Search Results

Search found 1931 results on 78 pages for 'clever human'.

Page 30/78 | < Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • Multi language CMS?

    - by Adam
    Is there any CMS such as expression engine or wordpress that allows a user to click a button and convert all the text to another language (it would have to be human generated otherwise it has too many mistakes probably). I'd like to know if there are any good solutions out there that work for real world use, in like business company websites.

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

  • Write easily readable XML in Python

    - by dutch
    Is there any way other than creating a method myself to write XML using python which are easily readable? xMLFile.write(xmlDom.toxml()) does create proper xml but reading them is pretty difficult. I tried toprettyxml but doesn't seem like it does much. e.g. following is what I would consider a human readable xml:

    Read the article

  • sequential minimal optimization C++

    - by Anton
    Hello. I want to implement the method of SVM. But the problem appeared in his training. It was originally planned to use SMO, but did not find ready-made libraries for C++. If there is a ready, then share it. Thank you in advance. The problem of finding an object in the picture (probably human)

    Read the article

  • Changing keyboard layout on application focus

    - by Anonymous Coward
    Hi Everyone As everybody knows the en-US Keyboard-layout is the best one for programming. So I'd like to use it in my IDEs. But since I live in a non-en-US country I need the de-CH layout for all other applications. Now I wonder if it is possible to set the layout depending to which application currently has the focus. If that is possible, can a human brain adapt to such a behaviour or is it just confusing? cheers, AC

    Read the article

  • Is it possible to edit a sound file based on frequency???

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Digital clocking systems/software? (employee clocking)

    - by Bill
    How does a digital clocking system deal with user error such as someone forgetting to clock out or someone erroneously entering their code causing them to clock someone else in/out (who might not even be on the schedule that day). Its obvious there could be issues of dishonesty, but what about human error?

    Read the article

  • How do I detect bots programatically

    - by Tom
    we have a situation where we log visits and visitors on page hits and bots are clogging up our database. We can't use captcha or other techniques like that because this is before we even ask for human input, basically we are logging page hits and we would like to only log page hits by humans. Is there a list of known bot IP out there? Does checking known bot user-agents work?

    Read the article

  • Where can I find some good tutorials for C++

    - by Rob
    My friend has convinced me to start learning some C++, so my question is simple: where can I find some good tutorials for it? But please don't link me to the usual dry boring tutorials that only tells you the function syntax, I need more thorough explanations. I get sidetracked very easily, and I need tutorials that are more on a human level, that I'll not only learn from, but enjoy reading as well. So I'd appreciate any links that would help :)

    Read the article

  • Money Transaction without using in-app purchase for iphone app

    - by Jaydevsinh Gohil
    I want to implement the payment gateway like functionality in my iphone application other than In-App Purchase feature provided by Apple. So, i have one Question regarding the application approval on Appstore that, if i will redirect user to the UIwebview for payment related functionality, then apple will reject this application for not following the human interface guideline or it will allow this. Other way i can do it by calling web-service for the transaction of money. So, again there is any chance of app rejection on AppStore. Please share your thought on this

    Read the article

  • Windows Azure and dynamic elasticity

    - by Ryan Elkins
    Is there a way do do dynamic elasticity in Windows Azure? If my workers begin to get overloaded, or queues start to get too full, or too many workers have no work to do, is there a way to dynamically add or remove workers through code or is that just done manually (requires human intervention) right now? Does anyone know of any plans to add that if its not currently available?

    Read the article

  • How to access the database when developing on a phone?

    - by Pentium10
    I am having trouble accessing the database while I am developing on the phone. Whenever I execute cd /data/data/com.mycompck/databases then if I try to run ls I get opendir failed, Permission denied Or whenever I type in: sqlite3 I get sqlite3: permission denied What I am doing wrong? Are there some applications that can help me getting a human view of content resolvers values and/or SQLite databases?

    Read the article

  • How should I interpret site analytics with 11 pageviews in an 3 second visit?

    - by Juank
    I'm using google analytics and recently i've noticed some weird trends going on. I have a lot of visits that last mere seconds but mark several page views... more than a normal human can see in that range of time. A specific case is that the only visitor from Ireland i've had until now recorded 11 pageviews in a 3 second visit. Are these crawlers? Shouldn't google analytics filter those out?

    Read the article

< Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >