Search Results

Search found 31717 results on 1269 pages for 'response write'.

Page 30/1269 | < Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >

  • Allow WRITE access to local folders machine in 2003SBS AD

    - by Dan M.
    Have a SBS2003 client with a mess of a domain that is in process of being cleaned. But, for the life of me I cannot find a setting that will allow write access to the local hard disk for domain users with redirected profiles(to the server). This is needed only for one program that will not follow a symbolic link to the network path, instead it seems to be hard coded to the %appdata% folder but only on the c: drive.... So question is how can I allow "Domain users" write access to the local %appdata% directory? I have tried setting it manually on a machine but it kept resetting to RO no matter how many times I tried. Every time I would un-check the RO property it would reset sometime right after i hit OK. Thanks in advance! Dan

    Read the article

  • Using Extended ACLs to control write access?

    - by tocapa
    I am trying to set up file uploading on a website, but I get a permissions error when trying to write to upload directory. When I asked my supervisor about this, he suggested using extended ACLs to give the server write access to the directory. I've looked ACLs and nothing has suggested to me that this is the right way to go. Am I just not looking in the right place? How would I use ACLs to do this, or if not, what would be the right way to go about this? Forgive me for I've never used ACLs before so I don't know what I'm talking about.

    Read the article

  • Write to windows share mounted in Ubuntu

    - by aidan
    I used to mount a windows share in Ubuntu server, with an entry in fstab: //data/SharedFolder /media/SharedFolder/ smbfs user,defaults,credentials=/root/.creds,uid=root,gid=root 0 0 /root/.creds is a text file with three lines, my username, password and domain. Users on the ubuntu server could write to this mount, but then I upgraded to 10.04 and now only root can write. Regular users can still read though. mount currently tells me: //data/SharedFolder on /media/SharedFolder type cifs (rw,mand,noexec,nosuid,nodev) How do I make it world writeable again? Thanks

    Read the article

  • Grant account write access to specific attributes on Active Directory User object

    - by Patricker
    I am trying to allow an account to update very specific attributes on all User objects. I am setting this security on the "User" object. When I add the account on the security tab, go to advanced, edit the accounts permissions, and start going through the list of attributes I am only able to find a few, like First Name, but most of the attributes I want to let them write to are missing. How can I grant the account write access to these attributes? Attributes I need to grant permission for: First Name (givenName) Last Name (sn) Initials (initials) Department (department) Company (company) Title (title) Manager (manager) Location Info (physicalDeliveryOfficeName, streetAddress, postOfficeBox) Work Phone (telephoneNumber) Pager (pager) IP Phone (ipPhone) IP Phone Other (otherIpPhone) ThumbnailLogo (thumbnailLogo) jpegPhoto (jpegPhoto) Description (displayName) Thanks

    Read the article

  • www-data is unable to write to an NFS share

    - by Bastian
    On Debian Squeeze, I created an NFS share with these options rw,sync,no_root_squash,no_subtree_check,insecure and on the other Debian Squeeze I can successfully mount it and read write with root, but this share is intended to be used by Apache. I changed the permission to 777 just to make sure. And still, the www-data user can read, create files but not write to them! It does not sound to me like the typical permissions problem, maybe something related to NFS, a lock problem that I am not aware of. Any idea is welcome.

    Read the article

  • Does aria2 support write small files in batch?

    - by Jon
    I'm using aria2 to download 8 million jpg from flickr. Each image is about 100KB. I got a list of urls of these images in a txt file, the format is: http://farm2.staticflickr.com/1070/1151334893_5a8e7f77f4.jpg I'm wondering whether aria2 support writing small files in batch? Say write 100 image to disk when all of them are download in the memory, not just write every single file when the download is finished. Because I think writing in batch will better protect my hard disk. Or do you have other software or opensource code to recommend?

    Read the article

  • How to configure Notepad++ (Scintilla) to write below EOF after EOL [on hold]

    - by Piotr Piaseczny
    Is it possible to configure scintilla to "brake" EOL/EOF while writing ? Now, if I want to begin writing in a column after EOL, I use ALT+left mouse button and start typing after click. No idea how to begin writing below EOF. Pressing Enter key many times is the only method now. Other explanation: If You open a new document, doesnt matter what kind of (php/txt etc) all You have is just one line. If You want to write in line 5 - must press Enter 5 times. Every other editor I know (IDE in Builder C++/MultiEdit) "ignore" eof and you can write anywhere in document. Because of php/html I've found notepad++ as a best editor but I'd like to "brake" limitations of (probably) scintilla

    Read the article

  • How to write to Samba folder?

    - by Darren
    Hi all, I created a Samba share on my CentOS machine and I can connect to the share and read the contents but I cannot write files to it or delete them. In Samba I have set readable to yes and writeable to yes, as well as made the folder I want to access apart of the wheel group of which I added the user that is accessing it from Samba. The folder in quesiton is /var/www/. I have set that folder and all folders under it to the wheel group which can read and write to it. What am I doing wrong here?

    Read the article

  • How to write to Samba folder?

    - by Darren
    I created a Samba share on my CentOS machine and I can connect to the share and read the contents but I cannot write files to it or delete them. In Samba I have set readable to yes and writeable to yes, as well as made the folder I want to access apart of the wheel group of which I added the user that is accessing it from Samba. The folder in quesiton is /var/www/. I have set that folder and all folders under it to the wheel group which can read and write to it. What am I doing wrong here?

    Read the article

  • USB Permission - Write protection

    - by dekhadmai
    I have an external harddisk and my friends asked for it. The point is I don't trust in his anti-virus software. Is there anyway to allow some folders (I prepare hdd space for him) to write-able and all others is read-only ? or is there a software that can do like this ? And it would be great if I can have full access on my computer ONLY (may be with some specific software on my PC) and without having to modify anything. I don't ask for hdd-encryption since I only want to limit the area of write-able folder (and allow my friend to read through all my data), later I can scan for virus myself only in that area ... scanning entire hdd with 500gb/friend is not fun at all ! Sorry if this doesn't seems like the programming questions. Any help would be appreciate, Thank you.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • IIS7 Integrated Pipeline - Response.End not ending the request.

    - by MikeGurtzweiler
    I have the following bit of code that worked as expected before we upgraded to Integrated Pipeline in IIS7. public void RedirectPermanently(string url, bool clearCookies) { Response.ClearContent(); Response.StatusCode = 301; Response.AppendHeader("Location", url); if(clearCookies) { Response.Cookies.Clear(); Response.Flush(); Response.End(); } } Previously when this method was executed, if clearCookies was true, the response would be sent to the client and request processing would end. Now under Integrated Pipeline Response.End() does not seem to end processing. The page continues running as if the method was never called. Big question is, why and what changed! Thanks.

    Read the article

  • c# write big files to blob sqlite

    - by brizjin-gmail-com
    I have c# application which write files to sqlite database. It uses entity fraemwork for modeling data. Write file to blob (entity byte[] varible) with this line: row.file = System.IO.File.ReadAllBytes(file_to_load.FileName); //row.file is type byte[] //row is entity class table All work correctly when files size is less. When size more 300Mb app throw exception: Exception of type 'System.OutOfMemoryException' was thrown. How I can write to blob direct, without memory varibles?

    Read the article

  • How does DataContractSerializer write to private fields?

    - by Eric
    I understand how XMLSerializer could work by using reflection to figure out what public read/write fields or properties it should be using to serialize or de-serialize XML. Yet XMLSerializer requires that the fields be public and read/write. However, DataContractSerializer is able to read or write to or from completely private fields in a class. So I'm wondering how this is even possible with out explicitly giving DataContractSerializer additional access rights to my class(es).

    Read the article

  • write c++ in latex, noob latex question

    - by voodoomsr
    maybe is a noob question but i can't find the solution in the web, i need to write C++ in Latex. I write C$++$ but the result is like crap, the signs are too big and there is too much space between C and the first plus sign. Previously i needed to write the sharp symbol for C#....c$\sharp$ it also looks like crap but with a escape character it looks nice, for the plus sign i can't do the same.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Caching the xml response from a HttpHandler

    - by Blankman
    My HttpHandler looks like: public void ProcessRequest(HttpContext context) { context.Response.ContentType = "text/xml"; XmlWriter writer = new XmlTextWriter(context.Response.OutputStream, Encoding.UTF8); writer.WriteStartDocument(); writer.WriteStartElement("ProductFeed"); DataTable dt = GetStuff(); for(...) { } writer.WriteEndElement(); writer.WriteEndDocument(); writer.Flush(); writer.Close(); } How can I cache the entire xml document that I am generating? Or do I only have the option of caching the DataTable object?

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • How do i write this jpql query?

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Howto specify format of Restlet-response in browser?

    - by martin
    Hello everybody, i've started to introduce myself into REST. I use as REST-framework Restlet. I have defined a resource with methods for the GET with several response formats like @Get("xml") @Get("json") I now want to test my defined response-formats with my browser, but I don't know which parameter I have to specify in my URL to get the format. Something like: http://localhost:8182/members?type=xml I've tried some param-names, but I couldn't find the right param-name. I know that there must be such a parameter, because I've seen it already in an URL, but i forgot the name and couldn't find it in the net. How is the name of this parameter when using restlet? I would be pleased, if somebody can help me, thanks, Martin

    Read the article

  • Using XStream to deserialize an XML response with separate "success" and "failure" forms?

    - by Chris Markle
    I am planning on using XStream with Java to convert between objects and XML requests and XML responses and objects, where the XML is flowing over HTTP/HTTPS. On the response side, I can get a "successful" response, which seems like it would map to one Java class, or a "failure" response, which seems like it would map to another Java class. For example, for a "file list" request, I could get an affirmative response e.g., <?xml version="1.0" encoding="UTF-8"?> <response> <success>true</success> <files> <file>[...]</file> <file>[...]</file> <file>[...]</file> </files> </response> or I could get a negative response e.g., <?xml version="1.0" encoding="UTF-8"?> <response> <success>false</success> <error> <errorCode>-502</errorCode> <systemMessage>[...]AuthenticationException</systemMessage> <userMessage>Not authenticated</userMessage> </error> </response> To handle this, should I include fields in one class for both cases or should I somehow use XStream to "conditionally" create one of the two potential classes? The case with fields from both response cases in the same object would look something like this: Class Response { boolean success; ArrayList<File> files; ResponseError error; [...] } Class File { String name; long size; [...] } Class ResponseError { int errorCode; String systemMessage; String userMessage; [...] } I don't know what the "use XStream and create different objects in case of success or error" looks like. Is it possible to do that somehow? Is it better or worse way to go? Anyway, any advice on how to handle using XStream to deal with this success vs. failure response case would be appreciated. Thanks in advance!

    Read the article

  • SKProductsRequest delegate methods are never called.

    - by coneybeare
    This used to work for me but is now not working anymore and I can't figure out why. I have in-app purchase setup in my app. I confirmed that I have a correct set of product identifiers, matched by corresponding in-app purchase items in itunesconnect. The call goes out to Apple view [productRequest start], but I never get a response back, despite setting the delegate to myself. What am I missing? NSLog(@"productIdentifiersSet: %@", productIdentifiersSet); if ([productIdentifiersSet count]) { SKProductsRequest *productRequest = [[SKProductsRequest alloc] initWithProductIdentifiers:productIdentifiersSet]; [productRequest setDelegate:self]; [productRequest start]; } ……… - (void)productsRequest:(SKProductsRequest *)request didReceiveResponse:(SKProductsResponse *)response { <never called> } - (void)requestDidFinish:(SKRequest *)request { <never called> } - (void)request:(SKRequest *)request didFailWithError:(NSError *)error { <never called> }

    Read the article

< Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >