracle E-Business Suite technology stack, including elements such as database releases and options, Java, Oracle Forms, Oracle Containers for J2EE, desktop operating systems, browsers, JRE releases, development and Web authoring tools, user authentication and management, business intelligence, Oracle Application Management Packs, security options, clouds, Oracle VM, and virtualization. The session also covers the most commonly asked questions about tech stack component support dates and upgrade implications. CON9028 - Minimizing Oracle E-Business Suite Maintenance DowntimesSantiago Bastidas, Elke Phelps, Oracle Tuesday, Oct 2, 11:45 AM - 12:45 PM - Moscone West 2016 This Oracle development session features a survey of the best techniques sysadmins can use to minimize patching downtimes. It starts with an architectural-level review of Oracle E-Business Suite fundamentals and then moves to a practical view of the various tools and approaches for downtimes. Topics include patching shortcuts, merging patches, distributing worker processes across multiple servers, running ADPatch in noninteractive mode, staged APPL_TOPs, shared file systems, deferring systemwide database tasks, avoiding resource bottlenecks, and more. An added bonus: hear about the upcoming Oracle E-Business Suite 12 online patching capabilities based on the groundbreaking Oracle Database 11g Release 2 Edition-Based Redefinition feature. CON9116 - Extending the Use of Oracle E-Business Suite with the Oracle Endeca PlatformOsama Elkady, Muhannad Obeidat, Oracle Tuesday, Oct 2, 11:45 AM - 12:45 PM - Moscone West 2018 The Oracle Endeca platform includes a leading unstructured data correlation and analytics engine, together with a best-in class catalog search and guided navigation solution, to improve the productivity of all types of users in your enterprise. This development session focuses on the details behind the Oracle Endeca platform’s integration into Oracle E-Business Suite. It demonstrates how easily you can extend the use of the Oracle Endeca platform into other areas of Oracle E-Business Suite and how you can bring in your own data and build new Oracle Endeca applications for Oracle E-Business Suite. CON9005 - Oracle E-Business Suite Integration Best PracticesVeshaal Singh, Oracle, Jeffrey Hand, Zebra Technologies Tuesday, Oct 2, 1:15 PM - 2:15 PM - Moscone West 2018 Oracle is investing across applications and technologies to make the application integration experience easier for customers. Today Oracle has certified Oracle E-Business Suite on Oracle Fusion Middleware 11g and provides a comprehensive set of integration technologies. Learn about Oracle’s integration offering across data- and process-centric integrations. These technologies can be used to address various application integration challenges and styles. In this session, you will get an understanding of how, when, and where you can leverage Oracle’s integration technologies to connect end-to-end business processes across your enterprise, including your Oracle Applications portfolio.  CON9026 - Latest Oracle E-Business Suite 12.1 User Interface and Usability EnhancementsPadmaprabodh Ambale, Oracle Tuesday, Oct 2, 1:15 PM - 2:15 PM - Moscone West 2016 This Oracle development session details the latest UI enhancements to Oracle Application Framework in Oracle E-Business Suite 12.1. Developers will get a detailed look at new features to enhance usability, offer more capabilities for personalization and extensions, and support the development and use of dashboards and Web services. Topics include new rich UI capabilities such as new home page features, Navigator and Favorites pull-down menus, REST interface, embedded widgets for analytics content, Oracle Application Development Framework (Oracle ADF) task flows, third-party widgets, a look-ahead list of values, inline attachments, pop-ups, personalization and extensibility enhancements, business layer extensions, Oracle ADF integration, and mobile devices. CON8805 - Planning Your Oracle E-Business Suite Upgrade from 11i to Release 12.1 and BeyondAnne Carlson, Oracle Tuesday, Oct 2, 5:00 PM - 6:00 PM - Moscone West 3002/3004 Attend this session to hear the latest Oracle E-Business Suite 12.1 upgrade planning tips from Oracle’s support, consulting, development, and IT organizations. You’ll get specific cross-product advice on how to understand the factors that affect your project’s duration, decide on your project’s scope, develop a robust testing strategy, leverage Oracle Support resources, and more. In a nutshell, this session tells you things you need to know before embarking upon your Release 12.1 upgrade project. CON9053 - Advanced Management of Oracle E-Business Suite with Oracle Enterprise ManagerAngelo Rosado, Oracle Tuesday, Oct 2, 5:00 PM - 6:00 PM - Moscone West 2016 The task of managing and monitoring Oracle E-Business Suite environments can be very challenging. Oracle Enterprise Manager is the only product on the market that is designed to monitor and manage all the different technologies that constitute Oracle E-Business Suite applications, including end user, midtier, configuration, host, and database management—to name just a few. Customers that have implemented Oracle Enterprise Manager have experienced dramatic improvements in system visibility and diagnostic capability as well as administrator productivity. The purpose of this session is to highlight the key features and benefits of Oracle Enterprise Manager and Oracle Application Management Suite for Oracle E-Business Suite. CON8809 - Oracle E-Business Suite 12.1 Upgrade Best Practices: Technical InsightIsam Alyousfi, Udayan Parvate, Oracle Wednesday, Oct 3, 10:15 AM - 11:15 AM - Moscone West 3011 This session is ideal for organizations thinking about upgrading to Oracle E-Business Suite 12.1. It covers the fundamentals of upgrading to Release 12.1, including the technology stack components and supported upgrade paths. Hear from Oracle Development about the set of best practices for patching in general and executing the Release 12.1 technical upgrade, with special considerations for minimizing your downtime. Also get to know about relatively recent upgrade resources. CON9032 - Upgrading Your Customizations of Oracle E-Business Suite 12.1Sara Woodhull, Oracle Wednesday, Oct 3, 10:15 AM - 11:15 AM - Moscone West 2016 Have you personalized Oracle Forms or Oracle Application Framework screens in Oracle E-Business Suite? Have you used mod_plsql in Release 11i? Have you extended or customized your Release 11i environment with other tools? The technical options for upgrading these customizations as part of your Oracle E-Business Suite Release 12.1 upgrade can be bewildering. Come to this Oracle development session to learn about selecting the best upgrade approach for your existing customizations. The session will help you understand customization scenarios and use cases, tools, and technologies to ensure that your Oracle E-Business Suite Release 12.1 environment fits your users’ needs closely and that any future customizations will be easy to upgrade. CON9259 - Oracle E-Business Suite Internationalization and Multilingual FeaturesMaher Al-Nubani, Oracle Wednesday, Oct 3, 10:15 AM - 11:15 AM - Moscone West 2018 Oracle E-Business Suite supports more countries, languages, and regions than ever. Come to this Oracle development session to get an overview of internationalization features and capabilities and see new Release 12 features such as calendar support for Hijra and Thai, new group separators, lightweight multilingual support (MLS) setup, new character sets such as AL32UTF, newly supported languages, Mac certifications, Oracle iSetup support for moving MLS setups, new file export options for Unicode, new MLS number spelling options, and more. CON7188 - Mobile Apps for Oracle E-Business Suite with Oracle ADF Mobile and Oracle SOA SuiteSrikant Subramaniam, Joe Huang, Veshaal Singh, Oracle Wednesday, Oct 3, 10:15 AM - 11:15 AM - Moscone West 3001 Follow your mobile customers, employees, and partners with Oracle Fusion Middleware. See how native iPhone and iPad applications can easily be built for Oracle E-Business Suite with the new Oracle ADF Mobile and Oracle SOA Suite. Using Oracle ADF Mobile, developers can quickly develop native applications for Apple iOS and other mobile platforms. The Oracle SOA Suite/Oracle ADF Mobile combination can execute business transactions on Oracle E-Business Suite. This session includes a demo in which a mobile user approves a business transaction in Oracle E-Business Suite and a demo of the tools used to build a native on-device solution. These concepts for mobile applications also apply to other Oracle applications.CON9029 - Oracle E-Business Suite Directions: Slashing Downtimes with Online PatchingKevin Hudson, Oracle Wednesday, Oct 3, 11:45 AM - 12:45 PM - Moscone West 2016 Oracle E-Business Suite will soon include online patching (based on the Oracle Database 11g Release 2 Edition-Based Redefinition feature), which will reduce your database patching downtimes to however long it takes to bounce your database server. This Oracle development session details how online patching works, with special attention to what’s happening at a database object level when database patches are applied to an Oracle E-Business Suite environment that’s still running. Come learn about the operational and system management implications for minimizing maintenance downtimes when applying database patches with this new technology and the related impact on customizations you might have built on top of Oracle E-Business Suite. CON8806 - Upgrading to Oracle E-Business Suite 12.1: Technical and Functional PanelAndrew Katz, Komori America Corporation; Sandra Vucinic, VLAD Group, Inc. ;Srini Chavali, Cummins Inc.; Amrita Mehrok, Nadia Bendjedou, Anne Carlson Oracle Wednesday, Oct 3, 1:15 PM - 2:15 PM - Moscone West 2018 In this panel discussion, Oracle experts, customers, and partners share their experiences in upgrading to the latest release of Oracle E-Business Suite, Release 12.1. The panelists cover aspects of a typical Release 12 upgrade, technical (upgrading the technical infrastructure) as well as functional (upgrading to the new financial infrastructure). Hear directly from the experts who either develop the product or support, implement, or upgrade it, and find out how to apply their lessons learned to your organization. CON9027 - Personalize and Extend Oracle E-Business Suite Applications with Rich MashupsGustavo Jimenez, Padmaprabodh Ambale, Oracle Wednesday, Oct 3, 1:15 PM - 2:15 PM - Moscone West 2016 This session covers the use of several Oracle Fusion Middleware technologies to personalize and extend your existing Oracle E-Business Suite applications. The Oracle Fusion Middleware technologies covered include Oracle Application Development Framework (Oracle ADF), Oracle WebCenter, Oracle Endeca applications, and Oracle Business Intelligence Enterprise Edition with Oracle E-Business Suite Oracle Application Framework applications. CON9036 - Advanced Oracle E-Business Suite Architectures: Maximum Availability, Security, and MoreElke Phelps, Oracle Wednesday, Oct 3, 3:30 PM - 4:30 PM - Moscone West 2016 This session includes architecture diagrams and configuration instructions for building a maximum availability architecture (MAA) that will help you design a disaster recovery solution that fits the needs of your business. Database and application high-availability features it describes include Oracle Data Guard, Oracle Real Application Clusters (Oracle RAC), Oracle Active Data Guard, load-balancing Web and forms services, parallel concurrent processing, and the use of Oracle Exalogic and Oracle Exadata to provide a highly available environment. The session also covers the latest updates to systems management tools, AutoConfig, cloud computing, virtualization, and Oracle WebLogic Server and provides sneak previews of upcoming functionality. CON9047 - Efficiently Scaling Oracle E-Business Suite on Oracle Exadata and Oracle ExalogicIsam Alyousfi, Nishit Rao, Oracle Wednesday, Oct 3, 5:00 PM - 6:00 PM - Moscone West 2016 Oracle Exadata and Oracle Exalogic are designed from the ground up with optimizations in software and hardware to deliver superfast performance for mission-critical applications such as Oracle E-Business Suite. Oracle E-Business Suite applications run three to eight times as fast on the Oracle Exadata/Oracle Exalogic platform in standard benchmark tests. Besides performance, customers benefit from simplified support, enhanced manageability, and the ability to consolidate multiple Oracle E-Business Suite instances. Attend this session to understand best practices for Oracle E-Business Suite deployment on Oracle Exalogic and Oracle Exadata through customer case studies. Learn how adopting the Exa* platform increases efficiency, simplifies scaling, and boosts performance for peak loads. CON8716 - Web Services and SOA Integration Options for Oracle E-Business SuiteRekha Ayothi, Veshaal Singh, Oracle Thursday, Oct 4, 11:15 AM - 12:15 PM - Moscone West 2016 This Oracle development session provides a deep dive into a subset of the Web services and SOA-related integration options available to Oracle E-Business Suite systems integrators. It offers a technical look at Oracle E-Business Suite Integrated SOA Gateway, Oracle SOA Suite, Oracle Application Adapters for Data Integration for Oracle E-Business Suite, and other Web services options for integrating Oracle E-Business Suite with other applications. Systems integrators and developers will get an overview of the latest integration capabilities and technologies available out of the box with Oracle E-Business Suite and possibly a sneak preview of upcoming functionality and features. CON9030 - Recommendations for Oracle E-Business Suite Performance TuningIsam Alyousfi, Samer Barakat, Oracle Thursday, Oct 4, 11:15 AM - 12:15 PM - Moscone West 2018 Need to squeeze more performance out of your existing servers? This packed Oracle development session summarizes practical tips and lessons learned from performance-tuning and benchmarking the world’s largest Oracle E-Business Suite environments. Apps sysadmins will learn concrete tips and techniques for identifying and resolving performance bottlenecks on all layers, with special attention to application- and database-tier servers. Learn about tuning Oracle Forms, Oracle Concurrent Manager, Apache, and Oracle Discoverer. Track down memory leaks and other issues at the Java and JVM layers. The session also covers Oracle E-Business Suite product-level tuning, including Oracle Workflow, Oracle Order Management, Oracle Payroll, and other modules. CON3429 - Using Oracle ADF with Oracle E-Business Suite: The Full Integration ViewSiva Puthurkattil, Lake County; Juan Camilo Ruiz, Sara Woodhull, Oracle Thursday, Oct 4, 11:15 AM - 12:15 PM - Moscone West 3003 Oracle E-Business Suite delivers functionality for handling the core business of your organization. However, user requirements and new technologies are driving an emerging need to implement new types of user interfaces for these applications. This session provides an overview of how to use Oracle Application Development Framework (Oracle ADF) to deliver cutting-edge Web 2.0 and mobile rich user interfaces that front existing Oracle E-Business Suite processes, and it also explores all the existing types of integration between the two worlds. CON9020 - Integrating Oracle E-Business Suite with Oracle Identity Management SolutionsSunil Ghosh, Elke Phelps, Oracle Thursday, Oct 4, 12:45 PM - 1:45 PM - Moscone West 2016 Need to integrate Oracle E-Business Suite with Microsoft Windows Kerberos, Active Directory, CA Netegrity SiteMinder, or other third-party authentication systems? Want to understand your options when Oracle Premier Support for Oracle Single Sign-On ends in December 2011? This Oracle Development session covers the latest certified integrations with Oracle Access Manager 11g and Oracle Internet Directory 11g, which can be used individually or as bridges for integrating with third-party authentication solutions. The session presents an architectural overview of how Oracle Access Manager, its WebGate and AccessGate components, and Oracle Internet Directory work together, with implications for Oracle Discoverer, Oracle Portal, and other Oracle Fusion identity management products. CON9019 - Troubleshooting, Diagnosing, and Optimizing Oracle E-Business Suite TechnologyGustavo Jimenez, Oracle Thursday, Oct 4, 2:15 PM - 3:15 PM - Moscone West 2016 This session covers how you can proactively diagnose Oracle E-Business Suite applications, including extensions built with Oracle Fusion Middleware technologies such as Oracle Application Development Framework (Oracle ADF) and Oracle WebCenter to catch potential issues in the middle tier before they become more serious. Topics include debugging, logging infrastructure, warning signs, performance tuning, information required when logging service requests, general JVM optimization, and an overall picture of all the moving parts that make it possible for Oracle E-Business Suite to isolate and fix problems. Also learn how Oracle Diagnostics Framework will help prevent downtime caused by failures. CON9031 - The Top 10 Things You Can Do to Secure Your Oracle E-Business Suite InstanceEric Bing, Erik Graversen, Oracle Thursday, Oct 4, 2:15 PM - 3:15 PM - Moscone West 2018 Learn the top 10 things you can do to secure your applications and your sensitive data. This Oracle development session for system administrators and security professionals explores some of the most important and overlooked things you can do to secure your Oracle E-Business Suite instance. It also covers data masking and other mechanisms for protecting sensitive data. Special Interest Groups (SIG) Some of our most senior staff have been invited to participate on the following SIG meetings as guest speakers: SIG10525 - OAUG - Archive & Purge SIGBrian Bent - Pre-Sales Engineer, TierData, Inc. Sunday, Sep 30, 10:30 AM - 12:00 PM - Moscone West 3011 The Archive and Purge SIG is an organization in which users can share their experiences and solicit functional and technical advice on archiving and purging data in Oracle E-Business Suite. This session provides an opportunity for users to network and share best practices, tips, and tricks. Guest: Oracle E-Business Suite Database Performance, Archive & Purging - Q&A SessionIsam Alyousfi, Senior Director, Applications Performance, Oracle SIG10547 - OAUG - Oracle E-Business (EBS) Applications Technology SIGSrini Chavali - IT Director, Cummins Inc Sunday, Sep 30, 10:30 AM - 12:00 PM - Moscone West 3018 The general purpose of the EBS Applications Technology SIG is to inform and educate its members about current and future components of the tech stack as they relate to Oracle E-Business Suite. Attend this meeting for networking and education and to share best practices. Guest: Oracle E-Business Suite Technology Certification Roadmap - Presentation and Q&ASteven Chan, Sr. Director, Applications Technology Group, Oracle SIG10559 - OAUG - User Management SIGSusan Behn - VP of Oracle Delivery, Infosemantics, Inc. Sunday, Sep 30, 10:30 AM - 12:00 PM - Moscone West 3024 The E-Business Suite User Management SIG focuses on the components of user management that enable Oracle E-Business Suite users to define administrative functions and manage users’ access to functions and data based on roles within an organization—rather than the user’s individual identity—which is referred to as role-based access control (RBAC). This meeting includes an introduction to Oracle User Management that covers the Oracle User Management building blocks and presents an example of creating a security policy.Guest: Security and User Management - Q&A SessionEric Bing, Sr. Director, EBS Security, OracleSara Woodhull, Principal Product Manager, Applications Technology Group, Oracle SIG10515 - OAUG – Upgrade SIGBarbara Matthews - Consultant, On Call DBASandra Vucinic, VLAD Group, Inc. Sunday, Sep 30, 12:00 PM - 2:00 PM - Moscone West 3009 This Upgrade SIG session starts with a business meeting and then features a Q&A panel discussion on Oracle E-Business Suite upgrade topics. The session• Reviews Upgrade SIG goals and objectives• Provides answers, during the Q&A session, to questions related to Oracle E-Business Suite upgrades• Shares “real world” experiences, tips, and techniques for Oracle E-Business Suite upgrades to Release 12.1. Guest: Oracle E-Business Suite Upgrade - Q&A SessionAnne Carlson - Sr. Director, Oracle E-Business Suite Product Strategy, OracleUdayan Parvate - Director, EBS Release Engineering, OracleSuzana Ferrari, Sr. Principal Consultant, OracleIsam Alyousfi, Sr. Director, Applications Performance, Oracle SIG10552 - OAUG - Oracle E-Business Suite SIGDonna Rosentrater - Manager, Global Sourcing & Procurement Systems, TJX Sunday, Sep 30, 12:15 PM - 1:45 PM - Moscone West 3020 The E-Business Suite SIG, affiliated with OAUG, supports Oracle E-Business Suite users through networking, education, and sharing of best practices. This SIG meeting will feature a general discussion of Oracle E-Business Suite product strategies in Release 12 and migration to Oracle Fusion Applications. Guest: Oracle E-Business Suite - Q&A SessionJeanne Lowell, Vice President, EBS Product Strategy, OracleNadia Bendjedou, Sr. Director, Product Strategy, Oracle SIG10556 - OAUG - SysAdmin SIGRandy Giefer - Sr Systems and Security Architect, Solution Beacon, LLC Sunday, Sep 30, 12:15 PM - 1:45 PM - Moscone West 3022 The SysAdmin SIG provides a forum in which OAUG members and participants can share updates, tips, and successful practices relating to system administration in an Oracle applications environment. The SysAdmin SIG strives to enable system administrators to become more effective and efficient in their jobs by providing them with access to people and information that can increase their system administration knowledge and experience. Attend this meeting to network, share best practices, and benefit from educational content. Guest: Oracle E-Business Suite 12.2 Online Patching- Presentation and Q&AKevin Hudson, Sr. Director, Applications Technology Group, Oracle SIG10553 - OAUG - Database SIGMichael Brown - Senior DBA, COLIBRI LTD LC Sunday, Sep 30, 2:00 PM - 3:15 PM - Moscone West 3020 The OAUG Database SIG provides an opportunity for applications database administrators to learn from and share their experiences with supporting the various Oracle applications environments. This session will include a brief business meeting followed by a short presentation. It will end with an open discussion among the attendees about items of interest to those present. Guest: Oracle E-Business Suite Database Performance - Presentation and Q&AIsam Alyousfi, Sr. Director, Applications Performance, Oracle Meet the Experts We're planning two round-table discussions where you can review your questions with senior E-Business Suite ATG staff: MTE9648 - Meet the Experts for Oracle E-Business Suite: Planning Your Upgrade Jeanne Lowell - VP, EBS Product Strategy, Oracle John Abraham - Sr. Principal Product Manager, Oracle Nadia Bendjedou - Sr. Director - Product Strategy, Oracle Anne Carlson - Sr. Director, Applications Technology Group, Oracle Udayan Parvate - Director, EBS Release Engineering, Oracle Isam Alyousfi, Sr. Director, Applications Performance, Oracle Monday, Oct 1, 3:15 PM - 4:15 PM - Moscone West 2001A Don’t miss this Oracle Applications Meet the Experts session with experts who specialize in Oracle E-Business Suite upgrade best practices. This is the place where attendees can have informal and semistructured but open one-on-one discussions with Strategy and Development regarding Oracle Applications strategy and your specific business and IT strategy. The experts will be available to discuss the value of the latest releases and share insights into the best path for your enterprise, so come ready with your questions. Space is limited, so make sure you register. MTE9649 - Meet the Oracle E-Business Suite Tools and Technology Experts Lisa Parekh - Vice President, Technology Integration, Oracle Steven Chan - Sr. Director, Oracle Elke Phelps - Sr. Principal Product Manager, Applications Technology Group, Oracle Max Arderius - Manager, Applications Technology Group, Oracle Tuesday, Oct 2, 1:15 PM - 2:15 PM - Moscone West 2001A Don’t miss this Oracle Applications Meet the Experts session with experts who specialize in Oracle E-Business Suite technology. This is the place where attendees can have informal and semistructured but open one-on-one discussions with Strategy and Development regarding Oracle Applications strategy and your specific business and IT strategy. The experts will be available to discuss the value of the latest releases and share insights into the best path for your enterprise, so come ready with your questions. Space is limited, so make sure you register. Demos We have five booths in the exhibition demogrounds this year, where you can try ATG technologies firsthand and get your questions answered. Please stop by and meet our staff at the following locations: Advanced Architecture and Technology Stack for Oracle E-Business Suite (W-067) New User Productivity Capabilities in Oracle E-Business Suite (W-065) End-to-End Management of Oracle E-Business Suite (W-063) Oracle E-Business Suite 12.1 Technical Upgrade Best Practices (W-066) SOA-Based Integration for Oracle E-Business Suite (W-064)

    Read the article

  • E-Business Suite Certified with DB 11.2.0.2 on HP-UX Itanium and IBM AIX on Power

    - by Steven Chan
    As a follow-on to our previous certification announcement, Oracle Database 11g Release 2 (11.2.0.2) s now certified with Oracle E-Business Suite Release 12 (12.0.x and 12.1.x) and 11i (11.5.10.2 + ATG PF.H RUP 6 and higher) on the following additional platforms:Oracle E-Business Suite Release 12HP-UX Itanium (11.31) IBM AIX on Power Systems (64-bit) (5.3, 6.1) Oracle E-Business Suite Release 11iIBM AIX on Power Systems (64-bit) (5.3, 6.1)

    Read the article

< Previous Page | 1 2 3 4 5 6  | Next Page >